ID: 932816991

View in Genome Browser
Species Human (GRCh38)
Location 2:74870046-74870068
Sequence CGTGACACCCAAGAGTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932816991 Original CRISPR CGTGACACCCAAGAGTGCGG TGG Intronic
901877261 1:12173985-12174007 CGTGAGCCCCAAGTGTGCAGGGG + Intronic
903019324 1:20382933-20382955 CATTACACCCAGGAGGGCGGCGG + Intergenic
905839400 1:41162168-41162190 CTGGACCCCCAAGAGTGCAGGGG - Intronic
907452050 1:54551787-54551809 TCTGTCACCCAGGAGTGCGGTGG + Intronic
910115555 1:83727988-83728010 AGTGACAACCAAGAGTGAGGAGG - Intergenic
1064297917 10:14094950-14094972 TGTGTCAACCAAGAGTGTGGGGG + Intronic
1066673337 10:37862591-37862613 CTTGTCACCCAGGAGTGCAGTGG + Intergenic
1076645855 10:131953652-131953674 AGTGACTTCCAAGTGTGCGGGGG + Intronic
1081546809 11:44077639-44077661 CATGACACCCAAGAGTGATGAGG + Intronic
1083921388 11:65782836-65782858 CTGGACACCCAAGAGGGCCGAGG - Intergenic
1100540712 12:95554902-95554924 CCTGCCACCCAGGAGTGCAGTGG + Intergenic
1102527178 12:113520309-113520331 AATGACCCCCAAGAGCGCGGAGG - Intergenic
1111218418 13:85174426-85174448 CCTGTCACCCAGGAGTGCAGTGG - Intergenic
1112712330 13:102143841-102143863 TGTGACAGCCAAGAGAGAGGAGG - Intronic
1113614639 13:111671577-111671599 AGAGACACCCAGGAGTGGGGAGG + Intronic
1113977244 13:114237327-114237349 TGTGTCACCCAGGAGTGCAGTGG + Intronic
1116446493 14:45017843-45017865 CTTGTCACCCAGGAGTGCAGTGG - Intronic
1125155494 15:36580043-36580065 CGTGTCACACATGAGTGGGGAGG + Intronic
1125502600 15:40248736-40248758 CGTGAGACACAAGAGGGCTGGGG - Intronic
1132581010 16:684588-684610 CGTGTCACCCCATAGCGCGGCGG - Intronic
1132664023 16:1073482-1073504 CCTGAAACCCAAGACTGGGGAGG + Intergenic
1134055413 16:11166853-11166875 TGTGACACCTAAGACTGTGGAGG - Intronic
1134108872 16:11502203-11502225 TGAGACACCCAGCAGTGCGGGGG + Intronic
1135664957 16:24327900-24327922 TGTGACACTCAGGAGTGCAGTGG - Intronic
1138007423 16:53350837-53350859 GGAGACTCCCAAGAGTGAGGTGG + Intergenic
1141290424 16:82713464-82713486 AGGGACACCCAACAGTGCTGGGG - Intronic
1143797167 17:9346425-9346447 CATGACACACCAGAGTGCTGAGG - Intronic
1149952324 17:61003018-61003040 AATGACACCCGAGAGTGGGGAGG - Intronic
1164561912 19:29298374-29298396 GGAGACACCCAAGGGTGGGGAGG + Intergenic
1165200656 19:34141889-34141911 TCTGTCACCCAGGAGTGCGGTGG + Intergenic
1165725636 19:38110715-38110737 GGTGACCCCCAGGAGGGCGGTGG - Intronic
1168384622 19:55952885-55952907 TCTGTCACCCAAGAGTGCAGTGG - Intronic
932816991 2:74870046-74870068 CGTGACACCCAAGAGTGCGGTGG + Intronic
938851577 2:135266167-135266189 TGTGTCACACAGGAGTGCGGTGG - Intronic
942901886 2:181129847-181129869 CTGGACACCGAAGAGTGAGGAGG - Intergenic
943574034 2:189609768-189609790 CATTACCCCCAAGAGTCCGGAGG - Intergenic
1175195939 20:57243437-57243459 TGTGTCACCCAGGAGTGCAGTGG - Intronic
1179661794 21:42880674-42880696 AGGGACACCCAAGAGGGCAGAGG - Intronic
1180016144 21:45085665-45085687 CGTGACAACAAAAAGTGCAGAGG - Intronic
951213990 3:20006520-20006542 TGTGTCACCCAGGAGTGCAGTGG + Intronic
954543085 3:51409031-51409053 CGTGACAGCCAAGAGTGAGAGGG - Intronic
955897130 3:63712432-63712454 CCTGTCACCCAGGAGTGCAGTGG - Intergenic
964535510 3:157716841-157716863 CTTGAAACCCAAGGCTGCGGTGG + Intergenic
966890049 3:184400611-184400633 CCTGTCACCCCAGAGTGCAGTGG - Intronic
967322102 3:188204805-188204827 AGTGACACCCAAGACTGTGGAGG - Intronic
968492840 4:899686-899708 CGTGGCATCCAAGAGTGCAAGGG + Intronic
993670581 5:90756530-90756552 CAGGACAGCCAAGTGTGCGGAGG + Exonic
1007092095 6:39190827-39190849 CGGGACACCCTAGGGTGAGGGGG + Exonic
1011785380 6:90837724-90837746 CCTGAGAACCAAGAGTGCTGAGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1034866562 7:154647305-154647327 AGTGACACCCAGGATTGCCGTGG + Intronic
1043198035 8:77325240-77325262 CCTGAGAACCAAGAGTGCTGAGG + Intergenic
1053439591 9:38105300-38105322 CCTGTCACCCAGGAGTGCAGTGG + Intergenic
1061116290 9:128614737-128614759 TCTGTCATCCAAGAGTGCGGTGG - Intronic
1061553666 9:131352567-131352589 TGTGTCACCCAGGAGTGCAGTGG - Intergenic
1061600942 9:131669649-131669671 CATGACACCCAAGCATGCAGAGG + Intronic
1061726934 9:132587199-132587221 CGCGACACCCAAGCTCGCGGGGG - Intronic
1062034835 9:134378395-134378417 CTTGCCACCCAAGAGGGCTGTGG + Intronic
1185521587 X:744023-744045 CCTGAGACCCAGGAGAGCGGAGG - Intergenic
1187663342 X:21574516-21574538 GGTGACAGCCAAGAGTGAAGGGG + Intronic
1188153121 X:26703949-26703971 AGTGACACCCAAGGGAGCTGTGG + Intergenic
1190875117 X:54454608-54454630 TCTGTCACCCAGGAGTGCGGTGG - Intronic