ID: 932818213

View in Genome Browser
Species Human (GRCh38)
Location 2:74878544-74878566
Sequence GGTGGACTAAGCAATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 216}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818203_932818213 0 Left 932818203 2:74878521-74878543 CCTCCTCCTCCTGCCCCTGCACA 0: 1
1: 2
2: 32
3: 259
4: 2584
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818205_932818213 -3 Left 932818205 2:74878524-74878546 CCTCCTCCTGCCCCTGCACAGGT 0: 1
1: 0
2: 6
3: 92
4: 749
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818200_932818213 6 Left 932818200 2:74878515-74878537 CCCCTTCCTCCTCCTCCTGCCCC 0: 2
1: 29
2: 636
3: 5320
4: 15002
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818199_932818213 7 Left 932818199 2:74878514-74878536 CCCCCTTCCTCCTCCTCCTGCCC 0: 2
1: 10
2: 159
3: 1191
4: 5781
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818202_932818213 4 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818201_932818213 5 Left 932818201 2:74878516-74878538 CCCTTCCTCCTCCTCCTGCCCCT 0: 1
1: 12
2: 180
3: 1177
4: 5334
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818208_932818213 -9 Left 932818208 2:74878530-74878552 CCTGCCCCTGCACAGGTGGACTA 0: 1
1: 0
2: 5
3: 6
4: 123
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216
932818207_932818213 -6 Left 932818207 2:74878527-74878549 CCTCCTGCCCCTGCACAGGTGGA 0: 1
1: 1
2: 4
3: 28
4: 390
Right 932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818213 Original CRISPR GGTGGACTAAGCAATGAAGA GGG Intronic
901060487 1:6469616-6469638 GGTGACCAAAGCAGTGAAGAAGG - Exonic
902038324 1:13473686-13473708 GGTGGACTGAGTAAAGCAGATGG + Intergenic
902295910 1:15466884-15466906 GTTGGACTTAGCAGTGAAGTGGG + Intronic
902298803 1:15486790-15486812 GTTGGACTTAGCAGTGAAGTGGG + Intronic
902323104 1:15682790-15682812 GGTGGCCTGAGCAGAGAAGAGGG + Intergenic
903344897 1:22677668-22677690 GTTGCAGTAAGCAATGGAGATGG - Intergenic
908046834 1:60179339-60179361 GGTGGACTGAGTAAGGTAGATGG - Intergenic
908087920 1:60656353-60656375 GGTGGCCTAAGAAGTGAAAAAGG - Intergenic
908698144 1:66868441-66868463 GGTGGACTGAGTAAAGCAGATGG + Intronic
910236926 1:85046549-85046571 CTTGTACTCAGCAATGAAGAAGG + Intronic
912923948 1:113896688-113896710 GTTGGATTAAGCAATAAATAAGG + Intronic
913387788 1:118278580-118278602 GGTGGACTAAGCAAAGCAGATGG + Intergenic
913535371 1:119767122-119767144 GTTGGACAAAGAAAAGAAGAGGG + Intronic
916260284 1:162834992-162835014 AGTGGACAAAGCAATGAAGAAGG - Intronic
916329714 1:163601006-163601028 GGTGGATTAAGTAAAGCAGATGG + Intergenic
916459175 1:165004829-165004851 GGTGGACTGAGTAAAGCAGATGG - Intergenic
