ID: 932818216

View in Genome Browser
Species Human (GRCh38)
Location 2:74878564-74878586
Sequence GGGATTCTGTCCCCACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818208_932818216 11 Left 932818208 2:74878530-74878552 CCTGCCCCTGCACAGGTGGACTA 0: 1
1: 0
2: 5
3: 6
4: 123
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818200_932818216 26 Left 932818200 2:74878515-74878537 CCCCTTCCTCCTCCTCCTGCCCC 0: 2
1: 29
2: 636
3: 5320
4: 15002
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818211_932818216 5 Left 932818211 2:74878536-74878558 CCTGCACAGGTGGACTAAGCAAT 0: 1
1: 0
2: 0
3: 8
4: 73
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818199_932818216 27 Left 932818199 2:74878514-74878536 CCCCCTTCCTCCTCCTCCTGCCC 0: 2
1: 10
2: 159
3: 1191
4: 5781
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818203_932818216 20 Left 932818203 2:74878521-74878543 CCTCCTCCTCCTGCCCCTGCACA 0: 1
1: 2
2: 32
3: 259
4: 2584
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818207_932818216 14 Left 932818207 2:74878527-74878549 CCTCCTGCCCCTGCACAGGTGGA 0: 1
1: 1
2: 4
3: 28
4: 390
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818201_932818216 25 Left 932818201 2:74878516-74878538 CCCTTCCTCCTCCTCCTGCCCCT 0: 1
1: 12
2: 180
3: 1177
4: 5334
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818202_932818216 24 Left 932818202 2:74878517-74878539 CCTTCCTCCTCCTCCTGCCCCTG 0: 1
1: 5
2: 110
3: 1049
4: 5067
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818210_932818216 6 Left 932818210 2:74878535-74878557 CCCTGCACAGGTGGACTAAGCAA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818205_932818216 17 Left 932818205 2:74878524-74878546 CCTCCTCCTGCCCCTGCACAGGT 0: 1
1: 0
2: 6
3: 92
4: 749
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224
932818209_932818216 7 Left 932818209 2:74878534-74878556 CCCCTGCACAGGTGGACTAAGCA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG 0: 1
1: 0
2: 0
3: 18
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818216 Original CRISPR GGGATTCTGTCCCCACTGGG TGG Intronic
903293118 1:22327042-22327064 GGGGTTCTGGCCACACCGGGAGG + Intergenic
903305375 1:22409210-22409232 GGGATTCAGCAGCCACTGGGAGG - Intergenic
911079636 1:93916029-93916051 GTCAATCAGTCCCCACTGGGAGG + Intergenic
912447352 1:109748193-109748215 GTCAGTCTGTCCCTACTGGGGGG + Intronic
913151933 1:116052652-116052674 GTCAGTCTGCCCCCACTGGGAGG - Intronic
915105623 1:153533605-153533627 TGTCTTCTGTCCCCACTGGGTGG - Intergenic
915559023 1:156675853-156675875 TGGATTCTGTCTCCTCTGAGAGG + Intronic
918548096 1:185708124-185708146 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
920377906 1:205519143-205519165 GCCCTTCTGTCCCCACTTGGGGG + Intronic
1063993034 10:11586981-11587003 GGGAATCTGTCCTCACAGGGAGG - Intronic
1065081536 10:22134506-22134528 AGCACTCTGTCTCCACTGGGTGG - Intergenic
1069784605 10:70979704-70979726 AGGATCCTGTCCCCACATGGGGG - Intergenic
1070307055 10:75245926-75245948 GGGAGTGTGTCCCTCCTGGGAGG - Intergenic
1070893082 10:79956896-79956918 GTCAGTCTGTCCCTACTGGGGGG - Intronic
1076259606 10:129055013-129055035 GGGGTTCTGTTCCTGCTGGGTGG - Intergenic
1076413951 10:130271627-130271649 AGGCTTCTGTCCACACGGGGTGG - Intergenic
1077194832 11:1274131-1274153 GGCACCCTCTCCCCACTGGGTGG - Intergenic
1077244345 11:1528859-1528881 GGGTTTCTGGCCCCACAGGGTGG - Intergenic
1078032286 11:7764834-7764856 GTCATTCTGCCCCTACTGGGGGG - Intergenic
1081538260 11:44011255-44011277 GGGTTTCTGGCCTCACTGGCTGG - Intergenic
1081781671 11:45717306-45717328 TGGATTCCGTAACCACTGGGAGG + Intergenic
1081873160 11:46392220-46392242 GGGAGTCTGACCCCAGCGGGAGG + Intergenic
1082107452 11:48236064-48236086 GGCAGTCTGCCCCTACTGGGTGG + Intergenic
1082137562 11:48566975-48566997 GTGAGTCCGTCCCTACTGGGAGG + Intergenic
1082556970 11:54574355-54574377 GTCATTCTGCCCCTACTGGGGGG - Intergenic
1083602674 11:63958595-63958617 GGGACTATGTCCCCAGCGGGAGG + Intergenic
1083970186 11:66070000-66070022 GGGATTCGGTCCCTGCAGGGAGG - Intergenic
1084319788 11:68366944-68366966 GGGATTCTGTCTGCACCGCGGGG - Intronic
1085506998 11:77066571-77066593 GGGGTTCAGCCCCCACAGGGCGG - Intergenic
1089101703 11:115967670-115967692 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
1089494082 11:118899769-118899791 GGGATGCTGTTCCCACTCGCTGG - Intronic
1090256444 11:125287846-125287868 GGGATTCTATCCCCAAGTGGGGG + Intronic
1090308844 11:125716900-125716922 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
1091220517 11:133927623-133927645 GGGATCCTGGCCCCACTGTGGGG - Intronic
1091748953 12:3010788-3010810 GGGTTTCAGTCCCCACAGTGAGG + Intronic
1095389441 12:41688222-41688244 GGGACTCTGTTACCACTGTGAGG - Intergenic
1096069769 12:48768520-48768542 TGGACTCTGTGCTCACTGGGTGG - Exonic
1096237443 12:49939414-49939436 GGAATTCTGTCCACCCAGGGTGG - Intergenic
1096586228 12:52621866-52621888 GGGATTCCATCCCCACCAGGAGG + Intergenic
1100440776 12:94615277-94615299 GGGATTCATTCCCCATAGGGTGG - Intronic
1101545124 12:105705306-105705328 GGGATTCTGGACCTTCTGGGAGG + Intergenic
1105411103 13:20172353-20172375 GGGATGCTGTCTCCAATGGGTGG + Intergenic
1108907782 13:55500718-55500740 GGACATCTGTCCCCACTGGGAGG - Intergenic
1110892513 13:80707877-80707899 GTCATTCTGCCCCTACTGGGGGG + Intergenic
1113927427 13:113949598-113949620 GGCATTCTGTCCCCTCTTGCAGG + Intergenic
1114159143 14:20143750-20143772 TGAATTCTGTCACCACTGTGAGG - Exonic
1115080851 14:29448849-29448871 GGAATTCTGTCCCCTCTGACTGG + Intergenic
1116287782 14:42994540-42994562 GGGATTCTGTTCCTAGTGGTGGG + Intergenic
