ID: 932817575

View in Genome Browser
Species Human (GRCh38)
Location 2:74874192-74874214
Sequence CAGTAGTATAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932817559_932817575 30 Left 932817559 2:74874139-74874161 CCCCAGAGTCTGCAGTGAGAAAT 0: 1
1: 0
2: 0
3: 28
4: 317
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817565_932817575 7 Left 932817565 2:74874162-74874184 CCCAGCCATCCTGGCCGGGCAGT 0: 1
1: 0
2: 0
3: 11
4: 136
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817561_932817575 28 Left 932817561 2:74874141-74874163 CCAGAGTCTGCAGTGAGAAATCC 0: 1
1: 0
2: 0
3: 14
4: 179
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817567_932817575 2 Left 932817567 2:74874167-74874189 CCATCCTGGCCGGGCAGTCTCGG 0: 1
1: 0
2: 3
3: 10
4: 134
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817571_932817575 -7 Left 932817571 2:74874176-74874198 CCGGGCAGTCTCGGGACAGTAGT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817570_932817575 -2 Left 932817570 2:74874171-74874193 CCTGGCCGGGCAGTCTCGGGACA 0: 1
1: 0
2: 0
3: 8
4: 93
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817566_932817575 6 Left 932817566 2:74874163-74874185 CCAGCCATCCTGGCCGGGCAGTC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254
932817560_932817575 29 Left 932817560 2:74874140-74874162 CCCAGAGTCTGCAGTGAGAAATC 0: 1
1: 0
2: 1
3: 17
4: 194
Right 932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932817575 Original CRISPR CAGTAGTATAAGAGGGAAGA GGG Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
904214838 1:28911074-28911096 CAGAAGTCTGAGAGGGCAGATGG + Intronic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905963769 1:42070575-42070597 GGGTAGTATAAGAAGCAAGAAGG + Intergenic
907212933 1:52838727-52838749 CAGTAGAATATGAGGAAAAAAGG + Intergenic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
910785340 1:90991657-90991679 CAGGAGAATAAGAGTGAAGGGGG + Intronic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
913687083 1:121242669-121242691 CAGAAGTATGCAAGGGAAGATGG + Intronic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914038941 1:144030307-144030329 CAGAAGTATGCAAGGGAAGATGG + Intergenic
914150512 1:145037620-145037642 CAGAAGTATGCAAGGGAAGATGG - Intronic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
914444037 1:147734347-147734369 GATTAGTATAAGAGGAAGGAAGG - Intergenic
916822040 1:168409293-168409315 CAGCAGCATAAAAGGGAAGGAGG + Intergenic
916919791 1:169452359-169452381 CAGTAGTTTAAGTGGAATGATGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
920343107 1:205288075-205288097 GAGAACTATAAGAGGGAAGCAGG - Intergenic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920474411 1:206261190-206261212 CAGAAGTATGCAAGGGAAGATGG + Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
924069809 1:240264864-240264886 CAATAATATCAGAGGGAAGGAGG - Intronic
924131846 1:240917458-240917480 CAATATTATAAGAGATAAGAAGG + Intronic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
1063688490 10:8260969-8260991 CAGTTATTTAAGAGTGAAGACGG + Intergenic
1065885666 10:30074768-30074790 CAGTAGTATAATATGGGGGATGG - Intronic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1068161544 10:53271591-53271613 CAGTTGTATAAGGGGGCTGAAGG - Intergenic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1070079985 10:73176507-73176529 AAGTAATAGAACAGGGAAGATGG + Intronic
1071932403 10:90487139-90487161 CATTAATATAAGGGTGAAGAGGG - Intergenic
1073194034 10:101673439-101673461 CCGAAGTATAAGATGGAAAAGGG + Intronic
1074264692 10:111889819-111889841 AAGAAATATAAGAGGGAGGATGG - Intergenic
1076102035 10:127790310-127790332 AAGTTGTATGAGAGGGAGGAGGG - Intergenic
1076262761 10:129081095-129081117 CAACAGTATAAAAGAGAAGAGGG + Intergenic
1077965848 11:7132296-7132318 AAGTAGTCTAGTAGGGAAGATGG + Intergenic
1078012556 11:7584110-7584132 CTGTAGTATTACAGGGAATAAGG - Intronic
1078181781 11:9017708-9017730 CAGTAATATAACAGTGAAAAGGG - Intergenic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1078883423 11:15476104-15476126 CAGTAGTATAAGAGATAAAAAGG + Intergenic
