ID: 932818215

View in Genome Browser
Species Human (GRCh38)
Location 2:74878561-74878583
Sequence AGAGGGATTCTGTCCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 850}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818205_932818215 14 Left 932818205 2:74878524-74878546 CCTCCTCCTGCCCCTGCACAGGT 0: 1
1: 0
2: 6
3: 92
4: 749
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818202_932818215 21 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818208_932818215 8 Left 932818208 2:74878530-74878552 CCTGCCCCTGCACAGGTGGACTA 0: 1
1: 0
2: 5
3: 6
4: 123
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818201_932818215 22 Left 932818201 2:74878516-74878538 CCCTTCCTCCTCCTCCTGCCCCT 0: 1
1: 12
2: 180
3: 1177
4: 5334
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818200_932818215 23 Left 932818200 2:74878515-74878537 CCCCTTCCTCCTCCTCCTGCCCC 0: 2
1: 29
2: 636
3: 5320
4: 15002
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818203_932818215 17 Left 932818203 2:74878521-74878543 CCTCCTCCTCCTGCCCCTGCACA 0: 1
1: 2
2: 32
3: 259
4: 2584
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818209_932818215 4 Left 932818209 2:74878534-74878556 CCCCTGCACAGGTGGACTAAGCA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818199_932818215 24 Left 932818199 2:74878514-74878536 CCCCCTTCCTCCTCCTCCTGCCC 0: 2
1: 10
2: 159
3: 1191
4: 5781
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818207_932818215 11 Left 932818207 2:74878527-74878549 CCTCCTGCCCCTGCACAGGTGGA 0: 1
1: 1
2: 4
3: 28
4: 390
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818210_932818215 3 Left 932818210 2:74878535-74878557 CCCTGCACAGGTGGACTAAGCAA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850
932818211_932818215 2 Left 932818211 2:74878536-74878558 CCTGCACAGGTGGACTAAGCAAT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG 0: 1
1: 0
2: 2
3: 42
4: 850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818215 Original CRISPR AGAGGGATTCTGTCCCCACT GGG Intronic
900818045 1:4865275-4865297 TGAGGGATTTTGTCACCACCAGG - Intergenic
901209130 1:7514725-7514747 AGAGGAATCCTCTTCCCACTGGG + Intronic
901335568 1:8446056-8446078 TGAGAGATTTTGTCACCACTAGG - Intronic
901584347 1:10275462-10275484 ACAGGGATTCTGTACTTACTTGG + Exonic
902141389 1:14359627-14359649 TGAGAGATTTTGTCACCACTAGG - Intergenic
902746730 1:18479622-18479644 AGAGTGATTATGTCACTACTGGG + Intergenic
904364177 1:29999939-29999961 AAAGGGATGCTGTGCTCACTTGG - Intergenic
906579369 1:46923614-46923636 TGAGGGATTTTGTCACCACCAGG - Intergenic
906604351 1:47155249-47155271 TGAGGGATTTTGTCACCACCAGG + Intergenic
906886976 1:49659113-49659135 TGAGGGAATTTGTCACCACTAGG + Intronic
908099538 1:60776723-60776745 TGAGAGATTTTGTCACCACTAGG - Intergenic
908116668 1:60947543-60947565 AGAGGAACTCTGTCCACACTAGG + Intronic
908584423 1:65552907-65552929 TGAGAGATTCTGTCACCACCAGG - Intronic
908733148 1:67247805-67247827 TGAGAGATTCTGTCACCACCAGG - Intronic
908904091 1:68987740-68987762 TGAGGGATTTTGTCACCACCAGG + Intergenic
909262997 1:73519207-73519229 AGAGGGATTCTGTTGAGACTAGG + Intergenic
909449190 1:75779544-75779566 TGAGAGATTCTGTCACCACAAGG + Intronic
909454097 1:75830739-75830761 TGAGAGATTCTGTCACCACCAGG + Intronic
910572089 1:88716986-88717008 TGAGAGATTCTGTCACCACCAGG - Intronic
910627112 1:89318556-89318578 TGAGGGATTTTGTCACCACCAGG + Intergenic
911106473 1:94136047-94136069 TGAGAGATTTTGTCACCACTGGG + Intergenic
911556857 1:99355470-99355492 TGAGGGATTTTGTCACCACCAGG + Intergenic
911670492 1:100602430-100602452 TGAGAGATTCTGTCACCACCAGG - Intergenic
911938380 1:104010362-104010384 TGAGGGATTTTGTCACCACCAGG - Intergenic
912303786 1:108543810-108543832 TGAGAGATTCTGTCACCACCAGG + Intergenic
912676104 1:111682144-111682166 TGAGGGATTTTGTCACCACCAGG + Intronic
913119196 1:115724124-115724146 AGAGTGACTATGTCCCCACAAGG - Intronic
913398831 1:118405078-118405100 TGAGGGATTTTGTCACCACCAGG + Intergenic
914336621 1:146721383-146721405 TGAGAGATTCTGTCACCACCAGG - Intergenic
914400806 1:147318252-147318274 TGAGGGATTTTGTCACCACCAGG + Intergenic
914404809 1:147359915-147359937 TGAGGGAATTTGTCACCACTAGG + Intergenic
915105624 1:153533608-153533630 AGTTGTCTTCTGTCCCCACTGGG - Intergenic
915846436 1:159270509-159270531 TGAGGGATTTTGTCACCACCAGG + Intergenic
915886969 1:159732383-159732405 TGAGAGATTCTGTCACCACCAGG + Intergenic
915975900 1:160388777-160388799 TGAGAGATTCTGTCACCACAAGG - Intergenic
916140761 1:161695079-161695101 AGAGGGATTTTGCCACCACCAGG + Intergenic
916387362 1:164289713-164289735 TGAGAGATTTTGTCACCACTAGG + Intergenic
916949118 1:169761142-169761164 TGAAGGACTCTGTCCACACTTGG + Intronic
917007246 1:170428383-170428405 TGAGGGATTTTGTCACCACCAGG + Intergenic
917232591 1:172854452-172854474 TGAGGGATTTTGTCACCACCAGG - Intergenic
917295487 1:173514843-173514865 TGAGGGATTTTGTCACCACCAGG - Intronic
917357969 1:174145819-174145841 TGAGGGATTTTGTCACCACCAGG + Intergenic
917406158 1:174710626-174710648 TGAGGGATTTTGTCACCACCAGG + Intronic
917549193 1:176006540-176006562 TGAGGGATTTTGTCACCACCAGG - Intronic
918360186 1:183749752-183749774 TGAGGGATTTTGTCACCACCAGG - Intronic
918616401 1:186549492-186549514 TGAGAGATTTTGTCACCACTAGG - Intergenic
918786564 1:188770803-188770825 TGAGGGATTTTGTCACCACCAGG + Intergenic
918804167 1:189017829-189017851 TGAGGGATTTTGTCACCACCAGG - Intergenic
918955427 1:191200676-191200698 TGAGGGATTTTGTCACCACAAGG + Intergenic
919136378 1:193512897-193512919 TGAGGGATTTTGTCACCACCAGG - Intergenic
919752879 1:201049040-201049062 AGAAGGATTCAGCCCCCTCTGGG - Exonic
920085575 1:203413398-203413420 TGAGAGATTTTGTCACCACTAGG + Intergenic
920377903 1:205519140-205519162 TGAGCCCTTCTGTCCCCACTTGG + Intronic
920987837 1:210907286-210907308 AGAGTGAGTCCTTCCCCACTGGG - Intronic
921738095 1:218651961-218651983 TGAGGGATTTTGTCACCACCAGG - Intergenic
922253216 1:223869348-223869370 TGAGGGATTTTGTCACCACCAGG - Intergenic
922379819 1:225012142-225012164 TGAGGGATTTTGTCACCACCAGG - Intronic
922692110 1:227701575-227701597 TAAGGGATTCTGTCACCACTGGG + Intergenic
923442430 1:234033606-234033628 ATAGGGTGTCTTTCCCCACTTGG + Intronic
923505904 1:234607231-234607253 AGAGGGCATTTTTCCCCACTGGG + Exonic
924731552 1:246716135-246716157 TGAGAGATTTTGTCACCACTAGG + Intergenic
1062810618 10:461000-461022 TGAGAGATTCTGTCACCACCAGG + Intronic
1063489481 10:6449883-6449905 TGAGGGATTTTGTCACCACCAGG + Intronic
1063608004 10:7539932-7539954 ACACAGATTCTCTCCCCACTGGG - Intergenic
1064150305 10:12857558-12857580 TGAGAGATTTTGTCCCCACCGGG + Intergenic
1065157203 10:22882606-22882628 TGAGAGATTCTGTCACCACCAGG + Intergenic
1065735829 10:28751408-28751430 TGAGGGATTTTGTCACCACCAGG - Intergenic
1067006324 10:42667084-42667106 TGAGAGATTCTGTCACCACCAGG + Intergenic
1067996550 10:51280065-51280087 TGAGAGATTCTGTCACCACCAGG - Intronic
1068295815 10:55071048-55071070 TGAGAGATTCTGTCACCACCAGG + Intronic
1068410179 10:56644785-56644807 TGAGGGATTTTGTCACCACCAGG - Intergenic
1068567815 10:58594675-58594697 TGAGAGATTTTGTCACCACTAGG + Intronic
1068609356 10:59042036-59042058 TGAGAGATTTTGTCACCACTAGG - Intergenic
1068623203 10:59209378-59209400 TGAGAGATTTTGTCACCACTAGG + Intronic
1069139733 10:64808635-64808657 TGAGGGATTTTGTCACCACCAGG - Intergenic
1069784608 10:70979707-70979729 ATAAGGATCCTGTCCCCACATGG - Intergenic
1070213383 10:74349364-74349386 TGAGGGATTTTGTCACCACCAGG + Intronic
1070892677 10:79953313-79953335 TGAGGGAGTTTGTCACCACTAGG - Intronic
1070908069 10:80092088-80092110 AGAATGACTCTGTCACCACTAGG + Exonic
1071210968 10:83341564-83341586 AGAGAGATTTTGTCACCACCAGG - Intergenic
1071340121 10:84638458-84638480 TGAGGGATTTTGTCACCACTGGG + Intergenic
1071900613 10:90117257-90117279 TGAGAGATTCTGTCACCACCAGG - Intergenic
1071922715 10:90370006-90370028 TGAGAGATTCTGTCACCACCAGG - Intergenic
1072023627 10:91431071-91431093 TGAGGGATTTTGTCACCACCAGG - Intronic
1072024579 10:91442272-91442294 TGAGAGATTCTGTCACCACCAGG - Intronic
1072025118 10:91447323-91447345 TGAGAGATTCTGTCACCACCAGG + Intronic
1072394145 10:95021643-95021665 AGAGAGATTTTGTCACCACCAGG - Intergenic
