ID: 932816430

View in Genome Browser
Species Human (GRCh38)
Location 2:74865677-74865699
Sequence ATTTCCTGCCCAGTGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932816430_932816437 18 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816437 2:74865718-74865740 AGGAGGAATGCTGCCGTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 116
932816430_932816433 1 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816433 2:74865701-74865723 GAAAATTAGTGCCCCTAAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 76
932816430_932816432 -2 Left 932816430 2:74865677-74865699 CCTCTAGTCACTGGGCAGGAAAT 0: 1
1: 0
2: 4
3: 12
4: 135
Right 932816432 2:74865698-74865720 ATGGAAAATTAGTGCCCCTAAGG 0: 1
1: 1
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932816430 Original CRISPR ATTTCCTGCCCAGTGACTAG AGG (reversed) Intronic
900186527 1:1335709-1335731 ATTGCCTGGCCGGTGACTCGGGG - Exonic
901762933 1:11482276-11482298 AGGTCCTGCCCAGTGAGTAGGGG + Intronic
902201277 1:14835673-14835695 ATTTCCCTTCCAGTGACAAGTGG - Intronic
906863018 1:49382118-49382140 ATTTACTTCTCAGTGCCTAGTGG - Intronic
907409316 1:54273612-54273634 ATCTCCTGGCCAGTGAAAAGAGG - Intronic
907738150 1:57136458-57136480 TATTCCTGCCCAGAGAGTAGAGG + Intronic
908228894 1:62084556-62084578 ATTTCCTGTCCAGGGACAATGGG - Exonic
908842472 1:68293854-68293876 ATTTCCTGCCCAGGCACTAACGG + Intergenic
909052196 1:70779690-70779712 ATTTCCTGTGCAGTCCCTAGTGG + Intergenic
909966725 1:81921858-81921880 ATTTGCTGCCAAATGATTAGTGG + Intronic
910758079 1:90712090-90712112 ATTTCCAGCCCTGTTTCTAGGGG + Exonic
912260432 1:108106945-108106967 ATTTCCTGCCCACTGTCTCCTGG + Intergenic
912614679 1:111086018-111086040 AGTTCCTACCCAGTGAGAAGTGG + Intergenic
914705804 1:150169012-150169034 ATTTCAGGCCCTGTGTCTAGTGG - Intergenic
914921115 1:151848029-151848051 GTGTCCTGGCCAGGGACTAGAGG + Intronic
915099470 1:153488800-153488822 ATTTCCTTCCTAGTGACTCCAGG - Intergenic
915511221 1:156388131-156388153 ATTTCCTGCCCAGGGACATCTGG + Intergenic
919932583 1:202230932-202230954 ATCTCCTGCCCAGTCTCTTGAGG - Intronic
919941032 1:202286340-202286362 ATTATTTGCCCAGTGACTAGTGG - Intronic
923671445 1:236044803-236044825 TTTTCCTTCACATTGACTAGGGG - Intronic
924141243 1:241026175-241026197 TTTGCCTTCCCAGTGTCTAGTGG + Intronic
924627835 1:245710456-245710478 ATATCCTTCCCAGAGACGAGAGG - Intergenic
1067941493 10:50660481-50660503 ATGGCCTGCCCAGAGACTCGGGG + Intergenic
1071921841 10:90359151-90359173 CTTTTCTGCCCAGTGACCACAGG - Intergenic
1074082897 10:110181803-110181825 AGTCCCTGCTCAGTGACTAGTGG + Intergenic
1074565017 10:114569697-114569719 GTTACCTTCCCAGTGACCAGAGG + Intronic
1075992609 10:126850479-126850501 ACTTGGTGCCCAGTGACAAGTGG - Intergenic
1077936304 11:6790822-6790844 AATTCCTCCTCAGTGACAAGAGG + Intergenic
1079356962 11:19737752-19737774 ATATCGTGCCCAGTGAATGGTGG + Intronic