917989513 1:180358910-180358932 GGTGCAGTAAGTACTGAAGATGG - Intronic
920260748 1:204686126-204686148 AGTGGACTAAGGAATGTAGTGGG + Intergenic
920683937 1:208094944-208094966 GAAGGACTCAGCAATCAAGATGG - Intronic
921371049 1:214423436-214423458 GCTGGAGTAAGGAATGTAGATGG - Intronic
921438125 1:215151297-215151319 GATGAACTAACCAATGAATAAGG - Intronic
922870889 1:228901193-228901215 GGTGGCCGCAGCAGTGAAGAGGG - Intergenic
924206959 1:241722520-241722542 AGTGGACTAATCAATGGACAAGG + Intronic
1067132397 10:43576341-43576363 GATGGACTAAGAAATGTAGAAGG - Intergenic
1068266252 10:54654133-54654155 GGTGGAGTGAGCAATGAAATGGG - Intronic
1068827682 10:61457317-61457339 GGTGGAATGAGGAAGGAAGAAGG - Intergenic
1070056982 10:72944993-72945015 GGTGGGCTAGGAAATGAAGTGGG + Intronic
1073263335 10:102207283-102207305 GGAGCACAAAGCAAGGAAGAGGG - Intergenic
1074607620 10:114989379-114989401 GGTGAACTAAGTAAAGCAGAGGG + Intergenic
1074913226 10:117931204-117931226 GATGGACTAAGTAAAGCAGATGG - Intergenic
1075314360 10:121440013-121440035 CCTGGACCAAGCAATGAAGTGGG + Intergenic
1075952690 10:126495597-126495619 GGTGAACAAAGAAATAAAGATGG - Intronic
1076346743 10:129784643-129784665 GGTGAACTAGAAAATGAAGAGGG + Intergenic
1076679175 10:132162935-132162957 GGAGGACTGAGCTATGAAGTGGG - Intronic
1077732119 11:4742567-4742589 GGTGGACTGAGTAAAGCAGATGG + Intronic
1077966951 11:7144955-7144977 GGAGGACATAGCAAAGAAGAAGG - Intergenic
1078486786 11:11730748-11730770 GGTGGACTAAGTAAAGCAGATGG + Intergenic
1079458023 11:20653460-20653482 GGTTGAAAAAGGAATGAAGAAGG + Intronic
1080344805 11:31312513-31312535 GGTGGACCAAGTAAAGCAGATGG + Intronic
1080667969 11:34352513-34352535 TGTGGACTAAGTGATGAACAAGG - Intronic
1081073415 11:38638853-38638875 GGTCGACAAAGAAATTAAGAAGG - Intergenic
1083067033 11:59934986-59935008 TGTGGAATAAGGAATGAAGATGG + Intergenic
1084623871 11:70293265-70293287 TCTGGAAAAAGCAATGAAGAAGG - Intronic
1085335394 11:75689855-75689877 GGTGCTCTAAGTAAGGAAGAAGG - Intergenic
1085352612 11:75809484-75809506 GGTGGGCAAAGCAGTGAAAATGG - Intergenic
1087811319 11:102611845-102611867 GGTGGACAAAGCAGTGGAGATGG - Exonic
1091550493 12:1531689-1531711 GGTGGCAAAAGCAGTGAAGAAGG - Intronic
1092326795 12:7540996-7541018 GGTTGACTAGTCAATGCAGATGG + Intergenic
1095857079 12:46872168-46872190 GTTGGAATAAGAAATGATGATGG - Intergenic
1097242842 12:57587938-57587960 GGTGGGCTAAGGAATGAATAGGG - Intergenic
1097658699 12:62402545-62402567 GGTGTTCTAAGCAAAGAAAACGG + Intronic
1098861273 12:75713122-75713144 AGTGGAACAAGCAATGAAAAAGG - Intergenic
1099140950 12:78974824-78974846 GGTGGAGGCAGGAATGAAGAGGG - Intronic
1099457569 12:82882546-82882568 GGTTTACTAAGCAAGCAAGAGGG - Intronic
1100184381 12:92123172-92123194 GGTGGACTGAGTAAAGCAGATGG - Intronic
1101509631 12:105381043-105381065 GGTGGGCTAAGGAACGAAGGAGG - Intronic
1101531149 12:105574710-105574732 GCCGGAATAAGCAATGAAGAAGG - Intergenic
1103957197 12:124583843-124583865 GGTGGGGTCAGCACTGAAGATGG - Intergenic
1104535195 12:129612069-129612091 GGTGGACCAAGGACAGAAGAAGG + Intronic
1107323601 13:39215804-39215826 GGTGGACTCAGTAAAGTAGATGG - Intergenic
1107766653 13:43742543-43742565 GGTAGACTGAGTAAAGAAGATGG - Intronic
1109550909 13:63898540-63898562 GGTTGACTTAGAAATGAAAAAGG + Intergenic
1109618295 13:64865879-64865901 GGTAGCCCTAGCAATGAAGAGGG + Intergenic
1109712619 13:66180324-66180346 TGTGCACTTTGCAATGAAGAAGG - Intergenic
1110352625 13:74527206-74527228 TGTGGACTAATCAATGATGAGGG + Intergenic
1113325387 13:109276642-109276664 GCAGGACTAAGAAATGAAGCAGG + Intergenic
1113787937 13:113012513-113012535 GGTGGACACTGCAATGAGGACGG + Intronic
1114782201 14:25550239-25550261 GGTGGAGCATGCAATGAGGATGG - Intergenic
1115176932 14:30573773-30573795 GGTGAACTGAGCAAAGCAGATGG - Intronic
1115478733 14:33841157-33841179 GGTAGAATAAGAAAAGAAGAGGG - Intergenic
1119110173 14:71965107-71965129 GGTTGCCTAAGCAATGCAGATGG + Intronic
1119890434 14:78178448-78178470 GGTGCATGAAGCAAGGAAGAAGG - Intergenic
1120783671 14:88510367-88510389 AGTGGAGAAAGCAATTAAGAGGG - Intronic
1121395953 14:93623569-93623591 TCTGAACTAAGAAATGAAGATGG - Intronic
1124708438 15:31984776-31984798 GGTGAACTAAGTCAAGAAGAAGG - Intergenic
1127553854 15:60067842-60067864 GGTGGACTGAGTAAAGCAGATGG - Intergenic
1127716777 15:61655947-61655969 GGAGCAGTAAGCAATGAAGCAGG - Intergenic
1128005181 15:64232541-64232563 GGAGTACTATGGAATGAAGAAGG - Intronic
1129753995 15:78084878-78084900 TGTGAGCAAAGCAATGAAGAGGG + Intronic
1129929506 15:79398683-79398705 GGTGGACTGAGTAAAGCAGATGG - Intronic
1129934182 15:79435644-79435666 AATGGATTAAGAAATGAAGAGGG + Intronic
1132361092 15:101216138-101216160 CCTGGACTAAGCCATCAAGAAGG + Intronic
1138370521 16:56523176-56523198 GGTGGAAATAGCAATGAAGGAGG - Intergenic
1138978948 16:62242822-62242844 GGTGGACTCAGTAAAGTAGATGG - Intergenic
1141220199 16:82062437-82062459 GGATGAATAAGCATTGAAGAGGG - Intronic
1142207898 16:88792667-88792689 GGGGGACTGAGCAGTGAGGAGGG - Intergenic
1142615704 17:1133727-1133749 GGTAGAGTAAGCAAGGAAGAAGG - Intronic
1145097547 17:20043679-20043701 TGTGGACTATGAAATGAAAATGG - Intronic
1145960783 17:28885475-28885497 GGTGAATGAAGCAATGAAGAGGG + Intronic
1147197076 17:38774242-38774264 GGTGGACTGAGTAAAGCAGATGG + Intronic
1148001600 17:44390885-44390907 TGGGAACTCAGCAATGAAGAAGG - Intergenic
1149133841 17:53340900-53340922 GGTAGATAAAGCAACGAAGATGG + Intergenic
1150263954 17:63819855-63819877 GGTGGACTCAAGGATGAAGAAGG - Exonic
1150478430 17:65491261-65491283 GGTGGACAAAGGAATGAAGCAGG - Intergenic
1155063614 18:22250270-22250292 GGTGGACTAAGACACGATGAAGG - Intergenic
1158006185 18:52674448-52674470 GGTGGACTAAGTAAATCAGATGG - Intronic
1158619635 18:59021467-59021489 GGTGGAATAAGTAATGGAGTAGG + Intergenic
1159041078 18:63323156-63323178 GGTGGCCTGGGGAATGAAGACGG - Intergenic
1162150701 19:8643502-8643524 GGTGGACTGAGAAAAGCAGATGG + Intergenic
1163893754 19:20039451-20039473 AGGATACTAAGCAATGAAGATGG + Exonic
1166143918 19:40821641-40821663 GGTGGACTTAGCAGTGTAGGAGG + Intronic
1166183690 19:41125455-41125477 GGTGGACTTAGCAGTGTAGGAGG - Intronic
1167911833 19:52709952-52709974 GCTGGGCTAAACCATGAAGAAGG + Intronic
1167939480 19:52934928-52934950 GCTGGACGAAACCATGAAGAAGG + Intronic
926504510 2:13696189-13696211 GTTGCACAAAACAATGAAGATGG + Intergenic
927117295 2:19917260-19917282 GGTAGACAAATCCATGAAGATGG + Intronic
929272775 2:39991158-39991180 TCTGGACTAAGGAATGAAAATGG - Intergenic
929387598 2:41428418-41428440 GGAGGACTAATAAATGAAGGAGG + Intergenic
931264344 2:60647090-60647112 GGATTACTAAGCAATGAAGAAGG - Intergenic
932027037 2:68144617-68144639 GGTGGACTAGGAATTGGAGAAGG - Exonic
932818213 2:74878544-74878566 GGTGGACTAAGCAATGAAGAGGG + Intronic
933372101 2:81427652-81427674 GGTGAATTAAGAAAAGAAGATGG - Intergenic
936580831 2:113699074-113699096 GTTGGACTGAGTAAAGAAGATGG - Intergenic
936628243 2:114172124-114172146 GGTGGACTCAGTAAAGTAGATGG + Intergenic
941048669 2:160705681-160705703 GGTTGAAAAAGCAATGAAGTAGG + Intergenic
941126395 2:161589202-161589224 GGTAGACTAAGAAAGAAAGAGGG - Intronic
941620121 2:167768099-167768121 GGTGGACTGAGTAAAGCAGATGG - Intergenic
943490823 2:188554376-188554398 GGTTGACAAAGAAATTAAGATGG - Intronic
1169992570 20:11519822-11519844 TGTGGGCTCAGCAATGTAGAGGG - Intergenic
1170713203 20:18810379-18810401 GGTGGACTGAGTAAGGCAGATGG + Intronic
1170817556 20:19727668-19727690 GGTGGGCTAGGCAATGAGGAAGG + Intergenic
1173704680 20:45101062-45101084 GGGGGACTAGGCAAGGAAGAAGG - Exonic
1173756652 20:45522512-45522534 GGTGGACTCAGTAAAGTAGACGG - Intergenic
1175481847 20:59317308-59317330 GTTTGACTTAGCAATAAAGAAGG - Intronic
1177855885 21:26399774-26399796 GGTAGAGTAAGCCATGAGGAGGG - Intergenic
1178035261 21:28575418-28575440 GGTGGACTGAGTAAGGCAGATGG + Intergenic
1178708768 21:34895965-34895987 TCTGGATTAAGCAATGGAGATGG + Intronic
1179800189 21:43808101-43808123 GGTGGACTAAGGAAAGCAGGTGG - Intergenic
1183024231 22:35052133-35052155 AGTAGACTAAGTAAAGAAGATGG + Intergenic
1183382531 22:37497315-37497337 GGTGGAGAAGGCAAGGAAGAGGG - Intronic
1184983042 22:48108321-48108343 GGTGGACTAAGTAAGGCAGACGG + Intergenic
1184983056 22:48108441-48108463 GGTGGACTAAGTAAGGCAGATGG - Intergenic
1185114966 22:48927921-48927943 TGTGGAAAAATCAATGAAGAAGG - Intergenic
949618332 3:5781450-5781472 GGTGGACCAAGGAAAGCAGATGG - Intergenic
949640322 3:6029425-6029447 GGTAGACAAATCCATGAAGATGG - Intergenic
951438369 3:22691612-22691634 GGTGGGCTAAGTAAAGCAGATGG - Intergenic
952506195 3:34008664-34008686 GTTGGAGTAAGCATTGAGGAGGG + Intergenic
957374000 3:79333601-79333623 GATGGAATGAGCAAGGAAGAGGG - Intronic
958027416 3:88064712-88064734 ACTGGACAAAGCAATGAAAAAGG - Intronic
958761858 3:98318921-98318943 GGTGGACTGAGTAAAGCAGATGG - Intergenic
958766358 3:98372688-98372710 GGAGGACTGATCAATGAACAGGG - Intergenic
959073487 3:101725438-101725460 CCTGGTCTAAGCCATGAAGACGG - Intronic
959762619 3:109985536-109985558 GGTGGAGTAGGCAAGGAAAATGG - Intergenic
960459944 3:117921366-117921388 AATAGACTGAGCAATGAAGAGGG + Intergenic
960499178 3:118415054-118415076 GGTAAACTAAGCAGTTAAGAAGG + Intergenic
960954543 3:123022664-123022686 AGTGGAATAAAAAATGAAGATGG - Intronic
964116282 3:153139523-153139545 GGTGGACTGAGGACTGAAGGTGG - Intergenic
964805820 3:160608527-160608549 GGTTGATTAAGTAATGAAGGTGG + Intergenic
965973183 3:174588494-174588516 GGTAGATAAAACAATGAAGATGG - Intronic
967656814 3:192060465-192060487 GCTAGACTAAGCACTGAACAGGG - Intergenic
967925340 3:194641395-194641417 AGTGGAATAACCAGTGAAGATGG + Exonic
968020809 3:195387097-195387119 GACGGACTTGGCAATGAAGAGGG + Intronic
970044053 4:11830024-11830046 GGTGGACTGAGTGAAGAAGATGG + Intergenic
970819196 4:20193048-20193070 GGTGGACTGAGTAAAGCAGATGG + Intergenic
975255052 4:72224272-72224294 GCTGGACTAGGTAATAAAGATGG - Intergenic
976894813 4:90096746-90096768 GGTGGACTGAGTAAAGCAGATGG - Intergenic
976984510 4:91276422-91276444 GGTTGAAAAAGAAATGAAGAAGG - Intronic
977200354 4:94107781-94107803 ACTGGACTAAGGAATGGAGAGGG - Intergenic
977450161 4:97185856-97185878 GGTGGAGTGAGGGATGAAGATGG - Intronic
977627308 4:99201304-99201326 GCTGGACCAAACAATGAAGAGGG - Intergenic
977773353 4:100886200-100886222 GATGGACTAAGAAAAAAAGAGGG - Intergenic
978629236 4:110724087-110724109 GCTGGACTAAGCCCTGAAGATGG - Intergenic
979529052 4:121749435-121749457 GGTGGACTGAGCGATGCAGATGG + Intergenic
980619509 4:135281072-135281094 CCTGGACAAAGAAATGAAGAGGG + Intergenic
980828870 4:138105499-138105521 GGTGGACTGAGTAAAGCAGATGG + Intergenic
981365890 4:143902660-143902682 GGTTGAATAAGCAAGGAAGGAGG - Intronic
981375996 4:144016474-144016496 GGTTGAATAAGCAAGGAAGGAGG - Intronic
981386522 4:144137833-144137855 GGTTGAATAAGCAAGGAAGGAGG - Intronic
982610291 4:157565575-157565597 GGTAGACTGAGTAAAGAAGATGG - Intergenic
982957286 4:161787505-161787527 GGTGAAAGAAGAAATGAAGATGG + Intronic
983195295 4:164799620-164799642 GGTGGACTCAGTAAAGCAGATGG - Intergenic
983430658 4:167646446-167646468 GGAGGAATAAACAGTGAAGAAGG - Intergenic
983987004 4:174072064-174072086 CTTGGACTAGGCAGTGAAGATGG + Intergenic
987557845 5:19478523-19478545 GGTGAACTAAGAGAAGAAGATGG - Intronic
987557924 5:19479604-19479626 GGTGGACAAAGAGAAGAAGATGG - Intronic
987587857 5:19880468-19880490 AGTGAATTAAGCATTGAAGAAGG + Intronic
989533974 5:42542201-42542223 GGTGGAAGAATCAATGGAGAAGG + Intronic
991150337 5:63360489-63360511 GGTAGATTAATCCATGAAGATGG - Intergenic
991913659 5:71585644-71585666 AGTGGACTGAGCAATGAACATGG - Intergenic
993267319 5:85742772-85742794 GGTGGATGAAGAAATCAAGAAGG - Intergenic
993728524 5:91395795-91395817 GGTGGACTGAGTAAAGCAGATGG - Intergenic
994137849 5:96308578-96308600 GGTAGACAAATCCATGAAGATGG - Intergenic
995646536 5:114319253-114319275 GGTAGACACAGCAATGGAGAGGG - Intergenic
995884728 5:116881595-116881617 GGTGTACTGAGAGATGAAGAAGG - Intergenic
1000293579 5:159893559-159893581 GTTGTACTAAGCCAGGAAGAAGG + Intergenic
1000393399 5:160748354-160748376 GATAGATTAAGCAATGAGGAAGG - Intronic
1001339732 5:170832179-170832201 GGTGGACTGAGTAAAGCAGATGG - Intergenic
1004215604 6:13701383-13701405 TGTGGACTAAGCCATTGAGAGGG - Intronic
1005822545 6:29609426-29609448 GGAGGACAAAGGAATGAAGACGG + Intronic
1007110519 6:39310906-39310928 GGTGGACACAGAAAAGAAGAAGG + Exonic
1008504600 6:52217425-52217447 GGTGGACTCAGCACTAAGGAAGG + Intergenic
1008764771 6:54898391-54898413 CGTGGACTCAGAAATGAAGATGG + Intronic
1012631665 6:101477394-101477416 GGTGGGCTAAGCTCTCAAGAAGG - Intronic
1013192137 6:107812548-107812570 GGTGGACTGAGTAAAGCAGATGG + Intronic
1014634649 6:123830181-123830203 AGTGGTCTAAGCAAGGAGGATGG - Intronic
1015394907 6:132722440-132722462 GGTGGACTGAGTAAAGCAGACGG - Intergenic
1015812702 6:137177339-137177361 GTTGGGCTAAGCAAGGAACATGG - Intergenic
1016832866 6:148450328-148450350 GGGAGACTGAGCAATAAAGAAGG - Intronic
1017650369 6:156576059-156576081 GGTGAATGAAGCATTGAAGAGGG + Intergenic
1020612764 7:10421514-10421536 GGTGAAAGAAGCAGTGAAGAAGG + Intergenic
1021040526 7:15856566-15856588 GGTGGACTAAGAATTCAATAGGG - Intergenic
1022402619 7:30054714-30054736 GGTGAAATAAGGAAGGAAGATGG + Exonic
1022403743 7:30066611-30066633 TGTGGAATATGCAATGGAGAGGG - Intronic
1023173875 7:37417134-37417156 GGTGGACACACCACTGAAGAGGG + Intronic
1023184553 7:37519317-37519339 GCTGGACTAAGTAAAGCAGATGG + Intergenic
1026217166 7:68359837-68359859 GGTGGACTAAGTAAAGCAGATGG + Intergenic
1029169583 7:98621167-98621189 GGTGGCCAAAGCCATGATGATGG - Intronic
1030617893 7:111757306-111757328 GGTGGAAAAAACAATGGAGAAGG + Intronic
1035052431 7:156007076-156007098 GCTGGACAAAGCAATGATGCAGG - Intergenic
1035862336 8:3042604-3042626 GATGGAGTCAGCACTGAAGATGG - Intronic
1036114878 8:5948336-5948358 GGTGGTACAAGCAATGTAGATGG - Intergenic
1036164039 8:6415126-6415148 GGTGGACTTAGGAAGCAAGAGGG + Intronic
1037322030 8:17652944-17652966 GGTGGTCTAAGCTAAAAAGAAGG - Intronic
1037512115 8:19594022-19594044 GGTGGAATATGCCATGAAGATGG + Intronic
1037755250 8:21706145-21706167 GGTGGAAGAAGCCAGGAAGAGGG + Intronic
1040974105 8:53170816-53170838 GGTGGACTGAGTAAAGCAGATGG + Intergenic
1042936023 8:74059077-74059099 GGTGGACTGAGTAAAGATGATGG - Intergenic
1044182700 8:89215763-89215785 GGTGAGAAAAGCAATGAAGAGGG + Intergenic
1045499183 8:102731997-102732019 GGTGGACTGAGAAATCAAGCTGG + Intergenic
1046079306 8:109351867-109351889 GGTAGTCTAAGCCATGAACATGG + Intergenic
1049680961 8:143917955-143917977 GGTGTACCAGGCCATGAAGAAGG - Exonic
1049926662 9:415562-415584 TGTGGATTAAGGAATGTAGAGGG + Intronic
1050498684 9:6271258-6271280 TGTGGAGTGAGGAATGAAGAGGG - Intergenic
1052681931 9:31704583-31704605 GGTGGACTGAGTAAAGCAGATGG + Intergenic
1054860816 9:69951227-69951249 GGTAGACTGAGTAAAGAAGATGG - Intergenic
1055317524 9:75048728-75048750 GGTGGATTAGACATTGAAGATGG + Intergenic
1055748068 9:79472853-79472875 TGTGGTCAAAGGAATGAAGAGGG - Intergenic
1056300208 9:85232413-85232435 GATGGAATACGAAATGAAGATGG - Intergenic
1056472267 9:86917624-86917646 GGTGGAGAAAGTAATTAAGAAGG + Intergenic
1056779827 9:89541067-89541089 GGTGGACTGAGGAATGCAGGTGG - Intergenic
1058886016 9:109321344-109321366 GGTGGACTAGGTAATCAACACGG + Intergenic
1186453918 X:9695952-9695974 GGTTGACTAAGTAATGATGGTGG - Intronic
1186814156 X:13219328-13219350 GGTGGAGTTAGCAATAGAGAAGG - Intergenic
1187790738 X:22947378-22947400 GGTGGATAAAGAAATGAATAAGG + Intergenic
1190066899 X:47247725-47247747 GGTGGAATCAGAAAGGAAGAAGG - Intronic
1190275056 X:48893972-48893994 GGTGGGCTCAGCAATGATGGGGG - Exonic
1192534053 X:71912503-71912525 GGTGGGGTCTGCAATGAAGAGGG - Intergenic
1192585109 X:72313172-72313194 GGTGGACAGAGCTGTGAAGATGG - Intergenic
1192774994 X:74234721-74234743 GTTGCACTAAGCAATGATAATGG - Intergenic
1193403380 X:81072437-81072459 GGTGCACTGACCAAGGAAGAAGG + Intergenic
1194502245 X:94696055-94696077 GCTGGACTAAGCAAAGCAGAGGG + Intergenic
1198377054 X:136050637-136050659 GGTGGAATAAGGAAGCAAGAGGG + Intergenic
1199065218 X:143408084-143408106 GAAGGAATAAGCAATGAATAAGG + Intergenic
1199207667 X:145167418-145167440 ATTGGATTTAGCAATGAAGATGG + Intergenic