1072394448 10:95024519-95024541 AGAGAGATTTTGTCACCACCAGG - Intergenic
1072485957 10:95855628-95855650 TGAGAGATTCTGTCACCACCAGG - Intronic
1072953310 10:99867872-99867894 TGAGGGATTTTGTCACCACCAGG - Intergenic
1073022420 10:100456393-100456415 TGAGAGATTTTGTCCCCACCAGG + Intergenic
1073698344 10:105895384-105895406 TGAGGGATTTTGTCACCACCAGG + Intergenic
1074111591 10:110426737-110426759 AGAGCAATTCTGGCCCCATTTGG + Intergenic
1074303376 10:112252847-112252869 TGAGAGATTTTGTCACCACTAGG + Intergenic
1074386001 10:113017218-113017240 TGAGGGATTCTGGTCCCACAGGG + Intronic
1074465014 10:113673350-113673372 TGAGAGATTCTGTCACCACCAGG + Intergenic
1075175208 10:120154053-120154075 TGAGGGATTTTGTCACCACCAGG - Intergenic
1075983710 10:126765239-126765261 TGAGGGATGCTGTCACCACCAGG - Intergenic
1076397617 10:130152497-130152519 TGAGAGATTCTGTCACCACCAGG - Intronic
1077720791 11:4626369-4626391 AGAGGATTTCTGTTTCCACTAGG + Intergenic
1077721107 11:4629816-4629838 TGAGGGATTTTGTCACCACCTGG + Intergenic
1077855276 11:6117543-6117565 TGAGGGAATCTGTCACCACTGGG + Intergenic
1078021751 11:7662339-7662361 TGAGAGATTTTGTCACCACTAGG - Intergenic
1078813881 11:14800120-14800142 TGAGAGATTCTGTCACCACCAGG - Intronic
1079177878 11:18159725-18159747 TGAGAGATTCTGTCACCACCAGG + Intronic
1079262650 11:18898078-18898100 TGAGGGATTTTGTCACCACTAGG + Intergenic
1079393754 11:20044090-20044112 AGAAGGATTCCGCCTCCACTTGG - Exonic
1079715125 11:23733860-23733882 TGAGGGATTTTGTCACCACCAGG + Intergenic
1079868105 11:25760243-25760265 TGAGAGATTTTGTCACCACTAGG + Intergenic
1080363680 11:31545934-31545956 TGAGGGATTTTGTCACCACCAGG + Intronic
1080710253 11:34739728-34739750 TGAGGGATTTTGTCACCACCAGG + Intergenic
1080965423 11:37209294-37209316 TGAGGGATTTTGTCACCACCAGG - Intergenic
1081252140 11:40849332-40849354 TGAGGGATTTTGTCACCACCAGG - Intronic
1082150764 11:48735831-48735853 TGAGAGATTCTGTCACCACCAGG + Intergenic
1082182782 11:49140607-49140629 TGAGGGATTTTGTCACCACCAGG + Intergenic
1082568751 11:54712758-54712780 TGAGAGATTCTGTCACCACCAGG - Intergenic
1082871942 11:57951726-57951748 TGAGGGATTTTGTCACCACCAGG - Intergenic
1082903419 11:58281499-58281521 TGAGGGATTTTGTCACCACCAGG - Intergenic
1083006108 11:59348364-59348386 TGAGGGATTTTGTCACCACCAGG - Intergenic
1083073283 11:60009790-60009812 TGAGGGATTTTGTCACCACCAGG - Intergenic
1083368550 11:62158744-62158766 AGAGAGATTTTGTCCCCACCAGG + Intergenic
1083515393 11:63252853-63252875 TGAGGAATTTTGTCACCACTAGG + Intronic
1083837335 11:65279815-65279837 AGAGTGATTTTCTTCCCACTTGG + Intronic
1084517516 11:69644697-69644719 TGTGCGAGTCTGTCCCCACTGGG - Intronic
1084836729 11:71807366-71807388 AGATGGATTCTCACCCCTCTTGG + Intergenic
1085003589 11:73063238-73063260 TGAGGGATTTTGTCACCACCAGG + Intronic
1086529031 11:87762581-87762603 TGAGAGATTCTGTCACCACCAGG - Intergenic
1087100648 11:94360695-94360717 TGAGAGATTTTGTCACCACTAGG + Intergenic
1087330594 11:96775985-96776007 TGAGAGATTCTGTCACCACCAGG - Intergenic
1087719031 11:101640835-101640857 TGAGAGATTCTGTCACCACCAGG + Intronic
1087824107 11:102745631-102745653 TGAGAGATTTTGTCACCACTAGG - Intergenic
1088008515 11:104970879-104970901 TGAGGGATTTTGTCACCACCAGG + Intergenic
1088066660 11:105727826-105727848 TGAGGGATTTTGTCACCACCAGG + Intronic
1088203350 11:107363622-107363644 TGAGAGATTCTGTCACCACCAGG + Intronic
1088204313 11:107374570-107374592 TGAGAGATTCTGTCACCACCAGG + Intronic
1089708553 11:120298707-120298729 AGAATGTTTCTGTCCCCATTGGG + Intronic
1089882246 11:121786013-121786035 TGAGGGATTTTGTCACCACTAGG - Intergenic
1090195459 11:124812612-124812634 GTAGGCATTATGTCCCCACTGGG - Intergenic
1090321370 11:125846428-125846450 TGAGGGAATTTGTCACCACTAGG + Intergenic
1091213321 11:133883451-133883473 TGAGGGATTTTGTCACCACCAGG - Intergenic
1092194791 12:6542670-6542692 CCAGGGAAGCTGTCCCCACTAGG - Intronic
1092402511 12:8188739-8188761 AGATGGATTCTCACCCCTCTTGG - Intergenic
1092639103 12:10483626-10483648 TGAGAGATTTTGTCACCACTAGG + Intergenic
1092782898 12:12003771-12003793 AGATGGATGCTGTACCCAGTGGG - Intergenic
1093493759 12:19732876-19732898 TGAGAGATTTTGTCACCACTAGG - Intergenic
1093544843 12:20334796-20334818 TGAAGGATTTTGTCACCACTAGG - Intergenic
1093615072 12:21213256-21213278 TGAGAGATTCTGTCACCACCAGG - Intronic
1093712458 12:22342668-22342690 TGAGAGATTCTGTCACCACCAGG + Intronic
1094387608 12:29911836-29911858 TGAGAGATTCTGTCACCACCAGG + Intergenic
1095217562 12:39567817-39567839 TGAGAGATTTTGTCACCACTAGG - Intronic
1095320182 12:40817857-40817879 TGAGGGATTTTGTCACCACCAGG - Intronic
1095356591 12:41281822-41281844 TGAGGGATTTTGTCACCACCAGG + Intronic
1095387702 12:41670497-41670519 TGAGAGATTTTGTCACCACTAGG - Intergenic
1095406494 12:41872100-41872122 TGAGGGATTTTGTCACCACCAGG + Intergenic
1095931126 12:47626098-47626120 TGAGGGATTTTGTCACCACCGGG + Intergenic
1096292062 12:50351657-50351679 CGAAGGCTTCTCTCCCCACTGGG - Exonic
1096359829 12:50974439-50974461 TGAGAGATTCTGTCACCACCAGG + Intergenic
1096926658 12:55155637-55155659 AGAGAGATTTTGTCACCACCAGG - Intergenic
1097422049 12:59391950-59391972 TGAGGGATTTTGTCACCACCCGG + Intergenic
1097654202 12:62341570-62341592 AGAGGGATTTTGTCACCACCAGG - Intronic
1097763151 12:63492319-63492341 TGAGGGATTTTGTCACCACCAGG - Intergenic
1097837836 12:64291543-64291565 TGAGAGATTTTGTCACCACTAGG - Intronic
1098182981 12:67868054-67868076 TGAGAGATTATGTCACCACTAGG - Intergenic
1098615584 12:72518837-72518859 TGAGAGATTCTGTCACCACCAGG - Intronic
1099000897 12:77177582-77177604 TGAGAGATTTTGTCACCACTAGG - Intergenic
1099031039 12:77525703-77525725 TGAGGGATTTTGTCACCACCAGG + Intergenic
1099253524 12:80288089-80288111 TGAGGGATTTTGTCACCACCAGG - Intronic
1099523696 12:83694614-83694636 TGAGAGATTTTGTCACCACTAGG + Intergenic
1099912361 12:88848803-88848825 TGAGAGATTCTGTCACCACCAGG + Intergenic
1099965710 12:89442554-89442576 TGAGGGATTTTGTCACCACCAGG + Intronic
1100652190 12:96603148-96603170 TGAGAGATTCTGTCACCACCAGG - Intronic
1100740240 12:97583337-97583359 TGAGGGATTTTGTCACCACCAGG + Intergenic
1101219628 12:102624741-102624763 AGAGGAACTCTGTCCTCACATGG + Intergenic
1101768312 12:107724028-107724050 TGAGAGATTCTGTCACCACCAGG + Intergenic
1102372696 12:112395513-112395535 TGAAGGATTTTGTCCCCACCAGG + Intergenic
1105648592 13:22348009-22348031 TGAGAGATTCTGTCACCACCAGG + Intergenic
1106336360 13:28787076-28787098 AGAGAGATTTTGTCACCACCAGG - Intergenic
1106617430 13:31342371-31342393 TGAGGGATTTTGTCACCACCAGG + Intergenic
1106651103 13:31690607-31690629 TGAGAGATTTTGTCACCACTAGG + Intergenic
1106817060 13:33419906-33419928 TGAGAGATTTTGTCCCCACCAGG + Intergenic
1106874110 13:34053744-34053766 TGAGGGATTTTGTCACCACCAGG - Intergenic
1107243678 13:38266898-38266920 CGAGGGATTTTGTCACCACCAGG + Intergenic
1107980936 13:45733730-45733752 AGAGGGAAGCTGTGCCCATTAGG - Intergenic
1108029876 13:46218793-46218815 TGAGGGATTTTGTCACCACCAGG - Intronic
1108262587 13:48673813-48673835 TGAGGGATTTTGTCACCACCAGG - Intronic
1108308383 13:49161796-49161818 TGAGAGATTCTGTCACCACCAGG - Intronic
1108600065 13:51984866-51984888 TGAGAGATTTTGTCACCACTAGG + Intronic
1108998501 13:56765083-56765105 TGAGAGATTTTGTCACCACTGGG + Intergenic
1109188110 13:59293640-59293662 TGAGGGATTTTGTCACCACCAGG + Intergenic
1109640408 13:65184111-65184133 TGAGAGATTCTGTCACCACTTGG - Intergenic
1109884282 13:68523457-68523479 TGAGGGATTCTGTTACCACCAGG + Intergenic
1110343780 13:74422870-74422892 AGGGGAATTCTTTCCCCACCTGG - Intergenic
1110389919 13:74961417-74961439 TGAGGGATTTTGTCGCCACCAGG + Intergenic
1110445801 13:75578765-75578787 AGAGGGATTATTTGACCACTGGG + Intronic
1110878617 13:80542123-80542145 TGAGGGATTTTGTCACCACCCGG - Intergenic
1111374979 13:87366925-87366947 TGAGAGATTTTGTCACCACTGGG - Intergenic
1112060861 13:95739015-95739037 TGAGAGATTCTGTCACCACCAGG - Intronic
1112075651 13:95910041-95910063 TGAGAGATTCTGTCACCACGAGG + Intronic
1112231800 13:97595162-97595184 TGAGGGATTTTGTCACCACCAGG + Intergenic
1112482551 13:99790389-99790411 TGAGAGATTCTGTCACCACCAGG - Intronic
1114360728 14:21969248-21969270 TGAGGGATTTTGTCTCCACCAGG + Intergenic
