ID: 932818212

View in Genome Browser
Species Human (GRCh38)
Location 2:74878543-74878565
Sequence AGGTGGACTAAGCAATGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818205_932818212 -4 Left 932818205 2:74878524-74878546 CCTCCTCCTGCCCCTGCACAGGT 0: 1
1: 0
2: 6
3: 92
4: 749
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818199_932818212 6 Left 932818199 2:74878514-74878536 CCCCCTTCCTCCTCCTCCTGCCC 0: 2
1: 10
2: 159
3: 1191
4: 5781
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818208_932818212 -10 Left 932818208 2:74878530-74878552 CCTGCCCCTGCACAGGTGGACTA 0: 1
1: 0
2: 5
3: 6
4: 123
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818201_932818212 4 Left 932818201 2:74878516-74878538 CCCTTCCTCCTCCTCCTGCCCCT 0: 1
1: 12
2: 180
3: 1177
4: 5334
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818200_932818212 5 Left 932818200 2:74878515-74878537 CCCCTTCCTCCTCCTCCTGCCCC 0: 2
1: 29
2: 636
3: 5320
4: 15002
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818203_932818212 -1 Left 932818203 2:74878521-74878543 CCTCCTCCTCCTGCCCCTGCACA 0: 1
1: 2
2: 32
3: 259
4: 2584
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818207_932818212 -7 Left 932818207 2:74878527-74878549 CCTCCTGCCCCTGCACAGGTGGA 0: 1
1: 1
2: 4
3: 28
4: 390
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142
932818202_932818212 3 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818212 Original CRISPR AGGTGGACTAAGCAATGAAG AGG Intronic
900588024 1:3442793-3442815 AGGTGGAATATGAATTGAAGTGG + Intergenic
901787852 1:11636540-11636562 AGGTGGAATTAGCACTGATGGGG + Intergenic
902295909 1:15466883-15466905 TGTTGGACTTAGCAGTGAAGTGG + Intronic
902298802 1:15486789-15486811 TGTTGGACTTAGCAGTGAAGTGG + Intronic
905270234 1:36782873-36782895 AGAGGGACTGAGCAAAGAAGAGG - Intergenic
908248715 1:62248267-62248289 AGGTGGACGTAGCAATGAGCCGG + Intronic
911782684 1:101902603-101902625 AGGTGTACAAAGAAAAGAAGTGG + Intronic
912672339 1:111642429-111642451 AGGAGGAATAAGCAAGAAAGGGG - Intronic
913441661 1:118904914-118904936 AGGCAGACTTAGAAATGAAGAGG - Intronic
920260747 1:204686125-204686147 CAGTGGACTAAGGAATGTAGTGG + Intergenic
1066242252 10:33549619-33549641 AGGTGAGCTAAGGAGTGAAGCGG - Intergenic
1068266253 10:54654134-54654156 GGGTGGAGTGAGCAATGAAATGG - Intronic
1070056981 10:72944992-72945014 AGGTGGGCTAGGAAATGAAGTGG + Intronic
1073469042 10:103711513-103711535 AGGTGGACTAACCACTGAGTTGG - Intronic
1075314358 10:121440012-121440034 GCCTGGACCAAGCAATGAAGTGG + Intergenic
1076482714 10:130795445-130795467 AAGTGGACAAAGCAATTCAGGGG - Intergenic
1076679176 10:132162936-132162958 GGGAGGACTGAGCTATGAAGTGG - Intronic
1080503489 11:32892079-32892101 AGTTGGATTAATCAATGAAGAGG + Intergenic
1081543065 11:44050153-44050175 AGGGGGACTAAGCCTTGAAGGGG - Intronic
1087982727 11:104636281-104636303 AGGAGGACAAAGGAATAAAGAGG - Intergenic
1093726218 12:22512144-22512166 AGCTGAACTAAGCAATGATGAGG - Intronic
1095737764 12:45576439-45576461 AGGAGTACTAGGAAATGAAGTGG - Intergenic
1096613171 12:52816231-52816253 AGGTGGACTGACCCATGACGCGG - Intergenic
1097242843 12:57587939-57587961 AGGTGGGCTAAGGAATGAATAGG - Intergenic
1099140951 12:78974825-78974847 AGGTGGAGGCAGGAATGAAGAGG - Intronic
1100268227 12:92998996-92999018 AGGTGGCCTAAGCTATAGAGAGG - Intergenic
1101714513 12:107298780-107298802 TGTTGGACTAAGAAATGATGTGG + Intergenic
1106196392 13:27497826-27497848 AGCTGGAATAAGCAAGGAAATGG - Intergenic
1106245714 13:27948225-27948247 AGCTGGAAGAAGCAAGGAAGGGG - Intergenic
1107305525 13:39014214-39014236 AGGTGCAGTGGGCAATGAAGGGG + Exonic
1108157569 13:47601759-47601781 TGTTGTACCAAGCAATGAAGAGG - Intergenic
1108174373 13:47777284-47777306 AGGTGGAGGAAGAAATGAAAGGG + Intergenic
1110352624 13:74527205-74527227 TTGTGGACTAATCAATGATGAGG + Intergenic
1111160389 13:84386967-84386989 AGGTGGAATAAGGAAGGAATAGG + Intergenic
1111615218 13:90653571-90653593 AGACGCACTATGCAATGAAGTGG - Intergenic
1112720603 13:102240068-102240090 AGATAGACTATGCTATGAAGTGG - Intronic
1116863591 14:50013855-50013877 AGGTGGACTAAGGCCTGATGTGG + Intergenic
1122402678 14:101476547-101476569 ATCTGGACTACGAAATGAAGGGG + Intergenic
1125590469 15:40851596-40851618 ACGTGGACTAAACAAGGCAGTGG - Intronic
1126984362 15:54286680-54286702 AGGTGGAATAAGCAATTATAAGG + Intronic
1128928428 15:71680542-71680564 AGGAGGACCTAGCAATGATGTGG - Intronic
1129753994 15:78084877-78084899 ATGTGAGCAAAGCAATGAAGAGG + Intronic
1129880945 15:79005684-79005706 AGGTGGTCTAAGCAAAGCAGGGG + Intronic
1131727636 15:95244126-95244148 AGGAGGCCTAAGCAATCAGGAGG + Intergenic
1134080757 16:11323440-11323462 AGCTGGAAGAAGCAAGGAAGGGG + Intronic
1134183123 16:12063345-12063367 AGATGGACTAGGAAAAGAAGAGG - Intronic
1134865404 16:17602480-17602502 AGGTTGAAGTAGCAATGAAGCGG - Intergenic
1137541293 16:49363814-49363836 AGGTGGAGTAACTTATGAAGAGG - Intergenic
1138101528 16:54255779-54255801 AGGTGGACAGTGCAATGCAGTGG + Intronic
1138294970 16:55878328-55878350 AGGTGGACAAAACAAAGGAGTGG + Intronic
1139602917 16:67997724-67997746 AGGAGGGGTAAGGAATGAAGGGG + Intronic
1140171998 16:72615461-72615483 AAGAGGACTAAGGAATTAAGAGG - Intergenic
1141774678 16:86115344-86115366 AGGTGGACTTGGAAAAGAAGAGG + Intergenic
1145960782 17:28885474-28885496 TGGTGAATGAAGCAATGAAGAGG + Intronic
1146638671 17:34524380-34524402 TGGGGGACTAAACAATGAAAGGG - Intergenic
1147996412 17:44362579-44362601 AGGTGGACTCAGGACTGGAGTGG + Intronic
1148576587 17:48716219-48716241 AGGTGGAGGAAGCAAAGAAGGGG - Intergenic
1151760223 17:76097400-76097422 AGGTGGATTAAAGAATAAAGGGG + Intronic
1151932681 17:77242391-77242413 AGGTGCCATAAGCGATGAAGTGG + Intergenic
1152288497 17:79425662-79425684 AGATGGACAGAGCAAGGAAGGGG + Intronic
1152356574 17:79810437-79810459 AGGGGGGTTAAGCAACGAAGGGG - Intergenic
1158776905 18:60593832-60593854 CTGTGGACCAAGCAATTAAGAGG - Intergenic
1159625156 18:70684719-70684741 AGGTTTACTAAGGAATGAATAGG - Intergenic
1162947565 19:14053126-14053148 AGGTGGAGCAAGAAATGAAAAGG + Exonic