1080574344 11:33584465-33584487 ATTTCTTTCCCAGTCACTGGAGG - Intronic
1083342254 11:61966579-61966601 ATTTCTTGCCCAGTAACTGTCGG + Intronic
1083624337 11:64064424-64064446 ATTGCCTGCCCAGTGCCCAGAGG - Intronic
1089647461 11:119889641-119889663 ACTTCCTGCCCGGGGACTGGAGG - Intergenic
1093090900 12:14919102-14919124 ATTTTCTGCCCAGTTGCTACTGG + Intronic
1095369818 12:41453622-41453644 GTTTTCTGTCCTGTGACTAGTGG + Intronic
1096424767 12:51491872-51491894 TTTTACTGACCAGTGACTTGAGG + Intronic
1102188185 12:110965783-110965805 ATTTCCAGCCCAGTGATTTCAGG + Intergenic
1104108175 12:125682897-125682919 ATCTCTTTCCCAATGACTAGAGG + Intergenic
1107171824 13:37351781-37351803 ATTTTCTTCCCATTGACTATAGG + Intergenic
1109714560 13:66204555-66204577 ATTTCCTGCCCCTTGAACAGGGG + Intergenic
1111004026 13:82225234-82225256 ATTTACTGCCCATTCAGTAGTGG - Intergenic
1113113877 13:106854204-106854226 ATTTTCTGCCCAGTCCTTAGAGG - Intergenic
1113924726 13:113935140-113935162 GTTTCCTGGCCAGTGGCGAGAGG + Intergenic
1113931623 13:113971840-113971862 ATTTCCAGCCCTGTGACCCGAGG - Intergenic
1114532879 14:23406361-23406383 TTTGCCTGCACAGTGACTAGCGG + Intronic
1115457260 14:33617939-33617961 AGTTCCTACGCAGTTACTAGTGG - Intronic
1120011195 14:79416973-79416995 ATTTCCTGCTCAGTCTGTAGTGG + Intronic
1122061619 14:99140061-99140083 ATTTCCCACCCAGGGACTTGGGG + Intergenic
1123847304 15:24315563-24315585 ATTTTCAGCCCTGTGACTATAGG + Intergenic
1123866299 15:24522630-24522652 ATTTTCAGCCCTGTGACTATAGG + Intergenic
1125509560 15:40285609-40285631 CATTCCTGCCCAGTTACTGGGGG - Intronic
1126180882 15:45783987-45784009 ATTTCTTGGCCTGTGCCTAGGGG + Intergenic
1127756433 15:62097070-62097092 AATTCCTGCCCAGTGACTGGAGG - Intergenic
1127820217 15:62648295-62648317 CTTTCCTGCCCTGAGACTACAGG - Intronic
1129159889 15:73741291-73741313 CTTCCCTGCCCACTGACAAGTGG + Intronic
1129654665 15:77516082-77516104 ATACCTTGCCCAGTGTCTAGGGG - Intergenic
1130904756 15:88232594-88232616 CTTTCCAGCCAAGTGTCTAGAGG - Intronic
1131689973 15:94816146-94816168 AACTCCTGCCCAGTGACCTGTGG + Intergenic
1132350474 15:101136712-101136734 ATCTCCTGAACAGTGACTATGGG + Intergenic
1134037940 16:11045980-11046002 ATTTCCTCCTCAGTGTGTAGGGG - Intronic
1134204205 16:12223849-12223871 ATTTCATGGCCAGTGGCTCGTGG + Intronic
1134209616 16:12265171-12265193 ATTTCCTGCCCTGAAACAAGTGG - Intronic
1138765829 16:59602079-59602101 ATAACCTGCCCAGGGACTGGGGG + Intergenic
1139527292 16:67524818-67524840 ATTTCCAGCCCAGTGGATGGTGG - Intronic
1140122232 16:72093717-72093739 TTTTCCTGCCCCCAGACTAGAGG + Exonic
1143611568 17:8020749-8020771 AGGTCCTGCCCAGAGACCAGTGG - Intergenic
1147649263 17:42052867-42052889 ATTGTCTGCCCCGTGACTTGGGG - Intronic
1150783843 17:68146553-68146575 ATTTCCTTCCCAGTACTTAGAGG - Intergenic
1150994913 17:70306427-70306449 ATTTCCTGCTCAGTGTCTCCTGG - Intergenic