1079112528 11:17612809-17612831 GACTAGGATAAGAGGGGAGACGG + Intronic
1079231114 11:18649559-18649581 CAGTAGTGTGAAAGGGAAGCTGG + Intergenic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1080124052 11:28710553-28710575 AAGGAGTATAACAGGGAATAGGG + Intergenic
1080362938 11:31537146-31537168 TACTAGTACAAGAGGTAAGATGG + Intronic
1081199356 11:40198020-40198042 AAGTAGGATAAGTGGGAAGATGG + Intronic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1085899871 11:80686251-80686273 AGGTAGTATAAGGGGTAAGAAGG - Intergenic
1086021078 11:82230318-82230340 CAGTAGTATTAGAAGAAAAATGG + Intergenic
1086193153 11:84104409-84104431 GGGAAATATAAGAGGGAAGAAGG + Intronic
1086217817 11:84404982-84405004 CACTATTATAATAGGGAAAAGGG + Intronic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1087841640 11:102926764-102926786 GACTAGTATAAGATGGAAGCAGG + Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1090819323 11:130326813-130326835 CACTAGTAGAAGAGGGAAAGGGG - Intergenic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091756993 12:3060084-3060106 AAGGAGTATAAAAGTGAAGATGG - Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1095518060 12:43029050-43029072 CAGGAGTCTAAGAGGGTAGAAGG + Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1098986956 12:77022933-77022955 CAGAAGAGTAAGAGGGAAAATGG - Exonic
1099228640 12:79997773-79997795 CAGTATTATAAGATTGGAGATGG - Intergenic
1099257495 12:80331901-80331923 CAATAGAATCAGAGGAAAGAAGG + Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1101154543 12:101915313-101915335 CTTTAGTAAAAGAGGGTAGAGGG + Intronic
1101266401 12:103092917-103092939 CAGAAGTGAAACAGGGAAGAGGG - Intergenic
1101473348 12:105020142-105020164 GAGTAGGATATGAGGGATGATGG - Exonic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1104203741 12:126616820-126616842 TAGTCGTATCAGATGGAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1108069055 13:46608627-46608649 TAGTAGTAAAAGAGGAAACAGGG - Intronic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1111248082 13:85568390-85568412 AATTTGTATAAGAGAGAAGAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112239429 13:97666493-97666515 CAGTAGACTGAGAGAGAAGATGG - Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114724519 14:24921537-24921559 CTTTACTATAAGAGGGTAGAAGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1120503473 14:85325374-85325396 CAGTAGTATAACAAGGTAGGTGG - Intergenic
1120781762 14:88491988-88492010 AATAAGTAAAAGAGGGAAGAGGG - Intronic
1121076458 14:91073052-91073074 TAGAAGGATAAGATGGAAGATGG + Intronic
1121081896 14:91115037-91115059 CCGTAGTAAAAGAGGACAGAGGG - Intronic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1123413541 15:20078965-20078987 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1123522883 15:21086077-21086099 TTGTAGTATAAGAGGAAGGAAGG + Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125384607 15:39124042-39124064 CAGAAGTAGAAGTGGGAATAAGG + Intergenic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1126303202 15:47223060-47223082 CAGGAGTATAAGATGGAACCTGG - Intronic
1126645107 15:50867925-50867947 CAGTAGTTTAAGGGGTGAGATGG + Intergenic
1126776260 15:52103184-52103206 CATTATTATAAAAGGAAAGAAGG - Intergenic
1127293244 15:57588895-57588917 CAGAGATATAAGAGTGAAGAGGG + Intergenic
1127309019 15:57735544-57735566 TGGTAGTAAAAGCGGGAAGATGG + Intronic
1129820142 15:78595205-78595227 TGGTAGTATAAGAGGGATCAGGG - Exonic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130702114 15:86194695-86194717 AGTTAGTATAAGAGGGAAGATGG + Intronic
1130895517 15:88167502-88167524 CACTAGTAAAACAGGGATGATGG + Intronic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137595904 16:49723623-49723645 CAATAGTATCAGAGTGAGGAAGG - Intronic