1115035068 14:28847172-28847194 TGAGAGATTTTGTCACCACTAGG + Intergenic
1115122967 14:29959565-29959587 TGAGGGATTTTGTCACCACCAGG - Intronic
1115281311 14:31666743-31666765 TGAGGGATTCTGTCACCACCAGG - Intronic
1115357377 14:32462526-32462548 GGAGGGATTTTGTCACCACAAGG + Intronic
1115477254 14:33827418-33827440 TGAGAGATTCTGTCACCACCAGG + Intergenic
1115538258 14:34393464-34393486 TGAGAGATTTTGTCACCACTAGG + Intronic
1115690804 14:35842368-35842390 TGAGAGATTTTGTCACCACTAGG - Intronic
1115943757 14:38636760-38636782 TGAGAGATTCTGTCACCACCAGG + Intergenic
1115974202 14:38979378-38979400 TGATGGATTCTGTCACCACCAGG - Intergenic
1116482955 14:45413350-45413372 AGAGAGATTTTGTCACCACCAGG + Intergenic
1116727063 14:48574418-48574440 TGAGAGATTTTGTCACCACTGGG - Intergenic
1116795499 14:49385442-49385464 TGAGGGATTGTGTCACCACCAGG + Intergenic
1117299041 14:54406029-54406051 TGAGGGATTTTGTCCCCACCAGG - Intronic
1117465768 14:55992379-55992401 TGAGAGATTTTGTCACCACTAGG - Intergenic
1117624438 14:57620490-57620512 TGAGAGATTCTGTCACCACCAGG + Intronic
1117849867 14:59956820-59956842 TGAGGGATTTTGTCACCACCAGG - Intronic
1117852867 14:59993261-59993283 TGAGAGATTCTGTCACCACCAGG + Intronic
1117857323 14:60049446-60049468 AGAGGGAATTTGTCACCACCAGG - Intronic
1118415035 14:65526754-65526776 TGAGAGATTCTGTCACCACCAGG - Intronic
1119265111 14:73259748-73259770 TGGGGGTTTGTGTCCCCACTTGG - Intronic
1120113864 14:80590957-80590979 TGAGAGATTCTGTCACCACCGGG + Intronic
1121122624 14:91385506-91385528 TGAGGGTTTCCGTGCCCACTTGG + Intronic
1123790257 15:23712360-23712382 AGATGGGCTCTGTCCCCATTTGG + Intergenic
1124419391 15:29506707-29506729 TGAGGGATTTTGTCACCACCAGG + Intronic
1124474456 15:30020652-30020674 TGAGGGATTTTGTCACCACCAGG + Intergenic
1124894164 15:33760086-33760108 TGAGGGATTTTGTCACCACCAGG + Intronic
1125098632 15:35884018-35884040 AGTAGGATTCAGTTCCCACTGGG + Intergenic
1125331093 15:38582654-38582676 TGAGAGATTTTGTCACCACTAGG + Intergenic
1125386634 15:39143735-39143757 GGAGAGATTCTGTCCCCAGTAGG + Intergenic
1126185947 15:45830466-45830488 GAGGGGATTCTGTCCACACTGGG + Intergenic
1126211611 15:46106465-46106487 TGAGAGATTTTGTCCCCACCAGG + Intergenic
1126364759 15:47882850-47882872 AGAGTGATTCTATCTGCACTGGG - Intergenic
1127038446 15:54946012-54946034 TGAGAGATTCTGTCACCACCAGG + Intergenic
1127056488 15:55137153-55137175 TGAGGGATTTTGTCACCACCAGG + Intergenic
1127580226 15:60331713-60331735 TGAGAGATTTTGTCACCACTAGG + Intergenic
1128416592 15:67452416-67452438 TGAGAGATTCTGTCACCACCAGG - Intronic
1129652804 15:77503582-77503604 AGAGGCATTATATTCCCACTTGG + Intergenic
1129850388 15:78790510-78790532 GGCTGGATTCTGTCCGCACTTGG - Intronic
1130476018 15:84268292-84268314 TGAGAGATTCTGTCACCACCAGG - Intergenic
1130483439 15:84382346-84382368 TGAGAGATTCTGTCACCACCAGG - Intergenic
1131902923 15:97108351-97108373 TGAGGGATTTTGTCACCACCAGG + Intergenic
1131930415 15:97434641-97434663 TGAGAGATTCTGTCACCACCAGG + Intergenic
1131942557 15:97583638-97583660 TGAGGGATTTTGTCACCACTAGG - Intergenic
1132096625 15:98989931-98989953 TGAGAGATTCTGTCACCACCAGG + Intronic
1132746225 16:1437458-1437480 AGATGGATTCACTCCCCACACGG - Intronic
1133938769 16:10290901-10290923 TGAGAGATTTTGTCACCACTAGG - Intergenic
1135350218 16:21723042-21723064 AAAATGATTCTCTCCCCACTGGG + Intronic
1136519105 16:30785023-30785045 AGAGGGCCTCTGTCTCCTCTGGG - Intronic
1136643315 16:31587236-31587258 TGAGGGAATTTGTCACCACTAGG - Intergenic
1136662297 16:31773560-31773582 TGAGGGAATTTGTCACCACTAGG + Intronic
1137503598 16:49030634-49030656 TGAGAGATTTTGTCACCACTAGG + Intergenic
1137525290 16:49230021-49230043 TGAGAGATTTTGTCGCCACTAGG + Intergenic
1137799853 16:51253095-51253117 TGAGAGATTTTGTCACCACTAGG - Intergenic
1137969792 16:52973770-52973792 TGAGGGATTTTGTCACCACCAGG - Intergenic
1138151743 16:54663610-54663632 TAAGGGATTTTGTCACCACTAGG + Intergenic
1138796775 16:59978406-59978428 TGAGAGATTCTGTCACCACCAGG + Intergenic
1138843445 16:60537461-60537483 TGAGGGATTTTGTCACCACCAGG - Intergenic
1140569881 16:76090920-76090942 TGAGAGATTCTGTCACCACCAGG - Intergenic
1142184043 16:88686094-88686116 GGCGGGATTCTCTCCCAACTTGG - Intronic
1144371971 17:14599716-14599738 TGAGGGATTTTGTCACCACCAGG + Intergenic
1144854864 17:18262105-18262127 AGAGGGCTGCTGTGCCCTCTGGG + Intronic
1145735819 17:27231064-27231086 AGAGGAACTCTGTTCCCTCTTGG - Intergenic
1148203472 17:45765335-45765357 TGAGGGCTACTGTCCTCACTAGG - Intergenic
1148203484 17:45765429-45765451 TGAGGGCTACTGTCCTCACTAGG - Intergenic
1150026029 17:61674981-61675003 TGAGAGATTCTGTCACCACCAGG + Intergenic
1150196298 17:63303291-63303313 TGAGGGATTTTGTCACCACCAGG - Intronic
1150881684 17:69036480-69036502 TGAGGGATTTTGTCACCACCAGG + Intronic
1150884815 17:69072546-69072568 TGAGGGATTTTGTCACCACCAGG + Intergenic
1153827375 18:8888261-8888283 TGAGAGATTTTGTCACCACTAGG - Intergenic
1155395443 18:25381402-25381424 TGAGGGATTTTGTCACCACTAGG + Intergenic
1156242412 18:35267098-35267120 AGTGAGATCCTGTCCCCTCTTGG + Intronic
1156725120 18:40118252-40118274 TGAGAGATTTTGTCACCACTAGG - Intergenic
1158398835 18:57102645-57102667 TGAGGGATTTTGTCACCACCAGG - Intergenic
1158890101 18:61864577-61864599 AGAGGGAGTTAGTCCCCAGTGGG - Intronic
1159076860 18:63690017-63690039 TGAGGGATTTTGTCACCACCAGG + Intronic
1159581539 18:70238668-70238690 TGAGGGATTTTGTCACCACCAGG + Intergenic
1161606995 19:5220667-5220689 AGAGTGCTCCTCTCCCCACTGGG + Intronic
1164047232 19:21553100-21553122 TGAGGGATTTTGTCACCACCAGG - Intronic
1164163668 19:22649119-22649141 TGAGGGATTTTGTCTCCACCAGG - Intronic
1164350046 19:27325871-27325893 AGAGAGATTTTGTCACCACCAGG + Intergenic
1164420722 19:28089582-28089604 AGAGAGATTTTGTCACCACCAGG + Intergenic
1165459772 19:35937424-35937446 AGAGGGACTGTGTCCTGACTCGG - Exonic
1166022184 19:40042098-40042120 TGAGGGATTTTGTCACCACCAGG - Intronic
1166260474 19:41636882-41636904 TGAGGGATTTTGTCACCACCAGG - Intronic
1166263383 19:41658983-41659005 TGAGGGATTTTGTCACCACCAGG + Intronic
1168530643 19:57125954-57125976 TGAGGGATTTTGTCACCACCAGG - Intronic
925247338 2:2395704-2395726 TGAGGGAGTCTCTCCCCAGTTGG - Intergenic
925467361 2:4119211-4119233 TGAGGGATTTTGTCACCACCAGG - Intergenic
925728909 2:6903013-6903035 TGAGGGATTCTGTCACTACCAGG - Intergenic
926074562 2:9931359-9931381 TGAGAGATTCTGTCACCACCAGG - Intronic
927360017 2:22222241-22222263 AGAGGGATTTTGTCCCAAGATGG + Intergenic
927610589 2:24535641-24535663 TGAGAGATTCTGTCACCACCAGG - Intronic
928480849 2:31682216-31682238 TGAGAGATTCTGTCACCACCAGG - Intergenic
928488485 2:31756306-31756328 TGAGGGATTTTGTCACCACTAGG + Intergenic
929062708 2:37940073-37940095 TGAGGGATTTTGTCACCACCAGG - Intronic
929272370 2:39986477-39986499 TGAGAGATTCTGTCACCACCAGG + Intergenic
929274667 2:40012782-40012804 TGAGAGATTCTGTCACCACCAGG - Intergenic
930027825 2:47040167-47040189 AGGGGGCTTCTGTCTGCACTGGG + Intronic
930359531 2:50360057-50360079 TGAGGGATTTTGTCACCACCAGG + Intronic
930440093 2:51393441-51393463 TGAGGGATTTTGTCACCACCAGG + Intergenic
930860145 2:56063740-56063762 TGAGGGATTTTGTCACCACCAGG - Intergenic
931211890 2:60205515-60205537 TGAGGGATTTTGTCACCACCAGG - Intergenic
931556187 2:63508385-63508407 TGAGGGATTGTGTCACCACCAGG + Intronic
931574557 2:63706487-63706509 TGAGAGATTCTGTCACCACCAGG - Intronic
932644130 2:73484265-73484287 TGAGAGATTTTGTCACCACTAGG - Intronic
932646578 2:73509450-73509472 TGAGGGATTTTGTCACCACCAGG - Intronic
932649560 2:73540319-73540341 TGAGAGATTTTGTCACCACTAGG + Intronic
932818215 2:74878561-74878583 AGAGGGATTCTGTCCCCACTGGG + Intronic
933166438 2:79081944-79081966 TGAGGGATTTTGTCACCACCAGG - Intergenic
933607460 2:84398524-84398546 TGAGAGATTTTGTCACCACTAGG + Intergenic
934702928 2:96456657-96456679 TGAGGGATTTTGTCACCACCAGG + Intergenic
934877451 2:97937977-97937999 TGAGAGATTCTGTCACCACCAGG + Intronic
934978424 2:98822228-98822250 AAGGGGTTTCTGTCCTCACTCGG + Exonic
935489235 2:103696773-103696795 TGAGGGATTTTGTCACCACCAGG - Intergenic
935837803 2:107074420-107074442 AGAGGCATTCTTTTCTCACTAGG - Intergenic
935858152 2:107298014-107298036 TGAGAGATTTTGTCACCACTAGG - Intergenic