1155176635 18:23306925-23306947 GTTTCCTTCCCTGTGACCAGGGG - Intronic
1157037951 18:43999256-43999278 ATCTCATGTCCAATGACTAGAGG - Intergenic
1157119229 18:44893252-44893274 ATTTACTGGCCACTGACTAAAGG + Intronic
1157412497 18:47475214-47475236 ATTTCCTGCCCTGGGAAGAGAGG - Intergenic
1158621443 18:59036009-59036031 CTTTCCAGGCCAGTGTCTAGTGG + Intergenic
1159450277 18:68592405-68592427 ATTTCCAGCACAGTCTCTAGTGG - Intergenic
1159776075 18:72604320-72604342 ATTTCCTGCACAGTAAGGAGTGG + Intronic
1161384732 19:3984994-3985016 ATTTTCTGCCGGGGGACTAGGGG - Intronic
1161836967 19:6654407-6654429 ATTTCCTGCCCAGGGGGTGGGGG + Intergenic
1162489953 19:10986148-10986170 ATATGCTGCCGAGTGACCAGTGG + Intronic
1166630540 19:44402518-44402540 ATTTCCTGCCCATTGCGTAGAGG - Intergenic
925237455 2:2292170-2292192 AATTCCTGCAGAGTGACTGGGGG + Intronic
926840705 2:17077235-17077257 TTATTCTGCCCAGTGACTTGGGG + Intergenic
929966139 2:46538479-46538501 TTTTTTTGCCCAGTGAGTAGGGG - Intronic
932816430 2:74865677-74865699 ATTTCCTGCCCAGTGACTAGAGG - Intronic
934073875 2:88410531-88410553 GTTCCCTGCCCAGTGGCTGGAGG - Intergenic
935148768 2:100415102-100415124 TTTTCCTATCCAGTGACAAGAGG - Exonic
935340193 2:102052923-102052945 ATTTCCAGCCATGTGACTACTGG - Intergenic
938543128 2:132303190-132303212 ATTTCCTGCCCATTGCCTAGAGG + Intergenic
941092441 2:161193693-161193715 ATTTCCTTGCCAGTGAGAAGGGG + Intronic
941198599 2:162480929-162480951 TTTTCAAGCCCAGTGAATAGGGG - Intronic
941864150 2:170316479-170316501 ATTTCCTGCCCAGGCATAAGTGG - Intronic
942616390 2:177795614-177795636 ATTCCCTGCCCAGTGGAAAGAGG - Intronic
947043464 2:225950045-225950067 ATGTCATGCCCATTGCCTAGGGG + Intergenic
947120180 2:226805781-226805803 AGATCCTGCCCACTGAATAGAGG - Intergenic
947446396 2:230166838-230166860 ATTTCCTGCCCTGGGATTAGGGG + Intergenic
1169350112 20:4861938-4861960 ATTTCCTCACCTGTGACCAGAGG + Exonic
1171872012 20:30536024-30536046 ATTTCCTGCCCATTGCCTAGAGG + Intergenic
1178483554 21:33002418-33002440 AAGTCCAGACCAGTGACTAGAGG - Intergenic
1179077834 21:38140725-38140747 ATTTACTGCCCAGTGGCTAAAGG - Intronic
1181762845 22:25069760-25069782 ATTTCCTTCCCTGTAACGAGTGG + Intronic
1184044859 22:41966700-41966722 ACTTCCTGCCCAGTAATTACAGG - Intergenic
1184143676 22:42595541-42595563 ATGTCCTCCTCAGTGACTCGAGG + Exonic
949501144 3:4681047-4681069 TTTCCCTGCCCAGGAACTAGTGG + Intronic
951141854 3:19171399-19171421 ATTTATTTCTCAGTGACTAGAGG + Intronic
959205928 3:103306540-103306562 ATTTTCTGGCCAGTCACTAAAGG - Intergenic
964863775 3:161231250-161231272 ATTTGGTGCCCAGGAACTAGAGG + Intronic
965780198 3:172277859-172277881 ATTACCTGCCTAGTGGCTATAGG + Intronic
968913619 4:3487722-3487744 ATTTCCCGTCCAGTAACTGGTGG - Intronic
979749024 4:124253238-124253260 ATTTCCAGGCCAGTGATTATTGG + Intergenic
982463086 4:155695421-155695443 ATTTCCTGTTCATTGGCTAGTGG - Intronic