1138024170 16:53509937-53509959 CAGTCTTATAAGTGGGAAGTAGG - Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138361295 16:56430598-56430620 CAGTATTAGAAGAGGGTATAAGG - Exonic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139608808 16:68039978-68040000 TTGTAGTATAAGAGGAAGGAAGG + Intronic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1157070965 18:44407846-44407868 AAGTAGTAAAAGAGGAAAAAAGG + Intergenic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1160295706 18:77634770-77634792 CACTAGTGAAATAGGGAAGATGG - Intergenic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167818619 19:51906132-51906154 GATTAGTATAAGAGGAAGGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1168539956 19:57201961-57201983 CAGCAGTATGGGAGGCAAGAGGG + Intronic
925343795 2:3155429-3155451 CAGTAGATTAAGTGGGGAGACGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
927271698 2:21217216-21217238 GAGAAGTGTAAGAGGAAAGAGGG + Intergenic
927628145 2:24745785-24745807 CAGAACTATAAAAGGGAACATGG - Intronic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928615911 2:33039446-33039468 ATGTAGTATAAGAGGTAAGAAGG - Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929391888 2:41478590-41478612 CTGTAGGATAGAAGGGAAGATGG - Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933478182 2:82819212-82819234 GAGTGGTATAAGAGTGAGGATGG - Intergenic
933639687 2:84746269-84746291 TAATAGAATAAGAGGAAAGATGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934467972 2:94283487-94283509 AGGAAGAATAAGAGGGAAGAAGG - Intergenic
934559293 2:95304289-95304311 CAGTACTGTAAGTGGGAAGCCGG + Intronic
934817856 2:97345738-97345760 CAGGACTATAAGAAGGGAGATGG - Intergenic
934819840 2:97362746-97362768 CAGGACTATAAGAAGGGAGATGG + Intergenic
939142634 2:138373865-138373887 CAGAAGTAGAAGAGAGTAGAAGG - Intergenic
940163436 2:150740071-150740093 CAGCAGTATAACGTGGAAGAGGG + Intergenic
940439139 2:153693641-153693663 CAGGAGGATAAGGGGGAAAAAGG + Intergenic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
942672271 2:178388731-178388753 CAGAAGTATGGGAGGGTAGATGG - Intronic
946138309 2:217666459-217666481 CAGTAGCCTAGGAGGAAAGATGG + Intronic
946610380 2:221451318-221451340 CATTACTATAAAAGGGAAGAGGG + Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
1171938466 20:31300107-31300129 CAGAAGAATAAAAGGAAAGATGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1177244718 21:18508437-18508459 AAGTAGTATGAGAGGGATCATGG + Intergenic
1179488686 21:41726955-41726977 CAGGAGTAGAAGAGGTTAGAAGG + Intergenic
1180679183 22:17612551-17612573 CAGTAGTACATGAGGGTACAGGG - Intronic
1181400927 22:22649857-22649879 GATTAGTATAAGAGGAAGGAAGG - Intergenic
1181702905 22:24630949-24630971 GATTAGTATAAGAGGAAGGAAGG - Intergenic
949833985 3:8248153-8248175 CAGTACTATGAGAAGGATGAAGG - Intergenic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
951942662 3:28097619-28097641 CAATAGTAAAAGAGGAAAGGAGG - Intergenic
953595729 3:44311043-44311065 CAGGAGTTTAGGTGGGAAGATGG + Intronic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
957756322 3:84492774-84492796 AAGTAGAAAAAGAGGGAACATGG + Intergenic
961706041 3:128786022-128786044 CAGTAGTCTGACAAGGAAGAAGG - Intronic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
963718774 3:148835590-148835612 CACTTGCATAAGAGGGAAGGAGG + Intronic
966909274 3:184549704-184549726 CAGTTGTTTAAGATGGAAGCAGG + Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969897148 4:10316089-10316111 CTTTAGTATAAAAGGGGAGACGG + Intergenic
970164409 4:13221364-13221386 CAAATGTAAAAGAGGGAAGAGGG + Intergenic
971272468 4:25163480-25163502 GAGTAATAAAAGAGGGAAGCTGG - Intronic
972169577 4:36328806-36328828 CAGTAGGAAAATAGGGAATAGGG - Intronic
972841509 4:42935404-42935426 CAGAAGTATAGGAAGGAAGAGGG + Intronic
973703577 4:53560053-53560075 TAATAGTATAGGAGGAAAGAAGG - Intronic
974557981 4:63476966-63476988 CAGTAGTATAAGATACAACAGGG - Intergenic
974777753 4:66508835-66508857 CAGTACTATAAAAGTGAAAAGGG + Intergenic
974803664 4:66852432-66852454 CAGTAGTATAATAGGCAAATAGG + Intergenic
975204859 4:71633378-71633400 AAGTAATATAAGAGGTCAGAAGG + Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
983257192 4:165413158-165413180 GGGTAGAGTAAGAGGGAAGAGGG - Intronic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