936992428 2:118380359-118380381 AGAGAGATGCAGACCCCACTGGG + Intergenic
937063877 2:119002525-119002547 TGAGAGATTTTGTCACCACTAGG - Intergenic
937762575 2:125623373-125623395 TGAGGGATTTTGTCACCACTAGG + Intergenic
937931708 2:127210311-127210333 TGAGGGATTTTGTTACCACTGGG + Intronic
938667018 2:133548678-133548700 TGAGAGATTTTGTCACCACTAGG + Intronic
938788366 2:134654739-134654761 TGAGAGATTTTGTCACCACTAGG - Intronic
938952108 2:136264943-136264965 TGAGGGATTTTGTCACCACCAGG - Intergenic
938952628 2:136269422-136269444 TGAGGGATTTTGTCACCACCAGG - Intergenic
938975246 2:136470647-136470669 TGAGGGATTTTGTCACCACGAGG + Intergenic
939116702 2:138069527-138069549 TGAGGGATTTTGTCACCACCAGG - Intergenic
939157490 2:138542927-138542949 TGAGAGATTCTGTCACCACCAGG - Intronic
939346239 2:140969716-140969738 TGAGAGATTTTGTCACCACTAGG - Intronic
939860441 2:147414113-147414135 TGAGGGATTTTGTCACCACCAGG - Intergenic
940602799 2:155882157-155882179 TGAGGGATTGTGTCACCACCAGG + Intergenic
940808033 2:158209763-158209785 TGAGAGATTCTGTCACCACCAGG + Intronic
941895640 2:170626739-170626761 TGAGAGATTCTGTCACCACCAGG - Intronic
942200110 2:173561867-173561889 TGAGAGATTCTGTCACCACCAGG + Intergenic
942576787 2:177372392-177372414 TGAGGGATTTTGTCACCACCAGG - Intronic
942780094 2:179631470-179631492 TGAGAGATTCTGTCACCACCAGG + Intronic
943031283 2:182688478-182688500 CGAGAGATTTTGTCACCACTAGG + Intergenic
943095087 2:183418569-183418591 TGAGGGATTTTGTCACCACCAGG + Intergenic
943097907 2:183452500-183452522 TGAGGGATTTTGTCACCACCAGG - Intergenic
943109550 2:183588129-183588151 TGAGAGATTTTGTCACCACTAGG + Intergenic
943112140 2:183620142-183620164 TGAGAGATTCTGTCACCACCAGG - Intergenic
943140659 2:183977371-183977393 TGAGAGATTCTGTCACCACCAGG + Intergenic
943541330 2:189218388-189218410 AGAGGGATTGTGTACAAACTGGG + Intergenic
943558382 2:189432147-189432169 TGAGAGATTCTGTCACCACCAGG + Intergenic
943891797 2:193296759-193296781 AGAGGGATTTTATCACCACCAGG + Intergenic
944292243 2:198020188-198020210 TGAGGGATTTTGTCACCACCAGG + Intronic
944374943 2:199030400-199030422 TGAGAGATTTTGTCACCACTAGG + Intergenic
944378175 2:199073504-199073526 TGAGGGATTTTGTCACCACCAGG + Intergenic
944764867 2:202853842-202853864 TGAGGGATTTTGTCACCACCAGG + Intronic
944950355 2:204741757-204741779 AGATGGCTTGTGTCCCCACTGGG - Intronic
945164520 2:206928343-206928365 TGAGGGATTTTGTCACCACCAGG + Intergenic
945207435 2:207346392-207346414 TGAGGGATTTTGTCACCACCAGG + Intergenic
945210678 2:207379386-207379408 TGAGGGATTTTGTCACCACCAGG - Intergenic
945432840 2:209784908-209784930 ACTGGGATTCTGACACCACTTGG - Intronic
945602933 2:211890355-211890377 TGAGAGATTTTGTCACCACTAGG + Intronic
945615130 2:212056728-212056750 TGAGAGATTTTGTCACCACTAGG + Intronic
946065112 2:216980901-216980923 TGAGGGATTTTGTCACCACCAGG - Intergenic
946208474 2:218128376-218128398 ACAGGGATTGAGTCCCCTCTGGG + Intronic
946913212 2:224487067-224487089 TGAGGGATTCTGTCACCACCAGG + Intronic
947086243 2:226455878-226455900 TGAGGGATTTTGTCACCACCAGG + Intergenic
947194182 2:227544649-227544671 TGAGAGATTCTGTCACCACCAGG - Intronic
947681209 2:232035692-232035714 TGAGGGATTCTGTCAGCACCAGG - Intronic
948419492 2:237847649-237847671 TGAGAGATTCTGTCGCCACCAGG - Intergenic
1169174409 20:3497353-3497375 TGAGAGATTCTGTCACCACCAGG - Intronic
1169421129 20:5461594-5461616 TGAGGGATTTTGTCACCACCAGG - Intergenic
1169791460 20:9414520-9414542 AGAGGCATTCTGTGCCCTTTAGG + Intronic
1170039374 20:12023954-12023976 AGATGGATTCGGTCTCCTCTGGG + Intergenic
1170265787 20:14465725-14465747 TGAGAGATTTTGTCACCACTAGG - Intronic
1170727127 20:18940042-18940064 TGAGGGATTTTGTCACCACCAGG - Intergenic
1174968319 20:55244913-55244935 TGAGGGATTTTGTCACCACCAGG + Intergenic
1175494150 20:59402413-59402435 AGAAGAATTTTGTTCCCACTTGG - Intergenic
1176344248 21:5727249-5727271 TGAGGGATTATGTCACCACCAGG - Intergenic
1176351062 21:5847833-5847855 TGAGGGATTATGTCACCACCAGG - Intergenic
1176500579 21:7597207-7597229 TGAGGGATTATGTCACCACCAGG + Intergenic
1176538569 21:8125318-8125340 TGAGGGATTATGTCACCACCAGG - Intergenic
1177463686 21:21446023-21446045 TGAGGGATTTTGTCACCACCAGG - Intronic
1178393768 21:32221430-32221452 TGAGGGATTTTGTCACCACCAGG + Intergenic
1179025698 21:37676688-37676710 ACATGGCTGCTGTCCCCACTTGG - Intronic
1180599076 22:17002392-17002414 TAAGGGATTCTGTCACCACCAGG + Intronic
1181998935 22:26904288-26904310 GGAGGGTCTCTTTCCCCACTGGG + Intergenic
1182870508 22:33642335-33642357 TGAAGGATTTTGTCACCACTAGG + Intronic
1182993460 22:34790635-34790657 TGAGAGATTCTGTCACCACCAGG + Intergenic
1183182516 22:36270116-36270138 TGAGGGATTTTGTCACCACCAGG - Intergenic
1183278885 22:36921859-36921881 TGAGGGACTGGGTCCCCACTTGG - Intronic
1184886579 22:47349742-47349764 TGAGAGATTCTGTCACCACCAGG - Intergenic
1185101230 22:48841936-48841958 AGAGGGATTCAGTCCCAGGTGGG + Intronic
1203243515 22_KI270733v1_random:41673-41695 TGAGGGATTATGTCACCACCAGG - Intergenic
949406666 3:3721191-3721213 AGAGAGATTTTGTCACCACCAGG + Intronic
949583601 3:5414764-5414786 TGAGAGATTTTGTCACCACTGGG + Intergenic
950189369 3:10966112-10966134 ACTTGGTTTCTGTCCCCACTTGG + Intergenic
950619499 3:14192968-14192990 TGAGGGATTTTGTCACCACCAGG - Intronic
951012340 3:17695046-17695068 TGAGAGATTCTGTCACCACCAGG + Intronic
951414929 3:22412753-22412775 TGAGGGATTTTGTCACCACCAGG - Intergenic
951687397 3:25360667-25360689 TGAGGGATTTTGTCACCACCAGG - Intronic
951741890 3:25933440-25933462 CGAGGGATTTTGTCACCACCAGG + Intergenic
951791781 3:26493866-26493888 TGAGAGATTTTGTCACCACTAGG - Intergenic
951826864 3:26877799-26877821 TGAGGGATTTTGTCACCACCAGG + Intergenic
951832399 3:26944802-26944824 TGAGGGATTCTGTCACCACCAGG + Intergenic
952154634 3:30629389-30629411 AGAGTTCTTCTTTCCCCACTGGG - Intronic
952319668 3:32264403-32264425 TGAGCGATTTTGTCACCACTAGG + Intronic
952515126 3:34096010-34096032 TGAGAGATTTTGTCACCACTAGG + Intergenic
952612500 3:35227747-35227769 TGAGAGATTCTGTCACCACCAGG + Intergenic
953102137 3:39840653-39840675 TGAGGGATTCTGTCACCATCAGG - Intronic
953112416 3:39955477-39955499 TGAGAGATTCTGTCACCACCAGG + Intronic
953116359 3:39995982-39996004 TGAGAGATTCTGTCACCACCAGG + Intronic
953264477 3:41372590-41372612 TGAGGGATTTTGTCACCACCAGG + Intronic
953354168 3:42240434-42240456 TGAGAGATTCTGTCACCACCAGG + Intergenic
953895115 3:46791897-46791919 TGAGGGATTTTGTCACCACCAGG + Intronic
954931552 3:54286877-54286899 TGAGAGATTCTGTCACCACCAGG + Intronic
955013969 3:55050295-55050317 TGAGAGATTCTGTCACCACCAGG - Intronic
955361478 3:58279781-58279803 TGAGAGATTCTGTCACCACCAGG - Intronic
955944794 3:64182553-64182575 AGAGGGAATGTGTCCCCACATGG - Intronic
956355920 3:68391810-68391832 TGAGGGATTTTGTCACCACCAGG + Intronic
956382854 3:68684619-68684641 TGAGGGATTTTGTCACCACTAGG - Intergenic
956394648 3:68812124-68812146 TGAGAGATTCTGTCACCACCAGG + Intronic
957011068 3:75007072-75007094 TGAGGGATTTTGTCACCACCAGG - Intergenic
957786298 3:84886934-84886956 TGAGAGATTCTGTCACCACCAGG + Intergenic
957908007 3:86582609-86582631 AGAGAGATTTTGTCACCACCAGG + Intergenic
958014598 3:87924559-87924581 ACAGGGAATTTGTCACCACTAGG - Intergenic
958253119 3:91293069-91293091 TGAGGGATTTTGTCACCACCAGG + Intergenic
958261057 3:91381944-91381966 TGAGAGATTTTGTCACCACTAGG - Intergenic
958553725 3:95646996-95647018 TGAGGGATTTTGTCACTACTAGG + Intergenic
958817391 3:98930610-98930632 TGAGGGAATTTGTCACCACTGGG + Intergenic
959453964 3:106535992-106536014 TGAGGGATTTTGTCACCACCAGG + Intergenic
959534805 3:107472312-107472334 TGAGAGATTTTGTCACCACTAGG + Intergenic
959617838 3:108368158-108368180 TGAGGGATTCTGTCACCACTAGG + Intronic
959801200 3:110496976-110496998 TGAGGGATTTTGTGACCACTAGG + Intergenic
959939972 3:112071137-112071159 TGAGAGATTTTGTCACCACTAGG - Intronic
960177493 3:114533938-114533960 TGAGAGATTTTGTCACCACTAGG + Intronic
960429974 3:117557345-117557367 GGAGGGACTATCTCCCCACTAGG + Intergenic
960580035 3:119269134-119269156 TGAGGGATTTTGTCACCACCAGG + Intergenic
960730466 3:120721135-120721157 TGAGAGATTCTGTCACCACCAGG + Intronic
960776708 3:121264261-121264283 TGAGAGATTTTGTCCCCACCAGG + Intronic
960850252 3:122046110-122046132 TGAGAGATTTTGTCACCACTAGG - Intergenic
961355154 3:126333371-126333393 TGAGAGATTTTGTCACCACTAGG + Intergenic
962291632 3:134141816-134141838 TGAGAGATTTTGTCACCACTAGG + Intronic
962995528 3:140624084-140624106 TGAGAGATTCTGTCACCACCAGG + Intergenic
963401543 3:144805181-144805203 TGAGGGATTTTGTCACCACCAGG - Intergenic
963551314 3:146727426-146727448 AGAGAGATTTTGTCACCACCAGG + Intergenic
963980450 3:151530664-151530686 TGAGAGATTTTGTCCCCACCAGG + Intergenic
963998363 3:151738186-151738208 TGAGGGATTTTGTCACCACCAGG - Intronic
964010580 3:151887095-151887117 TGAGGGATTTTGTCACCACAAGG + Intergenic
964053345 3:152421879-152421901 TGAGGGATTTTGTCACCACCAGG + Intronic
964371166 3:156002272-156002294 TGAGGGATTTTGTCACCACCAGG - Intergenic
964713004 3:159691791-159691813 TGAGGGATTTTGTCACCACCAGG - Intronic
964905036 3:161709008-161709030 TGAGGGATTTTGTCACCACCAGG + Intergenic
965350239 3:167602570-167602592 AGAAGGATTCTGTCCCCTCCTGG - Intronic
965497462 3:169415333-169415355 TGAGGGATTTTGTCACCACCAGG + Intronic
965621743 3:170649333-170649355 TGAGGGATTTTGTCACCACCAGG - Intronic
966662318 3:182427904-182427926 TGAGAGATTTTGTCACCACTAGG + Intergenic
969164618 4:5296969-5296991 TGAGGGATTTTGTCACCACCAGG - Intronic
969778126 4:9374861-9374883 AGATGGATTCTCACCCCTCTTGG + Intergenic
970055141 4:11963563-11963585 TGAGGGATTCTGTCACCACCAGG - Intergenic
970714528 4:18906120-18906142 TGAGGGATTTTGTCACCACAAGG + Intergenic
970727369 4:19062101-19062123 TGAGGGATTTTGTCACCACCAGG + Intergenic
971429854 4:26554700-26554722 TGAGGGATTTTGTCACCACCAGG - Intergenic
971466978 4:26974429-26974451 TGAGAGATTCTGTCACCACCAGG - Intronic
971698076 4:29931780-29931802 TGAGAGATTTTGTCACCACTAGG + Intergenic
971943017 4:33239823-33239845 TGAGGGATTTTGTCACCACCAGG - Intergenic
973311374 4:48713029-48713051 TGAGAGATTCTGTCACCACCAGG + Intronic
973562852 4:52153406-52153428 TGAGGGATTTTGTCACCACCAGG + Intergenic
973591415 4:52446155-52446177 TGAGAGATTTTGTCACCACTAGG - Intergenic
973629310 4:52803936-52803958 TGAGGGATTTTGTCACCACCAGG + Intergenic
973776373 4:54245513-54245535 TGAGAGATTCTGTCACCACCAGG + Intronic
974298210 4:60032690-60032712 TGAGGGATTTTGTCACCACCAGG - Intergenic
974302267 4:60083238-60083260 TGAGGGATTTTGTCACCACCAGG + Intergenic
974326118 4:60417562-60417584 TGAGGGATTTTGTCACCACCAGG - Intergenic
974427396 4:61758871-61758893 TGAGAGATTCTGTCACCACCAGG - Intronic
975149205 4:71003148-71003170 AGAGGGATTTTATCACCACAAGG - Intronic
975178111 4:71310632-71310654 TGAGGGATTTTGTCACCACCAGG + Intronic
975479532 4:74861767-74861789 TGAGGGATTTTGTCACCACCAGG + Intergenic
975513897 4:75223278-75223300 TGAGGGATTTTGTCACCACCAGG + Intergenic
975518260 4:75270551-75270573 TGAGGGATTTTGTCACCACCAGG + Intergenic
975524437 4:75333160-75333182 TGAGGGATTTTGTCACCACCAGG + Intergenic
975532848 4:75419114-75419136 TGAGGGATTTTGTCTCCACCAGG - Intergenic
975620128 4:76288819-76288841 TGAGGGATTTTGTCACCACCAGG - Intronic
975887232 4:78980636-78980658 AGAGAGATTTTGTCACCACCAGG - Intergenic
976476634 4:85491603-85491625 AGAGGGGTTCTGTGTGCACTAGG + Intronic
976534134 4:86191962-86191984 TGAGAGATTCTGTCACCACCAGG - Intronic
976716137 4:88124113-88124135 TGAGGGATTTTGTCACCACCAGG + Intronic
976760245 4:88540892-88540914 TGAGAGATTTTGTCCCCACCAGG + Intronic
976924777 4:90483564-90483586 TGAGAGATTCTGTCACCACCAGG - Intronic
976992158 4:91380938-91380960 TGAGAGATTTTGTCACCACTAGG - Intronic
977415660 4:96729790-96729812 AGAGGCTTTATTTCCCCACTTGG + Intergenic
977456916 4:97273103-97273125 TGAGAGATTCTGTCACCACCAGG + Intronic
977485199 4:97635290-97635312 TGAGAGATTTTGTCACCACTAGG + Intronic
977496364 4:97779881-97779903 TGAGAGATTCTGTCACCACCAGG + Intronic
977624431 4:99174914-99174936 TGAGAGATTCTGTCACCACCAGG - Intergenic
977678047 4:99769633-99769655 TGAGAGATTCTGTCACCACCAGG - Intergenic
977888078 4:102274902-102274924 TGAGGGATTTTGTCACCACCAGG + Intronic
978012934 4:103709456-103709478 TGAGAGATTTTGTCACCACTAGG + Intronic
978179332 4:105774542-105774564 TGAGGGATTTTGTCACCACCAGG - Intronic
978307866 4:107351854-107351876 AGAAGGATTTTTTCCCCCCTTGG - Intergenic
978487765 4:109275589-109275611 TGAGGGCTTCTGTCTTCACTTGG + Intronic
978658794 4:111098831-111098853 AGAGAGATTTTGTCACCACCAGG - Intergenic
978677690 4:111338751-111338773 TGAGAGATTCTGTCACCACCAGG + Intergenic
978973230 4:114836303-114836325 TGAGGGATTTTGTCACCACCAGG - Intronic
979043882 4:115836190-115836212 TAAGGGATTTTGTCACCACTAGG + Intergenic
979282117 4:118879964-118879986 GGAGGGATTCTGTCCTGACAGGG - Intronic
979440346 4:120743229-120743251 TGAGAGATTTTGTCACCACTAGG + Intronic
979628437 4:122872825-122872847 TGAGGGATTTTGTCACCACCAGG + Intronic
979705481 4:123714989-123715011 TGAGAGATTCTGTCACCACCAGG + Intergenic
979726928 4:123973516-123973538 AGAGGCAGTCTTTCCACACTTGG + Intergenic
979757791 4:124363176-124363198 TGAGAGATTTTGTCACCACTAGG + Intergenic
979921288 4:126499699-126499721 TGAGAGATTCTGTCACCACCAGG + Intergenic
980037628 4:127903676-127903698 TGAGGGATTTTGTCACCACCAGG - Intergenic
980151462 4:129053945-129053967 TGAGGGATTTTGTCACCACCAGG - Intronic
980216229 4:129855717-129855739 TGAGAGATTCTGTCACCACCAGG + Intergenic
980541631 4:134202850-134202872 AAAGGGCATCTCTCCCCACTGGG - Intergenic
980584231 4:134791201-134791223 TGAGGGATTTTGTCACCACCAGG + Intergenic
980733011 4:136847086-136847108 TGAGGGATTTTGTCACCACCTGG - Intergenic
981126445 4:141112417-141112439 TGAGAGATTTTGTCACCACTAGG - Intronic
981133781 4:141188038-141188060 TGAGGGATTTTGTCACCACCAGG - Intronic
981254960 4:142650166-142650188 TGAGAGATTCTGTCACCACCAGG + Intronic
981264638 4:142767764-142767786 AGAGGCATTCTGTACACTCTTGG - Intronic
981315571 4:143336864-143336886 AGCGGGACTCTGCCCCGACTCGG - Exonic
981353030 4:143753989-143754011 TGAGGGATTGTGTCACCACCAGG + Intergenic
981395894 4:144248675-144248697 TGAGGGATTTTGTCACCACCAGG - Intergenic
982195864 4:152913211-152913233 AGATGGATTTTTTCCCCAATGGG - Intronic
982725372 4:158901024-158901046 TGAGAGATTCTGTCACCACCAGG - Intronic
982733617 4:158981656-158981678 TGAGGGATTTTGTCACCACCAGG + Intronic
982815206 4:159876082-159876104 TGAGGGATTTTGTCACCACCAGG - Intergenic
983101769 4:163634046-163634068 TGAGAGATTCTGTCACCACCAGG + Intronic
983140516 4:164143622-164143644 TGAGAGATTCTGTCACCACCAGG + Intronic
983173061 4:164557688-164557710 TGAGAGATTTTGTCACCACTAGG - Intergenic
983750413 4:171261415-171261437 TGAGGGATTTTGTCCCCACCAGG + Intergenic
983754265 4:171314343-171314365 TGAGAGATTTTGTCACCACTAGG - Intergenic
983755491 4:171329407-171329429 AGAAGGAGTCTCTCCTCACTGGG - Intergenic
984224602 4:177019162-177019184 TGAGAGATTCTGTCACCACCAGG + Intergenic
984354390 4:178638935-178638957 TGAGGGATTTTGTCACCACCAGG + Intergenic
984618853 4:181928979-181929001 TGAGAGATTTTGTCACCACTAGG + Intergenic
985755442 5:1711627-1711649 TGAGAGATTCTGTCACCACCAGG + Intergenic
986005803 5:3668124-3668146 TGAGAGATTTTGTCACCACTAGG - Intergenic
986090533 5:4500538-4500560 TGAGAGATTTTGTCACCACTAGG - Intergenic
986358734 5:6954064-6954086 TGAGGGATTTTGTCACCACCAGG + Intergenic
986378634 5:7161017-7161039 TGAGGGATTTTGTCACCACCAGG - Intergenic
986484540 5:8221972-8221994 TGAGGGATTTTGTCACCACCAGG + Intergenic
987634988 5:20527710-20527732 TGAGGGATTTTGTCACCACCAGG + Intronic
987678797 5:21109225-21109247 TGAGAGATTTTGTCACCACTAGG + Intergenic
987923878 5:24316158-24316180 TGAGGGATTTTGTCACCACTAGG - Intergenic
988251095 5:28759004-28759026 TGAGAGATTCTGTCACCACCAGG - Intergenic
988254150 5:28800600-28800622 TGAGAGATTCTGTCACCACCAGG + Intergenic
988381115 5:30498019-30498041 AGAGAGATTTTGTCACCACCAGG - Intergenic
988668071 5:33352351-33352373 AGAGAGATTTTGTCACCACCAGG - Intergenic
989320511 5:40129266-40129288 TGAGGGATTTTGTCACCACCAGG - Intergenic
989355923 5:40543119-40543141 TGAGAGATTTTGTCACCACTAGG + Intergenic
989725395 5:44580738-44580760 TGAGAGATTTTGTCACCACTAGG + Intergenic
989825519 5:45849719-45849741 TGAGAGATTCTGTCACCACTAGG + Intergenic
989968806 5:50496532-50496554 TGAGAGATTTTGTCACCACTAGG + Intergenic
990231561 5:53717917-53717939 TGAGGGATTCTGTCACCATCAGG + Intergenic
990800545 5:59597821-59597843 AGAGGGCATCTGTCCACAATGGG - Intronic
990803706 5:59633688-59633710 TGAGGGATTTCGTCCCCACCAGG + Intronic
991270837 5:64778804-64778826 AGAGGGAATTTGTCTGCACTAGG + Intronic
991365139 5:65860247-65860269 AGAGGGGTTCTGTCAACACCTGG - Intronic
991591815 5:68259549-68259571 AGAGGGGTTCTGTTCTCATTTGG + Intronic
991643471 5:68777167-68777189 AGAGGGATACTGTCCCCTGGAGG - Intergenic
991652280 5:68867218-68867240 TGAGGGATTTTGTCACCACCAGG + Intergenic
991916230 5:71608760-71608782 TGAGAGATTCTGTCACCACCAGG - Intronic
991950835 5:71945651-71945673 AGAGGGATTCTCTCACCAGAAGG + Intergenic
991977354 5:72196321-72196343 AGAGGGAGTCTGTGGCCAGTGGG + Exonic
992030656 5:72718209-72718231 AGAGAGATTATGTCCCCAGATGG + Intergenic
992254669 5:74909968-74909990 TGAGGGATTTTGTCACCACCAGG - Intergenic
992316773 5:75564581-75564603 TGAGGAATTCTGTCACCACCAGG - Intronic
992514430 5:77476623-77476645 TGAGAGATTCTGTCACCACCAGG + Intronic
992756658 5:79912921-79912943 TGAGAGATTTTGTCACCACTGGG + Intergenic
992815137 5:80429400-80429422 TGAGAGATTTTGTCACCACTAGG + Intronic
993261348 5:85661788-85661810 TGAGAGATTCTGTCACCACCAGG - Intergenic
993513220 5:88797836-88797858 TGAGAGATTTTGTCACCACTAGG - Intronic
993960727 5:94294320-94294342 TGAGGGATTTTGTCACCACCAGG - Intronic
994004961 5:94827160-94827182 TGAGGGATTTTGTCACCACCAGG - Intronic
994036784 5:95210866-95210888 TGAGAGATTTTGTCACCACTAGG - Intronic
994991111 5:106998442-106998464 TGAGGGATTTTGTCACCACCAGG - Intergenic
995080930 5:108049537-108049559 TGAGGGATTTTGTCACCACCAGG + Intronic
995204104 5:109459190-109459212 TGAGAGATTTTGTCGCCACTAGG + Intergenic
995309479 5:110694254-110694276 TGAGAGATTCTGTCACCACCAGG + Intronic
996122562 5:119688982-119689004 TGAGAGATTTTGTCACCACTAGG - Intergenic
996130791 5:119778956-119778978 TGAGAGATTTTGTCACCACTAGG - Intergenic
996162239 5:120180226-120180248 TGAGAGATTCTGTCACCACCAGG - Intergenic
996275573 5:121661853-121661875 TGAGGGATTTTGTCACCACCAGG + Intergenic
996426415 5:123318468-123318490 TGAGGGATTTTGTCACCACCAGG - Intergenic
996589349 5:125128567-125128589 GGATGGTTTCTGTCCCCTCTTGG - Intergenic
996621533 5:125510197-125510219 AGAGAGACCCTGTCCCCACAGGG + Intergenic
996639277 5:125732244-125732266 TGAGGGACTTTGTCACCACTAGG + Intergenic
997706559 5:135959492-135959514 AGAGTGAGTCTGTCCCTAATTGG - Intergenic
997920109 5:137970410-137970432 TGAGAGATTCTGTCACCACCAGG + Intronic
998229394 5:140350417-140350439 AGAGGGAAGCTGTGCCCCCTGGG + Intergenic
999026005 5:148232418-148232440 TGAGGGATTTTGTCACCACCAGG + Intergenic
999351047 5:150872285-150872307 GGAGGGATGTTGCCCCCACTGGG - Intronic
999502172 5:152158473-152158495 TGAGGGATTTTGTCACCACCAGG - Intergenic
999556999 5:152753907-152753929 TGAGGGATTTTGTCACCACCAGG + Intergenic
999602779 5:153284864-153284886 TGAGGGATTTTGTCACCACCAGG + Intergenic
999688517 5:154124112-154124134 TGAGGGATTTTGTCACCACCAGG + Intronic
999814407 5:155161789-155161811 TGAGAGATTCTGTCACCACCAGG - Intergenic
999963682 5:156784753-156784775 TGAGAGATTTTGTCACCACTAGG + Intergenic
1000069155 5:157722894-157722916 TGAGAGATTTTGTCACCACTAGG + Intergenic
1000181812 5:158818965-158818987 AGTGGGATTAAGTCCCCAGTAGG - Intronic
1000534221 5:162459983-162460005 AGAGAGAATTTGTCACCACTAGG + Intergenic
1001355701 5:171020964-171020986 TGAGGGATTTTGTCACCACCAGG - Intronic
1001358984 5:171062351-171062373 TGAGAGATTTTGTCACCACTAGG - Intronic
1001362467 5:171101785-171101807 TGAGGGATTCTGTCACCACTAGG - Intronic
1001372422 5:171219082-171219104 TGAGGGATTTTGTCACCACCAGG - Intronic
1001454541 5:171850673-171850695 AGAGGGATTTTGTCCCCTAGAGG + Intergenic
1001465970 5:171966577-171966599 TGGGGGATTCTGTTCCCCCTTGG - Intronic
1002058780 5:176613849-176613871 AGATGGATTCTCTCCACACGGGG - Intergenic
1002759692 6:191943-191965 AGAGGGGTGCTGGCCTCACTTGG + Intergenic
1004164037 6:13240001-13240023 AGATCGATTGTGTTCCCACTGGG - Intronic
1004593417 6:17075388-17075410 TGAGGGATTTTGTCACCACCAGG + Intergenic
1004713162 6:18191638-18191660 GGGGTGATTCTGTCCCCATTTGG - Intronic
1005041202 6:21602080-21602102 GCTGGGGTTCTGTCCCCACTGGG + Intergenic
1005795956 6:29361733-29361755 TGAGGGATTATGTCACCACCAGG + Intronic
1006200206 6:32281477-32281499 TGAGGGATTTTGTCACCACCAGG + Intergenic
1007873163 6:45064259-45064281 TGAGAGATTTTGTCACCACTAGG + Intronic
1008136816 6:47786511-47786533 GTAGGGATTCTGTCCACATTTGG + Exonic
1008798936 6:55342474-55342496 TGAGAGATTTTGTCACCACTAGG + Intronic
1008994105 6:57638200-57638222 TGAGAGATTTTGTCACCACTAGG + Intronic
1009322943 6:62313984-62314006 TGAGAGATTCTGTCACCACCAGG + Intergenic
1009458964 6:63889571-63889593 TGAAGGATTTTGTCACCACTAGG + Intronic
1009740039 6:67732748-67732770 TGAGGGATTTTGTCACCACCAGG - Intergenic
1010483023 6:76377659-76377681 TGAGGGATTTTGTTACCACTAGG - Intergenic
1010614405 6:77995279-77995301 TGAGAGATTCTGTCACCACCAGG - Intergenic
1010727209 6:79348710-79348732 TGAGGGATTTTGTCACCACTGGG + Intergenic
1010876734 6:81116244-81116266 AGAGAGATTTTGTCACCACCAGG - Intergenic
1011234799 6:85203945-85203967 TGAGGGATTTTGTCACCACCAGG + Intergenic
1011235386 6:85211344-85211366 TGAGGGATTTTGTCACCACTAGG - Intergenic
1011235692 6:85213745-85213767 TGAGGGATTTTGTCACCACCAGG + Intergenic
1011393882 6:86885110-86885132 TGAGGGATTTTGTCACCACCAGG - Intergenic
1011776586 6:90737939-90737961 TGAGAGATTTTGTCACCACTAGG - Intergenic
1012328737 6:97958014-97958036 AGAGGGATTCCCACCCCACCCGG - Intergenic
1012596923 6:101052345-101052367 TGAGGGATTTTGTCACCACCAGG - Intergenic
1012871082 6:104673020-104673042 TGAGGGATTTTGTCACCACCAGG + Intergenic
1012969932 6:105718065-105718087 TGAGAGATTTTGTCACCACTAGG + Intergenic
1013200510 6:107890760-107890782 GGAGGGATTTTGTCACCACCAGG - Intronic
1013672799 6:112423315-112423337 TGAGGGATTTTGTCACCACCAGG + Intergenic
1013889586 6:115010264-115010286 TGAGAGATTTTGTCACCACTAGG + Intergenic
1013920276 6:115395146-115395168 TGAGGGATTCTGTCACCACCAGG - Intergenic
1013926484 6:115479236-115479258 TGAGAGATTTTGTCACCACTAGG - Intergenic
1014012242 6:116489518-116489540 TGAGGGATTTTGTCACCACCAGG + Intergenic
1014113576 6:117647525-117647547 TGAGGGATTTTGTCACCACTAGG + Intergenic
1014128897 6:117809187-117809209 TGAGGGATTTTGTCACCACCAGG - Intergenic
1014225004 6:118838051-118838073 TGAGGGATTTTGTCACCACCAGG - Intronic
1014484560 6:121983405-121983427 TGAGGGATTTTGTCACCACGAGG - Intergenic
1014560431 6:122883499-122883521 TGAGGGATTTTGTCACCACCAGG - Intergenic
1014589425 6:123245045-123245067 TGAGGGATTTTGTCACCACCAGG + Intronic
1014753944 6:125282465-125282487 TGAGGAATTCTGTCACCACCAGG + Intronic
1014902468 6:126984424-126984446 TGAGGGATTTTGTCACCACCAGG + Intergenic
1014924737 6:127256977-127256999 TGAGAGATTCTGTCACCACCAGG + Intergenic
1015162806 6:130172397-130172419 TGAGGGGTTTTGTCACCACTGGG - Intronic
1015211521 6:130703564-130703586 TGAGGGATTTTGTCACCACCAGG + Intergenic
1015433016 6:133153259-133153281 TGAGGGATTTTGTCACCACTAGG - Intergenic
1018144504 6:160871138-160871160 TGAGGGATTTTGTCACCACCAGG - Intergenic
1018300474 6:162397084-162397106 AGAGGCCTTCTCTTCCCACTAGG + Intronic
1018578456 6:165284775-165284797 TGAGGGAATTTGTCACCACTAGG + Intronic
1018705707 6:166461924-166461946 AGAGGGGTTTTGCCCCCACTGGG + Intronic
1018797462 6:167198091-167198113 TGAGGGATTTTGTCACCACCAGG - Intergenic
1018806040 6:167260554-167260576 AGAGGGATTTTGTCACCACCAGG + Intergenic
1018972693 6:168539628-168539650 AGGAGCGTTCTGTCCCCACTGGG - Intronic
1019071698 6:169352059-169352081 TGAGAGATTTTGTCCCCACCAGG - Intergenic
1019097966 6:169601262-169601284 TGAGAGATTCTGTCACCACCAGG + Intronic
1020367040 7:7392169-7392191 TGAGAGATTTTGTCACCACTGGG - Intronic
1020599135 7:10249780-10249802 TGAGGGATTTTGTCACCACCAGG + Intergenic
1020640602 7:10749020-10749042 TGAGGGATTTTGTCACCACCAGG + Intergenic
1020830468 7:13088727-13088749 TGAGAGATTCTGTCACCACCAGG - Intergenic
1021014862 7:15519606-15519628 TGAGGGATTTTGTCACCACCAGG + Intronic
1021208066 7:17808906-17808928 AGAGAGATTTTGTCACCACCAGG + Intronic
1021238562 7:18173644-18173666 TGAGAGATTCTGTCACCACCTGG - Intronic
1021671334 7:23037541-23037563 CGAGAGATTTTGTCACCACTAGG + Intergenic
1022929414 7:35094768-35094790 TGAGAGATTTTGTCACCACTAGG + Intergenic
1022934083 7:35153750-35153772 TGAGAGATTTTGTCACCACTAGG + Intergenic
1023511417 7:40957854-40957876 TGAGGGATTTTGTCACCACCAGG - Intergenic
1025637731 7:63338293-63338315 TGAGGGATTTTGTCACCACCAGG - Intergenic
1025644966 7:63409806-63409828 TGAGGGATTTTGTCACCACCAGG + Intergenic
1025714663 7:63943533-63943555 TGAGGGATTTTGTCACCACCAGG + Intergenic
1027583082 7:80022071-80022093 TGAGGGATTTTGTCACCACCAGG + Intergenic
1027701962 7:81480388-81480410 TGAGAGATTTTGTCCCCACCAGG + Intergenic
1028014430 7:85688798-85688820 AGATTGATTCTCTACCCACTGGG + Intergenic
1028497698 7:91480866-91480888 TGAGAGATTTTGTCACCACTAGG - Intergenic
1028945329 7:96573458-96573480 TGAGAGATTTTGTCACCACTAGG - Intronic
1029357826 7:100065810-100065832 AGGGTGAGTCTGTTCCCACTGGG + Intronic
1029808204 7:103018274-103018296 TGAGAGATTTTGTCACCACTAGG + Intronic
1029919560 7:104248588-104248610 TGAGGGATTTTGTCACCACCAGG + Intergenic
1029979641 7:104866025-104866047 TGAGAGATTTTGTCACCACTAGG + Intronic
1030482463 7:110121274-110121296 TGAGGGATTTTGTCACCACAAGG + Intergenic
1030500608 7:110354982-110355004 TGAGGGATTTTGTCACCACCAGG - Intergenic
1030592785 7:111501773-111501795 TGAGAGATTCTGTCACCACCAGG + Intronic
1030759483 7:113332610-113332632 TGAGGGATTTTGTCACCACCAGG + Intergenic
1030850086 7:114472902-114472924 ACAGGGATTCTCTCAACACTTGG + Intronic
1032367930 7:131317405-131317427 TGAGGGATTTTGTCACCACCAGG + Intronic
1032603507 7:133325402-133325424 TGAGAGATTCTGTCACCACCAGG - Intronic
1032603855 7:133328612-133328634 TGAGAGATTCTGTCACCACCAGG - Intronic
1032883253 7:136113024-136113046 TGAGAGATTCTGTCACCACCAGG - Intergenic
1033525827 7:142212152-142212174 TGAGGGATTTGGTCACCACTAGG + Intronic
1033631647 7:143164406-143164428 TGAGAGATTCTGTCACCACCAGG - Intergenic
1034044852 7:147916982-147917004 ACATGGATTCTGTCTCCCCTGGG + Intronic
1034375357 7:150638823-150638845 TGAGGGATTTTGTTCCCACCAGG - Intergenic
1034580035 7:152034074-152034096 AGAGGGAATTTGACCCAACTAGG - Intronic
1035882055 8:3254066-3254088 TGAGAGATTCTGTCACCACCAGG - Intronic
1035998104 8:4572308-4572330 TGGGGGATTTTGTCACCACTAGG - Intronic
1036345765 8:7961500-7961522 AGATGGATTCTCACCCCTCTTGG - Intergenic
1036841099 8:12122254-12122276 AGATGGATTCTCACCCCTCTTGG - Intergenic
1036862900 8:12368506-12368528 AGATGGATTCTCACCCCTCTTGG - Intergenic
1037009580 8:13823915-13823937 AAAGGCATTCTTTCTCCACTGGG - Intergenic
1037285273 8:17292651-17292673 TGAGGGATTCTGTCACCACGAGG - Intronic
1037545537 8:19916507-19916529 TGAGGGATTTTGTCACCACCAGG - Intronic
1037928580 8:22864496-22864518 CGAGGGGTTCTGTCCCAGCTGGG + Intronic
1038336792 8:26652126-26652148 ACAGGGATCCTGTCCCAACTGGG - Intronic
1038664101 8:29522616-29522638 AGAGAGATTCTGTTCCCAAGTGG + Intergenic
1039134051 8:34299521-34299543 TGAGGGATTTTGTCCCCACCAGG + Intergenic
1041287616 8:56276585-56276607 TGAGGGATTTTGTCACCACCAGG + Intergenic
1041446734 8:57960469-57960491 AGAGAGATTTTGTCACCACCAGG - Intergenic
1041459527 8:58096733-58096755 TGAGAGATTCTGTCACCACCAGG - Intronic
1042622519 8:70722488-70722510 TGAGGGATTTTGTCACCACCAGG - Intronic
1042683128 8:71408172-71408194 TGAGAGATTTTGTCACCACTAGG + Intronic
1042753711 8:72186158-72186180 TGAGGGATTTTGTCACCACCAGG + Intergenic
1042946391 8:74158457-74158479 TGAGAGATTTTGTCACCACTAGG + Intergenic
1043036470 8:75206515-75206537 TGAGGGATTTTGTCACCACCAGG - Intergenic
1043165676 8:76900266-76900288 TGAGAGATTCTGTCACCACCAGG - Intergenic
1044007751 8:86959040-86959062 AGAGAGATTCTGTCACCACCAGG - Intronic
1044042475 8:87387056-87387078 TGAGAGATTCTGTCACCACCAGG + Intronic
1044209821 8:89537046-89537068 TGAGAGATTTTGTCACCACTGGG + Intergenic
1044267939 8:90205105-90205127 CGAGGGATTTTGTCACCACCTGG + Intergenic
1044377931 8:91498543-91498565 TGAGGGATTTTGTCACCACCAGG - Intergenic
1044385616 8:91584829-91584851 TGAGAGATTCTGTCACCACCAGG - Intergenic
1044405458 8:91820682-91820704 TGAGGGATTTTGTCACCACCAGG + Intergenic
1044546757 8:93468268-93468290 TGAGGGATTTTGTCACCACCAGG + Intergenic
1044548455 8:93485175-93485197 TGAGGGATTTTGTCACCACCAGG + Intergenic
1045034781 8:98168561-98168583 ACAGTGATTCAGTCCCCACTGGG + Intergenic
1045052022 8:98336067-98336089 AGTGGGATAGTGTCCACACTGGG - Intergenic
1045184962 8:99828790-99828812 TGAGGGATTTTGTCACCACCAGG - Intronic
1045199873 8:99969191-99969213 TGAGGGATTGTGTCACCACCAGG + Intronic
1045520962 8:102902886-102902908 AGAGTGAGTCTGTCCACACGTGG + Intronic
1045883002 8:107063464-107063486 TGAGAGATTTTGTCACCACTAGG - Intergenic
1045954784 8:107894070-107894092 TGAGAGATTCTGTCACCACCAGG - Intergenic
1045969235 8:108060984-108061006 TGAGAGATTCTGTCACCACCAGG + Intronic
1046018044 8:108629784-108629806 TGAGGGATTTTGTCACCACCAGG + Intronic
1046122221 8:109860563-109860585 TGAGGGATTCTGTCACCACCAGG + Intergenic
1046416138 8:113916149-113916171 TGAGGGAATCTGTCACCACCAGG - Intergenic
1046709043 8:117488612-117488634 AGAGGGAATTTGTCACCACCAGG + Intergenic
1046867124 8:119163590-119163612 TGAGAGATTTTGTCACCACTAGG - Intergenic
1047157006 8:122330860-122330882 TGAGAGATTTTGTCACCACTAGG - Intergenic
1047340059 8:123972482-123972504 AGAAGGATTCTGGCACCAGTTGG - Intronic
1047473262 8:125200365-125200387 TGAGAGATTTTGTCACCACTAGG - Intronic
1047837589 8:128711263-128711285 TGAGAGATTCTGTCACCACCAGG - Intergenic
1048149623 8:131881891-131881913 TGAGGGATTTTGTCACCACCAGG - Intergenic
1048466589 8:134669552-134669574 TGAGAGATTTTGTCACCACTAGG + Intronic
1048696956 8:137039156-137039178 TGAGAGATTCTGTCACCACCAGG - Intergenic
1048713632 8:137242317-137242339 TGAGAGATTTTGTCACCACTAGG + Intergenic
1049875632 8:145018015-145018037 TGAGAGATTTTGTCACCACTGGG - Intergenic
1050129955 9:2401898-2401920 TGAGAGATTTTGTCACCACTAGG - Intergenic
1050141361 9:2519766-2519788 TGAGAGATTTTGTCACCACTAGG - Intergenic
1050322634 9:4468585-4468607 TGAGAGATTCTGTCACCACCAGG + Intergenic
1050329708 9:4533013-4533035 TGAGAGATTTTGTCACCACTAGG + Intronic
1050442703 9:5682350-5682372 TGAGAGATTTTGTCCCCACCAGG - Intronic
1050660949 9:7881814-7881836 TGAGGGATTTTGTCACCACCAGG + Intronic
1050887144 9:10780217-10780239 AGAGAGATTTTGTCACCACCAGG + Intergenic
1050956635 9:11669448-11669470 TGAGAGATTCTGTCACCACCAGG - Intergenic
1051003436 9:12313717-12313739 TGAGGGATTTTGTCACCACCAGG - Intergenic
1051292569 9:15559923-15559945 TGAGAGATTCTGTCACCACCAGG - Intronic
1051451487 9:17203027-17203049 TGAGGGACTCTGTCACCACCAGG - Intronic
1051458570 9:17289200-17289222 TGAGAGATTTTGTCACCACTAGG - Intronic
1051695608 9:19765488-19765510 TGAGGGATTTTGTCACCACCAGG - Intronic
1051830958 9:21275890-21275912 TGAGAGATTTTGTCACCACTAGG - Intergenic
1051945965 9:22570410-22570432 TGAGAGATTTTGTCACCACTAGG + Intergenic
1052000435 9:23272248-23272270 TGAGGGATTTTGTCACCACCAGG - Intergenic
1052302514 9:26969844-26969866 TGAGGGAATGTGTCACCACTAGG - Intronic
1052336186 9:27322818-27322840 TGAGAGATTTTGTCACCACTGGG - Intergenic
1052628528 9:31006690-31006712 TGAGGGATTTTGTCACCACCAGG + Intergenic
1052640315 9:31159140-31159162 TGAGAGATTCTGTCACCACCAGG - Intergenic
1052746475 9:32446776-32446798 TGAGAGATTCTGTCACCACCAGG - Intronic
1053138097 9:35664425-35664447 GGAGGGCTTCTGCCGCCACTTGG - Exonic
1053834193 9:42116473-42116495 TGAGAGATTCTGTCACCACCAGG + Intronic
1054596356 9:67070936-67070958 TGAGAGATTCTGTCACCACCAGG - Intergenic
1055210505 9:73784951-73784973 TGATGGATTTTGTCACCACTAGG + Intergenic
1055344916 9:75325873-75325895 TGAGGAATTTTGTCACCACTAGG - Intergenic
1055346438 9:75344764-75344786 TGAGAGATTTTGTCACCACTAGG - Intergenic
1055386628 9:75770130-75770152 TGAGGGATTTTGTCACCACCAGG - Intergenic
1055571977 9:77625685-77625707 TGAGAGATTCTGTCACCACCAGG + Intronic
1055853777 9:80662372-80662394 TGAGAGATTCTGTCACCACCAGG - Intergenic
1056126082 9:83537766-83537788 GGAGGGACTCTGGCCCCTCTGGG - Intronic
1057460512 9:95256487-95256509 TGAGAGATTCTGTCACCACCAGG + Intronic
1058029461 9:100179088-100179110 AGAGAGATTTTGTCACCACCAGG + Intronic
1058149050 9:101443787-101443809 AGAGGGTCTCTGTTCTCACTTGG - Intergenic
1058265998 9:102899380-102899402 TGAGGGATTTTGTCACCACCAGG + Intergenic
1058591228 9:106567089-106567111 TGAGGGATTTTGTCACCACCAGG + Intergenic
1058796458 9:108502906-108502928 TGAGAGATTTTGTCCCCACCAGG + Intergenic
1060097719 9:120807613-120807635 TGAGAGAGTCTGTCACCACTAGG - Intergenic
1060320908 9:122560518-122560540 TGAGGGATTTTGTCACCACCAGG - Intergenic
1060402085 9:123355107-123355129 AAGAGGATTCTCTCCCCACTGGG + Intergenic
1060508762 9:124217074-124217096 AGAGGGATTCTCTAGCCTCTGGG - Intergenic
1061502011 9:131009388-131009410 CGAGGACTTCTGTCCCCACGTGG + Exonic
1062046502 9:134426867-134426889 ACAGGAAGTCTGTCCACACTGGG + Intronic
1062363516 9:136198427-136198449 ACAGGGATTGTGTCCCCACCAGG + Intronic
1203459843 Un_GL000220v1:24756-24778 TGAGGGATTATGTCACCACCAGG - Intergenic
1203491927 Un_GL000224v1:115182-115204 AGAGAGATTTTGTCACCACCTGG - Intergenic
1203504551 Un_KI270741v1:57054-57076 AGAGAGATTTTGTCACCACCTGG - Intergenic
1186431144 X:9505247-9505269 TGAGGGATTTTGTTACCACTAGG + Intronic
1186743298 X:12540039-12540061 TGAGAGATTCTGTCACCACCAGG + Intronic
1186810546 X:13183576-13183598 TGAGGGATTTTGTTACCACTAGG + Intergenic
1188390916 X:29618001-29618023 AGAGGCCTTCTTTTCCCACTGGG + Intronic
1188525231 X:31081510-31081532 TGAGAGATTTTGTCACCACTAGG - Intergenic
1188831349 X:34901631-34901653 GGAAGCATTCTGTCCCTACTAGG - Intergenic
1189039569 X:37528645-37528667 TGAGGGATTTTGTCACCACCAGG - Intronic
1189598150 X:42591597-42591619 TGAGGGATTTTGTCACCACCAGG + Intergenic
1189734361 X:44054400-44054422 AGAGGGAGTCTTGTCCCACTAGG + Intergenic
1190506087 X:51127172-51127194 TGAGGGATTTTGTCACCACCAGG + Intergenic
1190544349 X:51510009-51510031 AGAGAGATTTTGTCACCACCAGG + Intergenic
1190608820 X:52172716-52172738 TGAGAGATTTTGTCACCACTGGG + Intergenic
1190643291 X:52501550-52501572 AGGGAGCTTCTGTGCCCACTAGG - Intergenic
1190644381 X:52511317-52511339 AGGGAGCTTCTGTGCCCACTAGG + Intergenic
1190909618 X:54758902-54758924 AGAGGGATCCTCCCCACACTGGG + Exonic
1191072757 X:56419759-56419781 TGAGAGATTTTGTCACCACTAGG - Intergenic
1191097240 X:56686813-56686835 TGAGGGATTTTGTCACCACCAGG - Intergenic
1191134686 X:57050853-57050875 TGAGGGATTTTGTCACCACCAGG + Intergenic
1191176145 X:57503676-57503698 TGAGAGATTTTGTCACCACTGGG + Intergenic
1191204739 X:57821888-57821910 AGAGGATTTCTGTATCCACTAGG + Intergenic
1191222552 X:58004695-58004717 TGAGAGATTTTGTCACCACTCGG + Intergenic
1191744892 X:64476142-64476164 TGAGAGATTTTGTCCCCACCAGG - Intergenic
1191747073 X:64501405-64501427 TGAGAGATTTTGTCACCACTAGG - Intergenic
1191765484 X:64694123-64694145 TGAGAGATTTTGTCCCCACCAGG - Intergenic
1191772573 X:64777236-64777258 TGAGAGATTCTGTCACCACCAGG - Intergenic
1191787947 X:64936723-64936745 TGAGAGATTCTGTCACCACCAGG + Intronic
1191788544 X:64944022-64944044 TGAGGGATTTTGTCACCACCAGG - Intronic
1191928523 X:66342840-66342862 TGAGGGATTTTGTCACCACCAGG - Intergenic
1191960036 X:66691174-66691196 TGAGAGATTTTGTCACCACTGGG - Intergenic
1191993379 X:67064186-67064208 TGAGAGATTCTGTCACCACCAGG - Intergenic
1192000792 X:67149249-67149271 TGAGGGATTTTGTCACCACCAGG - Intergenic
1192078028 X:68019591-68019613 TGAGGGATTTTGTCACCACCAGG + Intergenic
1192165515 X:68825268-68825290 AGAGGGTTGCTAGCCCCACTGGG + Intergenic
1192391223 X:70730108-70730130 TGAGAGATTCTGTCACCACCAGG + Intronic
1192406612 X:70892200-70892222 TGAGGGATTTTGTCACCACCGGG + Intronic
1192613103 X:72587383-72587405 TGAGAGATTCTGTCACCACCAGG + Intronic
1192729583 X:73789759-73789781 TGAGGGATTTTGTCACCACCAGG - Intergenic
1192854819 X:74998202-74998224 TGAGGGATTTTGTCACCACCAGG - Intergenic
1192883432 X:75312320-75312342 TGAGGGATTTTGTCACCACCAGG - Intergenic
1192936220 X:75861402-75861424 TGAGAGATTCTGTCACCACCAGG - Intergenic
1193043657 X:77030232-77030254 TGAGGGATTTTGTCTCCACCAGG - Intergenic
1193174161 X:78372523-78372545 TGAGGGATTTTGTCACCACCAGG - Intergenic
1193402787 X:81065595-81065617 TGAGAGATTTTGTCACCACTAGG + Intergenic
1193445242 X:81593364-81593386 TGAGAGATTCTGTCACCACCAGG - Intergenic
1193897460 X:87130540-87130562 TGAGAGATTCTGTCACCACCAGG + Intergenic
1194231983 X:91335744-91335766 AGAGAGATTTTGTCACCACCGGG - Intergenic
1194315085 X:92367687-92367709 TGAGGGATTTTGTCACCACCAGG - Intronic
1194559714 X:95404878-95404900 TGAGGGATTTTGTCACCACCAGG + Intergenic
1194643181 X:96427764-96427786 TGAGGGATTTTGTCACCACCAGG - Intergenic
1194677653 X:96813715-96813737 TGAGGGATTTTGTCACCACCAGG - Intronic
1194798186 X:98239023-98239045 TGAGGGATTTTGTCACCACCAGG - Intergenic
1194837275 X:98697300-98697322 TGAGAGATTTTGTCACCACTAGG - Intergenic
1194852168 X:98882755-98882777 TGAGAGATTTTGTCACCACTAGG + Intergenic
1194896112 X:99442227-99442249 AGAGGGAAAATTTCCCCACTTGG - Intergenic
1194901400 X:99515878-99515900 TGAGGGATTTTGTCACCACCAGG + Intergenic
1195088790 X:101439162-101439184 TGAGAGATTCTGTCACCACTAGG - Intronic
1195140316 X:101952145-101952167 TGAGGGATTTTGTCACCACCAGG + Intergenic
1195170697 X:102265233-102265255 TGAGGGATTTTGTCACCACCAGG + Intergenic
1195188162 X:102421866-102421888 TGAGGGATTTTGTCACCACCAGG - Intronic
1195434495 X:104827316-104827338 TGAGGGATTTTGTCACCACCAGG - Intronic
1195435714 X:104841580-104841602 TGAGGGATTTTGTCACCACCAGG - Intronic
1195469242 X:105213925-105213947 TGAGGGATTTTGTCACCACCAGG + Intronic
1195572204 X:106408949-106408971 TGAGGGATTTTGTCACCACCAGG + Intergenic
1195674831 X:107500027-107500049 GGAGGGATTATGTACTCACTAGG + Intergenic
1195686076 X:107587641-107587663 TGAGGGATTTTGTCACCACCAGG - Intronic
1195854777 X:109319103-109319125 TGAGAGATTTTGTCACCACTAGG - Intergenic
1195882353 X:109605340-109605362 TGAGGGATTTTGTCACCACCAGG + Intergenic
1195979156 X:110559622-110559644 TGAGGGATTTTGTCACCACCAGG - Intergenic
1195983493 X:110604420-110604442 TGAGGGATTATGTCACCACCAGG + Intergenic
1197001058 X:121439451-121439473 TGAGAGATTTTGTCACCACTAGG + Intergenic
1197057842 X:122141941-122141963 TGAGAGATTTTGTCACCACTAGG + Intergenic
1197071086 X:122298773-122298795 TGAGAGATTATGTCACCACTAGG - Intergenic
1197091890 X:122548868-122548890 TGAGAGATTTTGTCACCACTAGG + Intergenic
1197184945 X:123575426-123575448 TGAGGGATTCTGTCACCATCAGG + Intergenic
1197302763 X:124801777-124801799 TGAGGGATTTTGTCACCACCAGG - Intronic
1197395395 X:125921526-125921548 TGAGGGATTTTGTCACCACCAGG - Intergenic
1197489935 X:127103854-127103876 TGAGGGATTTTGTCACCACCAGG + Intergenic
1197506204 X:127307737-127307759 TGAGGGATTTTGTCACCACCAGG + Intergenic
1198060361 X:133040382-133040404 TGAGGGATTTTGTCACCACCAGG - Intronic
1198085840 X:133280889-133280911 TGAGAGATTCTGTCACCACCAGG + Intergenic
1198490143 X:137131388-137131410 TGAGGGATTTTGTCACCACCAGG + Intergenic
1198571479 X:137961615-137961637 TGAGAGATTTTGTCACCACTAGG + Intergenic
1198581990 X:138075340-138075362 TGAGAGATTTTGTCACCACTAGG + Intergenic
1199378970 X:147146202-147146224 TGAGAGATTTTGTCACCACTAGG - Intergenic
1199452009 X:147988201-147988223 TAAGGGATTCTGTCACCACCAGG - Intronic
1199524707 X:148779938-148779960 TGAGGGATTTTGTCACCACCAGG - Intronic
1199588125 X:149437624-149437646 TGAGAGATTTTGTCACCACTAGG + Intergenic
1199662895 X:150070301-150070323 TGAGAGATTCTGTCACCACCAGG - Intergenic
1199878462 X:151954049-151954071 AGAGGAATGCTGTCCCAAATAGG + Exonic
1200365204 X:155655796-155655818 TGAGGGATTCTGTCACCACCAGG - Intronic
1200740080 Y:6845058-6845080 TGAGGGATTTTGTCACCACCAGG - Intergenic
1201313008 Y:12613953-12613975 TGAGGGATTTTGTCACCACCAGG + Intergenic
1201913772 Y:19159984-19160006 TGAGAGATTCTGTCACCACCAGG + Intergenic
1201915240 Y:19174431-19174453 TGAGAGATTTTGTCACCACTAGG + Intergenic
1201945739 Y:19508219-19508241 TGAGAGATTTTGTCACCACTAGG - Intergenic
1201992983 Y:20049328-20049350 AGAGAGATTTTGTCACCACCAGG + Intergenic
1202041852 Y:20694073-20694095 TGAGAGATTTTGTCACCACTAGG - Intergenic
1202085022 Y:21127708-21127730 TGAGAGATTTTGTCACCACTAGG - Intergenic
1202088069 Y:21160024-21160046 TGAGAGATTTTGTCGCCACTAGG - Intergenic
1202374728 Y:24223822-24223844 TGAGAGATTCTGTCACCACCAGG + Intergenic
1202496052 Y:25446298-25446320 TGAGAGATTCTGTCACCACCAGG - Intergenic