ID: 932814729

View in Genome Browser
Species Human (GRCh38)
Location 2:74852585-74852607
Sequence GGGCTAGTGCCCCACAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932814722_932814729 2 Left 932814722 2:74852560-74852582 CCCAGCTTGTGGGATGGAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932814729 2:74852585-74852607 GGGCTAGTGCCCCACAGCCCTGG 0: 1
1: 1
2: 1
3: 18
4: 216
932814716_932814729 16 Left 932814716 2:74852546-74852568 CCAGAGATCAGAGACCCAGCTTG 0: 1
1: 0
2: 0
3: 26
4: 193
Right 932814729 2:74852585-74852607 GGGCTAGTGCCCCACAGCCCTGG 0: 1
1: 1
2: 1
3: 18
4: 216
932814723_932814729 1 Left 932814723 2:74852561-74852583 CCAGCTTGTGGGATGGAGGGTGG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 932814729 2:74852585-74852607 GGGCTAGTGCCCCACAGCCCTGG 0: 1
1: 1
2: 1
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932814729 Original CRISPR GGGCTAGTGCCCCACAGCCC TGG Intronic