1165039417 19:33058553-33058575 AGGTGGATTACGCAGTCAAGAGG + Intronic
1165277905 19:34770868-34770890 AGGTGGACATTGGAATGAAGGGG - Intronic
925907736 2:8549311-8549333 AGATGCACAAAGCCATGAAGGGG - Intergenic
928114932 2:28539827-28539849 AGGAGGACTGAGAGATGAAGGGG + Intronic
930681410 2:54260582-54260604 AGGTGGTCTGATCAATGAATTGG + Intronic
931990197 2:67782595-67782617 TGGAGGACTGAGCAAGGAAGTGG + Intergenic
932818212 2:74878543-74878565 AGGTGGACTAAGCAATGAAGAGG + Intronic
938554852 2:132415725-132415747 AGAGGGAATGAGCAATGAAGGGG - Intergenic
938827104 2:135017021-135017043 AGGAGCACAAAGAAATGAAGGGG - Intronic
940497867 2:154456938-154456960 AGGTGGAGAAAGGAAGGAAGGGG + Intergenic
941126396 2:161589203-161589225 AGGTAGACTAAGAAAGAAAGAGG - Intronic
943260332 2:185651559-185651581 AGGTGTTATAAGCAATGTAGAGG - Intergenic
945052305 2:205835733-205835755 AGGTGGAGTTGGCAGTGAAGCGG - Intergenic
945683208 2:212937892-212937914 AGGTGGAAAAGGCAATTAAGTGG + Intergenic
946999466 2:225437035-225437057 AGGAGAACTGAGCTATGAAGTGG + Intronic
947997024 2:234536582-234536604 AGGAGGACTCAGCATTGAGGGGG - Intergenic
1169621825 20:7515594-7515616 AGGGGAACTGAGCAAAGAAGTGG - Intergenic
1172291511 20:33780366-33780388 AGGTGGGTTAAGCAATGGTGTGG + Intronic
1172789989 20:37496475-37496497 TGGTAGAATAAGGAATGAAGGGG - Intronic
1174555592 20:51393229-51393251 AGGTTCACCAAGCAAGGAAGTGG - Intronic
1175254520 20:57631901-57631923 AGTTGGACATAACAATGAAGAGG + Intergenic
1176904047 21:14478718-14478740 AGGTGGATTAAGAATTGAAAGGG + Intergenic
1177855886 21:26399775-26399797 AGGTAGAGTAAGCCATGAGGAGG - Intergenic
1183315180 22:37133163-37133185 TGGTGGAGAAAGCACTGAAGGGG + Intronic
1183382532 22:37497316-37497338 AGGTGGAGAAGGCAAGGAAGAGG - Intronic
949542053 3:5040288-5040310 AGGTGGACTCAAAAACGAAGAGG + Intergenic
951571532 3:24068465-24068487 AGATGGATTAATCAATAAAGGGG + Intergenic
954790552 3:53130213-53130235 AGGTGGACCCCGCAATGGAGGGG - Intronic
958766359 3:98372689-98372711 AGGAGGACTGATCAATGAACAGG - Intergenic
959975312 3:112452448-112452470 ATGGGGACTAAGAAATTAAGAGG + Intergenic
960005639 3:112778040-112778062 AAGTGAACCAAGCAAAGAAGAGG + Intronic
960359517 3:116694551-116694573 AGGTGGTCAAAGCAAGGAATCGG - Intronic
960825728 3:121782092-121782114 TTGTGCAGTAAGCAATGAAGAGG + Intronic
964020078 3:151999397-151999419 AAGTGGAATCAGCAATGAAATGG + Intergenic
966824451 3:183952121-183952143 AGGTGGACAAAGCCATGACCAGG - Intronic
967235685 3:187381647-187381669 CTGTGGTCTAGGCAATGAAGGGG + Intergenic
967585013 3:191202613-191202635 AAGTGGAGTAAACAGTGAAGGGG + Intronic
971154623 4:24068156-24068178 AGGTGGACAGAGGAATAAAGAGG + Intergenic
972556772 4:40189393-40189415 TGGAGGACTGAGCAGTGAAGTGG + Intergenic
977627309 4:99201305-99201327 GGCTGGACCAAACAATGAAGAGG - Intergenic
977773354 4:100886201-100886223 AGATGGACTAAGAAAAAAAGAGG - Intergenic
984153139 4:176159637-176159659 AGGTGGATTAAGCAAATATGTGG - Intronic
984548683 4:181135518-181135540 AGGTGGAAGAAGTAAGGAAGAGG + Intergenic
984593175 4:181639181-181639203 TGATGGACTAAGAAATGAAATGG + Intergenic
985179038 4:187236724-187236746 ATGTGGACTAAGCCAGGCAGAGG - Intergenic
987721234 5:21634972-21634994 AAGGGAACTAAGCAAAGAAGAGG + Intergenic
989344306 5:40411923-40411945 AGTTGGAAAAAGCAAAGAAGAGG + Intergenic
989398041 5:40979559-40979581 AGTTGGACCTAGGAATGAAGGGG + Intronic
993972795 5:94441006-94441028 AGGTGGACTGAGCAATCTAGAGG + Intronic
994026578 5:95091235-95091257 AGGTGGACAGGGCATTGAAGGGG - Intronic
994577848 5:101603447-101603469 AAGTTGACAAAGCAATGCAGTGG + Intergenic
996648832 5:125848716-125848738 GGGTGGAATATACAATGAAGAGG - Intergenic
996852208 5:127966090-127966112 ATGTGGTCAAAGCAATGAAACGG + Intergenic
998440890 5:142161302-142161324 AAATGGACTAAGCAAAAAAGAGG - Intergenic
1004215605 6:13701384-13701406 ATGTGGACTAAGCCATTGAGAGG - Intronic
1006341743 6:33451205-33451227 AGGTGTACTAAGCAAATTAGTGG - Intronic
1008061993 6:47008280-47008302 AGGTGGACAAAGCAATCATTAGG - Intronic
1009305785 6:62088323-62088345 AGGTGGATAAACCCATGAAGAGG - Intronic
1012566176 6:100655774-100655796 ATGTGGAAGAAGCAGTGAAGTGG - Exonic
1013325203 6:109038862-109038884 AGGAGGAAGAAGAAATGAAGAGG + Intronic
1013764199 6:113555380-113555402 ATGTGGCAGAAGCAATGAAGAGG - Intergenic
1017650368 6:156576058-156576080 AGGTGAATGAAGCATTGAAGAGG + Intergenic
1018124636 6:160669805-160669827 AGATGGATTAAGCAAAAAAGGGG - Intergenic
1022403744 7:30066612-30066634 ATGTGGAATATGCAATGGAGAGG - Intronic
1023063266 7:36350088-36350110 AGGTTGTCAAAACAATGAAGGGG - Intronic
1029296071 7:99541551-99541573 AGGTGGGCAAAGCCAGGAAGAGG - Intergenic
1030406611 7:109122709-109122731 ATGTAGAGTAGGCAATGAAGCGG + Intergenic
1032585213 7:133140031-133140053 AGACTGACTGAGCAATGAAGTGG - Intergenic
1032612877 7:133434581-133434603 GGGTGGACTGAGAAATGTAGAGG + Intronic
1033207123 7:139432749-139432771 AGGTGTTATAAGCAATGTAGAGG - Intergenic
1034714476 7:153228519-153228541 AGGGGGACTAACCACTGAAACGG + Intergenic
1036164038 8:6415125-6415147 AGGTGGACTTAGGAAGCAAGAGG + Intronic
1039929501 8:41971654-41971676 AGGTTTTCTAAGCAAGGAAGTGG + Intronic
1039986492 8:42452229-42452251 AGGAGGAGGAAGAAATGAAGTGG + Intronic
1044810977 8:96061534-96061556 AAGGGGACTAAGGAGTGAAGTGG - Intergenic
1049917928 9:336410-336432 AGGAGGACTAAGAAAGGTAGGGG + Intronic
1050112334 9:2229686-2229708 TGGTGGTCTAAGCAAGGTAGAGG - Intergenic
1050498685 9:6271259-6271281 ATGTGGAGTGAGGAATGAAGAGG - Intergenic
1056941877 9:90962889-90962911 AGGGACACTAACCAATGAAGGGG - Intergenic
1058096604 9:100868219-100868241 AGGTGCACAAACAAATGAAGGGG - Intergenic
1059059521 9:111020595-111020617 AGGTAGACAAAGCCAGGAAGAGG - Intronic
1060141163 9:121211568-121211590 AGGTGGATAAAGCACTGAACTGG + Intronic
1189613200 X:42759040-42759062 AGGTGGAGTGGGAAATGAAGTGG - Intergenic
1190275057 X:48893973-48893995 TGGTGGGCTCAGCAATGATGGGG - Exonic
1192231350 X:69267329-69267351 AGGTGGACTAGAGAATGAGGAGG + Intergenic
1194502244 X:94696054-94696076 TGCTGGACTAAGCAAAGCAGAGG + Intergenic
1194681629 X:96861309-96861331 AGGTGGAGAAAGCAAAGAAAGGG - Intronic