986269357 5:6217757-6217779 CCGCAGCATAAGAGGGAAGAAGG - Intergenic
987742901 5:21933367-21933389 CAGTGTTCTAAGAGGGAACAGGG + Intronic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
991464131 5:66892308-66892330 CAGTAATACAAAAGGGAGGAGGG - Intronic
992112704 5:73511234-73511256 AAGAAGCAGAAGAGGGAAGAGGG - Intergenic
992760567 5:79947849-79947871 CAGTAGTTTAGGAGGGAGGGGGG + Intergenic
993207840 5:84907698-84907720 CAGTAATATAAGAGCTGAGAAGG + Intergenic
996541998 5:124640198-124640220 CAGTAGCATAAGAGGCAACTTGG + Intronic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
998319890 5:141219390-141219412 CAATAGTATGGGAGGGAAAAGGG + Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1003005784 6:2380332-2380354 CTGCAGTTTAATAGGGAAGATGG - Intergenic
1006100232 6:31681801-31681823 CAGGATGATAAGGGGGAAGATGG + Intronic
1006967042 6:37998225-37998247 CATTAGTATGACATGGAAGATGG + Intronic
1007997602 6:46325222-46325244 AAGTAGAATAAGTTGGAAGAGGG - Intronic
1008701046 6:54100401-54100423 CAGTAACATAGGATGGAAGAAGG - Intronic
1011560034 6:88604853-88604875 AAGCAGGATAAGAGGGTAGATGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014075312 6:117228490-117228512 CAGTCCTATAAGAAGGAAGCTGG + Intergenic
1015447030 6:133317979-133318001 CACTTGTATAAGAGGGTGGATGG - Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021157578 7:17230732-17230754 AATTAGGAAAAGAGGGAAGAGGG + Intergenic
1022218721 7:28290952-28290974 TCCAAGTATAAGAGGGAAGATGG + Intergenic
1022479854 7:30735757-30735779 GAGTAGAGTGAGAGGGAAGAAGG + Intronic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1027532234 7:79350536-79350558 CAGAACTATAAGGTGGAAGAGGG - Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031375894 7:121025613-121025635 CAGGAGGTTAAGAGGGAAAAGGG - Intronic
1031418509 7:121521526-121521548 CAATAGTATAAAAAGGAAGTGGG + Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1034758665 7:153649525-153649547 GAGTAGCATATGAGGGAGGATGG + Intergenic
1035417569 7:158703493-158703515 CACTAATATAAGAGGGAAAATGG - Intronic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038578143 8:28722931-28722953 CAGTAGTCTATTAGGGAAAAGGG + Intronic
1039147617 8:34466396-34466418 CAGTAGTATAAGAGTCCAGCAGG + Intergenic
1041133047 8:54722991-54723013 CAGAAGTATAGCAGGGTAGAGGG + Intergenic
1041594895 8:59637925-59637947 TTGTAGAATAATAGGGAAGATGG + Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042686343 8:71445229-71445251 TAGTAGTAAAAGAGGTAATATGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1046971822 8:120231330-120231352 TAGTTGTATATGAGGCAAGAAGG - Intronic
1048007477 8:130431177-130431199 CAGGAGTCTGGGAGGGAAGATGG - Intronic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050055337 9:1647215-1647237 GAGAAGTATAAGAGCAAAGAGGG + Intergenic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1051936902 9:22454149-22454171 CAGTAGTATATGAGGAAATTGGG + Exonic
1052107247 9:24533948-24533970 CATTAATCTAAGATGGAAGAAGG + Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1056150056 9:83776941-83776963 CAGTGCTATAAGAAGGAAGTAGG + Intronic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057289621 9:93796011-93796033 CAGAAGGATAAGAGAGAAAAGGG - Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1062608277 9:137358574-137358596 CAAGAGAATAAGAGGGGAGACGG - Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1189351019 X:40275776-40275798 TAGTAGTATAAGGGGGATGGAGG + Intergenic
1191775229 X:64806784-64806806 GAGTAGTAGAAGAGGTCAGAGGG + Intergenic
1193688588 X:84610426-84610448 CAGTACCATAACAGAGAAGACGG + Intergenic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195429079 X:104767803-104767825 TAGTAGAATAAGTGGCAAGAAGG + Intronic
1198722494 X:139637868-139637890 CATTAGGATAAGAGGGAGGCAGG + Intronic
1199729752 X:150620356-150620378 CAGTAGTATAAGGGGAAAGCTGG - Intronic
1201450685 Y:14110285-14110307 GGGTAGTATGATAGGGAAGAAGG - Intergenic
1201570927 Y:15413598-15413620 CAGTAGGGTGAGAGAGAAGAAGG + Intergenic