985938082 5:3111880-3111902 ATTTCATTCCAAGTGATTAGTGG + Intergenic
986651505 5:9967863-9967885 ATTTGCTCCCCAATGACCAGTGG + Intergenic
988994032 5:36697463-36697485 ATTTCCTGCCCAGTGTCTAAAGG + Intergenic
994741859 5:103628910-103628932 ATTTCCTGCAGAGTGACAGGTGG + Intergenic
1001086071 5:168700852-168700874 TCTTACTGTCCAGTGACTAGGGG - Intronic
1002395923 5:178954315-178954337 AATTCCTGCCCATTGACTCTAGG + Intronic
1002844853 6:937201-937223 ATTTCCTGCCCGGGCAGTAGTGG - Intergenic
1005306334 6:24517711-24517733 ATTTCCTGTTCAGTCACTAGAGG - Intronic
1007755182 6:44094878-44094900 AGTTCCTGTTCAGTGAGTAGAGG - Intergenic
1010043169 6:71410909-71410931 CTTTCCTCCCCAGAGACAAGAGG - Intergenic
1010619855 6:78061106-78061128 CTTTCCAGCCTAGAGACTAGAGG + Intergenic
1012544092 6:100396517-100396539 GTTTCCTGCCTATTGACAAGAGG - Intronic
1018028853 6:159826367-159826389 AGTCCCTGCCCACTGTCTAGTGG + Intergenic
1020450425 7:8315330-8315352 ATTTGCTGCTTAGAGACTAGAGG - Intergenic
1021231701 7:18093052-18093074 ATTTGTGGCCCAGTGACTATAGG + Intronic
1026548414 7:71345546-71345568 ATGTCATGCCCAGTGAACAGAGG + Intronic
1028115717 7:86995228-86995250 TTTTCCTTCACAGTGATTAGAGG - Intronic
1028968068 7:96825244-96825266 AGTTCCTGCCCAGTGAATAATGG - Intergenic
1029419932 7:100467214-100467236 ATCCCCTGCCCAGTGCCTTGAGG + Intronic
1035999138 8:4582479-4582501 ATTTCCTGCCTGGTGCCTGGAGG - Intronic
1036280008 8:7392727-7392749 AAATTCTGCCCAGTGACCAGGGG - Intergenic
1036341517 8:7919156-7919178 AAATTCTGCCCAGTGACCAGGGG + Intergenic
1039202295 8:35109429-35109451 ATTTCCTCCCCCTTGACAAGAGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1045046021 8:98279176-98279198 TTTTCCTCCCCAGTAATTAGGGG - Intronic
1048189614 8:132275983-132276005 ATTTACTGACCACTTACTAGGGG + Intronic
1048339378 8:133526970-133526992 TTTTCTTGTCTAGTGACTAGGGG - Intronic
1051967728 9:22848833-22848855 GTTTCTTACCCACTGACTAGGGG + Intergenic
1052450956 9:28630653-28630675 CATTCCTGGCCATTGACTAGTGG - Intronic
1052935354 9:34088540-34088562 TTTTCCTGCCCCATGGCTAGAGG - Intronic
1053116567 9:35509446-35509468 ATTTCCTGCCCAATGAACACGGG - Intronic
1055829613 9:80362318-80362340 TTTTCTTGTCCAGTGAGTAGAGG + Intergenic
1058166584 9:101626061-101626083 ATTTCCTCACCAGTGACTCAGGG - Intronic
1058178542 9:101767532-101767554 ATCTCTTGCCCACTGAGTAGTGG - Intergenic
1059744767 9:117189211-117189233 ATTTGCTGCCTAGTGGGTAGTGG - Intronic
1060384937 9:123216568-123216590 ATTTGCTTCTCAGTGACTAAAGG - Intronic
1060555545 9:124505626-124505648 ATTTCCAGCCCAGCGACCTGAGG - Intronic
1186692280 X:11990964-11990986 TTTTTCTGGCCAGTGAATAGAGG + Intergenic
1187225087 X:17368016-17368038 ATTTCCTGCCTACTGACTTTGGG - Intergenic
1193277314 X:79604595-79604617 ATTGCCTGCCCAGCTACCAGTGG - Intergenic
1195791825 X:108596518-108596540 ATTTGCAGCCCAAAGACTAGAGG - Intronic
1198408327 X:136339102-136339124 CTTTCCTGTCCAGAGACTAGCGG - Intronic