ID: 932818202

View in Genome Browser
Species Human (GRCh38)
Location 2:74878517-74878539
Sequence CAGGGGCAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6232
Summary {0: 1, 1: 5, 2: 110, 3: 1049, 4: 5067}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818202_932818213 4 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818202_932818212 3 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818202_932818216 24 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818202_932818215 21 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818202_932818214 20 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818202 Original CRISPR CAGGGGCAGGAGGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr