ID: 932818214

View in Genome Browser
Species Human (GRCh38)
Location 2:74878560-74878582
Sequence AAGAGGGATTCTGTCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818210_932818214 2 Left 932818210 2:74878535-74878557 CCCTGCACAGGTGGACTAAGCAA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818202_932818214 20 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818208_932818214 7 Left 932818208 2:74878530-74878552 CCTGCCCCTGCACAGGTGGACTA 0: 1
1: 0
2: 5
3: 6
4: 123
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818203_932818214 16 Left 932818203 2:74878521-74878543 CCTCCTCCTCCTGCCCCTGCACA 0: 1
1: 2
2: 32
3: 259
4: 2584
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818199_932818214 23 Left 932818199 2:74878514-74878536 CCCCCTTCCTCCTCCTCCTGCCC 0: 2
1: 10
2: 159
3: 1191
4: 5781
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818209_932818214 3 Left 932818209 2:74878534-74878556 CCCCTGCACAGGTGGACTAAGCA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818200_932818214 22 Left 932818200 2:74878515-74878537 CCCCTTCCTCCTCCTCCTGCCCC 0: 2
1: 29
2: 636
3: 5320
4: 15002
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818201_932818214 21 Left 932818201 2:74878516-74878538 CCCTTCCTCCTCCTCCTGCCCCT 0: 1
1: 12
2: 180
3: 1177
4: 5334
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818207_932818214 10 Left 932818207 2:74878527-74878549 CCTCCTGCCCCTGCACAGGTGGA 0: 1
1: 1
2: 4
3: 28
4: 390
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818205_932818214 13 Left 932818205 2:74878524-74878546 CCTCCTCCTGCCCCTGCACAGGT 0: 1
1: 0
2: 6
3: 92
4: 749
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137
932818211_932818214 1 Left 932818211 2:74878536-74878558 CCTGCACAGGTGGACTAAGCAAT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818214 Original CRISPR AAGAGGGATTCTGTCCCCAC TGG Intronic
900383133 1:2395306-2395328 AGGAGGGATCCTGTCCTCTCAGG - Intronic
901221161 1:7584635-7584657 AACAGGGGTTCTGCCCCCATGGG + Intronic
902716420 1:18275914-18275936 AAGAGGACTACAGTCCCCACCGG + Intronic
902771537 1:18648038-18648060 CTGATGGCTTCTGTCCCCACAGG + Intronic
907264116 1:53245402-53245424 CAGAAGGATTCAGTCCCCAGTGG - Intergenic
915105625 1:153533609-153533631 AAGTTGTCTTCTGTCCCCACTGG - Intergenic
916438473 1:164798788-164798810 CAAAGGGAATCTGTCCCCAGGGG - Intronic
921605719 1:217152153-217152175 AAGAAGGAATCTGTTTCCACAGG - Intergenic
922692109 1:227701574-227701596 CTAAGGGATTCTGTCACCACTGG + Intergenic
923505903 1:234607230-234607252 AAGAGGGCATTTTTCCCCACTGG + Exonic
1063146645 10:3301008-3301030 ATGAGCGACGCTGTCCCCACAGG - Intergenic
1063608005 10:7539933-7539955 AACACAGATTCTCTCCCCACTGG - Intergenic
1064150304 10:12857557-12857579 CTGAGAGATTTTGTCCCCACCGG + Intergenic
1064340966 10:14484883-14484905 AAAAGGGAGTTTGTCCCCAAAGG + Intergenic
1065467521 10:26041227-26041249 AAGAGGTATTCTATGCCAACCGG - Intronic
1066545410 10:36494729-36494751 AAGATGGATTTTGTGGCCACTGG - Intergenic
1068944050 10:62710731-62710753 AAGAGAAAACCTGTCCCCACTGG + Intergenic
1071298937 10:84242141-84242163 GAGAGAGCTTCTGTTCCCACAGG - Intergenic
1071340120 10:84638457-84638479 CTGAGGGATTTTGTCACCACTGG + Intergenic
1073843141 10:107521116-107521138 AAGAGGGATCCTAGTCCCACAGG + Intergenic
1074386000 10:113017217-113017239 ATGAGGGATTCTGGTCCCACAGG + Intronic
1074900552 10:117812903-117812925 AATAAAGATTCTGACCCCACAGG - Intergenic
1075018172 10:118926467-118926489 GAGAGTAATTCTGTCCCCCCAGG - Intergenic
1075694115 10:124420622-124420644 AAAAGGGATTCAGTCCCCCTGGG + Intergenic
1076413953 10:130271631-130271653 AACAAGGCTTCTGTCCACACGGG - Intergenic
1076480612 10:130782837-130782859 CAGAGGCCTTCTGACCCCACTGG - Intergenic
1077855275 11:6117542-6117564 TTGAGGGAATCTGTCACCACTGG + Intergenic
1083378425 11:62244571-62244593 CAGTGGGATTCTGCCCCCAAAGG - Intronic
1084517517 11:69644698-69644720 ATGTGCGAGTCTGTCCCCACTGG - Intronic
1084597334 11:70124767-70124789 AAGAGGATCTCTGTCCTCACAGG + Intronic
1090232625 11:125119575-125119597 AAGAGAGAATCTGTCCCCATTGG + Intergenic
1091676498 12:2494748-2494770 AAGAGGGATTCTGAATCAACAGG - Intronic
1095931125 12:47626097-47626119 CTGAGGGATTTTGTCACCACCGG + Intergenic
1096222276 12:49838470-49838492 CAGAAGGCTTCTGTCCCAACTGG + Exonic
1097315168 12:58164099-58164121 AAGAGAGATTAAGTCCCCAAAGG - Intergenic
1103975427 12:124699637-124699659 CAGAGGGATTCTGTGCACATTGG + Intergenic
1106397671 13:29396931-29396953 AAGAGGGATGAGGTACCCACAGG - Intronic
1110445800 13:75578764-75578786 AAGAGGGATTATTTGACCACTGG + Intronic
1111438309 13:88241759-88241781 AAGAGGTATTGTGTCCCCTAAGG + Intergenic
1118673913 14:68161870-68161892 AGGAGGGATTTTGCCCCCAGAGG + Intronic
1119594127 14:75918059-75918081 AAGATGGTTTCTGTTCCTACCGG + Intronic
1120113863 14:80590956-80590978 CTGAGAGATTCTGTCACCACCGG + Intronic
1121518758 14:94571313-94571335 AGGGGAGATTCTGCCCCCACTGG - Intronic
1122300660 14:100729220-100729242 AGGAGGCATTCGGTACCCACAGG - Intronic
1122794390 14:104198707-104198729 CAGATGGACTCTGTCCCCAAAGG + Intergenic
1128511197 15:68314928-68314950 CAGAGGGATTGTGTCCACTCTGG - Intronic
1128873360 15:71181625-71181647 AAGAGGGACTCTGTCCACAGTGG - Intronic
1130220678 15:82016970-82016992 AAAAGGTATTCTGTGCCCAGAGG - Intergenic
1130891258 15:88135765-88135787 AAGAGTCCTTCTGTCCCTACTGG + Intronic
1132630404 16:914551-914573 AAGAGGGAGTGTGTCACCAGTGG - Intronic
1139551885 16:67678074-67678096 AAGATGGATTCTGTTCACACAGG + Intronic
1142273012 16:89100836-89100858 CAGGGCGATTCTGTCCCCAAAGG - Exonic
1144408584 17:14976636-14976658 ATGAGGAACTCTGTCCTCACCGG + Intergenic
1148330154 17:46809382-46809404 AAGTGGGACTCTGTGCCCAGGGG + Intronic
1153247156 18:3083371-3083393 AAAAGAAATTCTTTCCCCACTGG - Intronic
1156746606 18:40399557-40399579 AAGAGGGATTCCTTTCCCACTGG - Intergenic
1158548546 18:58416162-58416184 CAGAAGGATTCTGCCCCCAAAGG + Intergenic
1158890102 18:61864578-61864600 AAGAGGGAGTTAGTCCCCAGTGG - Intronic
1161714076 19:5865741-5865763 CAGGGCGATTCTGTCCCCAAGGG - Intergenic
1162095480 19:8307536-8307558 GAGAGGGAGCCCGTCCCCACTGG + Intronic
1163336099 19:16672844-16672866 AGAAGGGATTCTGTTCCCAAAGG + Intronic
930019790 2:46994559-46994581 ACGCAGGGTTCTGTCCCCACTGG + Intronic
931292408 2:60885451-60885473 AATAGGGATTCTGTTACCAAGGG - Intronic
931966903 2:67544868-67544890 CAGAAGGATCCTGTCCCCATTGG - Intergenic
932818214 2:74878560-74878582 AAGAGGGATTCTGTCCCCACTGG + Intronic
935296096 2:101650952-101650974 CAGAGGGATTCCGGCCCCGCAGG + Intergenic
935459948 2:103318482-103318504 AATAGGGAGTCTTTCCCCATTGG + Intergenic
936587140 2:113767996-113768018 ATGAGGGATTCTGTCCACTAGGG + Intergenic
936914965 2:117630937-117630959 AAGAGGGATTCTTTGCTCTCAGG - Intergenic
937169823 2:119854777-119854799 AAGAGGGATTATGGCCACCCGGG + Intronic
942541240 2:177017532-177017554 AAGAGGGATTCTAGCCCAAATGG - Intergenic
942900863 2:181116584-181116606 AAGAGTGATTTTGTCCACAGTGG - Intergenic
944950356 2:204741758-204741780 CAGATGGCTTGTGTCCCCACTGG - Intronic
947186888 2:227463518-227463540 AAGCAGGTTTCTCTCCCCACAGG + Intergenic
1168914481 20:1475123-1475145 ATGAGTGATTTTGCCCCCACTGG - Exonic
1170692188 20:18625795-18625817 AGGAGGCATTCTCACCCCACAGG - Intronic
1178132178 21:29586052-29586074 AGGAGGGATTTTGTCCCCCAGGG - Intronic
1179599616 21:42467552-42467574 ATGAGGGCTTCTGTCACCAAAGG - Intergenic
1181365257 22:22371577-22371599 GACAGGGATTCTGTCTTCACAGG + Intergenic
1181910598 22:26235292-26235314 AAGAGTGATTTTGTTCCCAGAGG - Intronic
1183516969 22:38272527-38272549 AAGAGGGATTGTGTGCTCCCGGG - Intronic
1185101229 22:48841935-48841957 AAGAGGGATTCAGTCCCAGGTGG + Intronic
949215177 3:1558819-1558841 AAGAGGGATATTGTCCCAATAGG - Intergenic
949573419 3:5315209-5315231 AAGAGAGATGCTGTCCACCCTGG - Intergenic
949952113 3:9237959-9237981 AGGAGTGATTTTGTCCCCAGGGG + Intronic
950359339 3:12439413-12439435 AGGAGGCATTCTGGGCCCACGGG + Intergenic
953268351 3:41415309-41415331 CAGGTGGATTCTGTCACCACTGG + Intronic
954151919 3:48662166-48662188 AAGAGGTAGTCTGTCACCAGGGG - Exonic
959851570 3:111094668-111094690 AAGATGGATTCAGTTCCCTCAGG + Intronic
960051230 3:113241257-113241279 ATGAAGGTTTCTGTCCCCAAAGG + Intronic
961409064 3:126704959-126704981 CAGAGGGATGCAGTCCCCAGAGG - Intronic
961625029 3:128255759-128255781 AAGAGGGCTTTTGTCCCAAGAGG + Intronic
964065258 3:152570323-152570345 ATTAGGCCTTCTGTCCCCACAGG - Intergenic
976907881 4:90262905-90262927 CAGGGTGATTATGTCCCCACAGG - Intronic
978049620 4:104181733-104181755 AAGAGGGAATCTTTGCACACTGG + Intergenic
979282118 4:118879965-118879987 AGGAGGGATTCTGTCCTGACAGG - Intronic
980956074 4:139430556-139430578 AAGATGGAGTCTGTTCACACAGG + Intergenic
981552365 4:145954949-145954971 AGGAGGGAATCTGTGCCCAGGGG + Intergenic
984879725 4:184399809-184399831 AAGATGGATTCTGACCACCCTGG + Intronic
986851202 5:11816308-11816330 CAGAGAGATCCTGTCCCCAAGGG + Intronic
991977353 5:72196320-72196342 AAGAGGGAGTCTGTGGCCAGTGG + Exonic
994833590 5:104818493-104818515 AGGAGGTATTTTGTCACCACTGG + Intergenic
996621532 5:125510196-125510218 GAGAGAGACCCTGTCCCCACAGG + Intergenic
1001886047 5:175291325-175291347 AAGAGGTATTCTGTCCTCATTGG - Intergenic
1002058781 5:176613850-176613872 CAGATGGATTCTCTCCACACGGG - Intergenic
1002934111 6:1657062-1657084 AAGAGGGTTTCTTTTGCCACAGG + Intronic
1004164038 6:13240002-13240024 AAGATCGATTGTGTTCCCACTGG - Intronic
1005041201 6:21602079-21602101 AGCTGGGGTTCTGTCCCCACTGG + Intergenic
1007703125 6:43775778-43775800 GAGAAGGATTCTGTGCCCATTGG + Intronic
1010727208 6:79348709-79348731 CTGAGGGATTTTGTCACCACTGG + Intergenic
1012543196 6:100386641-100386663 AAGTGGGATTCTCTGCCCAGAGG + Exonic
1013669687 6:112386525-112386547 AACAGGGAATCTTTCCCCATTGG - Intergenic
1018291683 6:162298252-162298274 TAGAGGGTTGCAGTCCCCACCGG - Intronic
1018705706 6:166461923-166461945 TAGAGGGGTTTTGCCCCCACTGG + Intronic
1019272097 7:156150-156172 AAGAGGGATCCTCTCCTCACTGG - Intergenic
1019708919 7:2509598-2509620 AAGGGGGACACTGTCCCCCCAGG + Intergenic
1022805421 7:33816329-33816351 AAGAGGGCCTGTGTCACCACTGG + Intergenic
1024244512 7:47459103-47459125 AAGAGGGATTATGTTCCATCTGG - Intronic
1025603937 7:63025253-63025275 AAAGGGGATTTTGTCCCCAGGGG - Intergenic
1026661708 7:72308560-72308582 ATGAGGGATCCTGTCCCCCTGGG + Intronic
1028014429 7:85688797-85688819 AAGATTGATTCTCTACCCACTGG + Intergenic
1029276513 7:99408417-99408439 CAGAGGGAGGCTGTCCGCACCGG - Intronic
1032597609 7:133257237-133257259 AATCAGGATTCTGTCCCCCCCGG - Intronic
1035774804 8:2180037-2180059 AACAGGGAAGGTGTCCCCACTGG + Intergenic
1037009581 8:13823916-13823938 AAAAGGCATTCTTTCTCCACTGG - Intergenic
1037928579 8:22864495-22864517 ACGAGGGGTTCTGTCCCAGCTGG + Intronic
1038336793 8:26652127-26652149 GACAGGGATCCTGTCCCAACTGG - Intronic
1043928022 8:86060056-86060078 AACAGGGAAACTGTCACCACTGG + Intronic
1044610607 8:94088369-94088391 AAGAGGGATTCTCCCAGCACAGG - Intergenic
1045034780 8:98168560-98168582 CACAGTGATTCAGTCCCCACTGG + Intergenic
1045496638 8:102714918-102714940 AAGAGGGCTTCCCTCCCTACTGG + Intergenic
1050189092 9:3006450-3006472 AACAAGGATTCTGCCACCACAGG + Intergenic
1056863136 9:90205531-90205553 AAAAAAGATTCTGTCCCAACTGG + Intergenic
1056895884 9:90549403-90549425 AAGAAGAATTTTTTCCCCACAGG - Intergenic
1062046218 9:134425656-134425678 AAGTGGTGTGCTGTCCCCACAGG - Intronic
1188390915 X:29618000-29618022 AAGAGGCCTTCTTTTCCCACTGG + Intronic
1188961032 X:36491525-36491547 AGAAGGGATTCTCGCCCCACAGG - Intergenic
1190201978 X:48369564-48369586 AAGAGGGATTTTCTCCCTCCTGG + Intergenic
1190208560 X:48425849-48425871 AAGAGGGATTTTCTCCCTCCTGG - Intergenic
1190668827 X:52720174-52720196 AAGAGGGATTTTCTCCCTCCTGG + Intergenic
1190670590 X:52738230-52738252 AAGAGGGATTTTCTCCCTCCTGG - Intergenic
1190909617 X:54758901-54758923 AAGAGGGATCCTCCCCACACTGG + Exonic
1192406611 X:70892199-70892221 CTGAGGGATTTTGTCACCACCGG + Intronic
1194231984 X:91335745-91335767 CAGAGAGATTTTGTCACCACCGG - Intergenic
1199148769 X:144404130-144404152 AAGGGGAATTCTATCCCCAAGGG - Intergenic
1201719268 Y:17078976-17078998 AAGTGGAATTATGACCCCACAGG + Intergenic