ID: 932816430

View in Genome Browser
Species Human (GRCh38)
Location 2:74865677-74865699
Sequence ATTTCCTGCCCAGTGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932816430_932816437 18 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816437 2:74865718-74865740 AGGAGGAATGCTGCCGTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 116
932816430_932816433 1 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816433 2:74865701-74865723 GAAAATTAGTGCCCCTAAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 76
932816430_932816432 -2 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816432 2:74865698-74865720 ATGGAAAATTAGTGCCCCTAAGG 0: 1
1: 1
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932816430 Original CRISPR ATTTCCTGCCCAGTGACTAG AGG (reversed) Intronic