1123116221 14:105895267-105895289 GGGCTTCTGGGACCACTGGGTGG + Intergenic
1123759366 15:23420844-23420866 GGGCTTCTGTCCCCAGAGGGCGG + Intergenic
1124256227 15:28145075-28145097 GGGGTCATTTCCCCACTGGGTGG - Intronic
1125275138 15:37980722-37980744 GGAAGTTTGTTCCCACTGGGTGG + Intergenic
1128853796 15:70990027-70990049 GTCATTCTGCCCCTACTGGGGGG + Intronic
1128946631 15:71827390-71827412 GGCATTGTGCCCCCACTGTGAGG - Intronic
1129701235 15:77769666-77769688 GGGATCCTGTCCCCCAGGGGTGG - Intronic
1131675318 15:94665243-94665265 GGGCTTCTGTCCCTGCTGTGTGG + Intergenic
1132930864 16:2458669-2458691 GGAATTCTGGCCACCCTGGGTGG + Exonic
1133028631 16:2999268-2999290 AGGTTTCAGTCCCCACTGGATGG - Intergenic
1134456980 16:14402014-14402036 GGGCTTCTGTCCCCAGAGGGCGG - Intergenic
1134591141 16:15454401-15454423 GAAATTCTGTCCCCAGTGGATGG - Intronic
1138456823 16:57125817-57125839 GGGTCTCTGGCCCCACTGGGTGG + Intronic
1143147941 17:4788932-4788954 GGGCTTCTGTCCCCTCCTGGAGG + Intergenic
1144461033 17:15458751-15458773 GGGATACTGTCCCTGCTGTGGGG + Intronic
1145309194 17:21692234-21692256 AAGATTCTGGCCCCACAGGGTGG - Intergenic
1148353223 17:46956486-46956508 GGGTTTCTGTCTCTACTGGTTGG + Intronic
1150306809 17:64092308-64092330 GTGATTCTGTCAGCACAGGGAGG + Intronic
1150663944 17:67112553-67112575 AGGATTCAGTACCCACTGGAGGG - Intronic
1151243961 17:72779972-72779994 GGGATTCTTTCCCCAGTGACTGG + Intronic
1151948403 17:77331811-77331833 GGGTTCCTGTCCTAACTGGGCGG + Intronic
1152772699 17:82179944-82179966 GGAATTCTGCCCCCAGTGTGTGG - Intronic
1153221404 18:2865606-2865628 GTGAGTCTGCCCCTACTGGGGGG + Intronic
1155676043 18:28430029-28430051 GGGCTTTCATCCCCACTGGGTGG - Intergenic
1157036801 18:43984699-43984721 GTCATTCTGCCCCTACTGGGAGG - Intergenic
1159296341 18:66494211-66494233 GGGATTGAGTAGCCACTGGGAGG + Intergenic
1160750574 19:732250-732272 GGGATACTGTTCCCACAGGAAGG - Intronic
1160959889 19:1715749-1715771 GGCGTTCTGCCCCCACTGGCAGG + Intergenic
1161121139 19:2527440-2527462 TCGAACCTGTCCCCACTGGGAGG + Intronic
1161582406 19:5088058-5088080 GGGCTTCTCTCCCCACAGGTGGG - Intronic
1162352352 19:10158401-10158423 CGGTTCCTGTACCCACTGGGAGG - Intronic
1165130781 19:33630518-33630540 GGCAGTCTGTCCACACTGGTGGG + Intronic
1166258034 19:41619869-41619891 GGTGTTGTGTCCACACTGGGAGG - Intronic
1167140549 19:47647825-47647847 GGGATCCTGTCCACGATGGGGGG + Intronic
1167428994 19:49443560-49443582 GGGACTCTGCAGCCACTGGGTGG - Intergenic
926113549 2:10197177-10197199 GGGATGTTGTCCCCACTCGAAGG - Intronic
926321189 2:11749357-11749379 GGGAATCTGTGCCCCCTAGGAGG + Intronic
927490695 2:23519161-23519183 GGGAGGCTGTCCCCGCTTGGTGG - Intronic
928058873 2:28088858-28088880 GGGATTCTGTAGCCACTAGCAGG + Intronic
928442369 2:31303067-31303089 TGGATTCTGTCCCGACTGGCTGG + Intergenic
931457697 2:62425007-62425029 GGGACACTGCCCCCACTGGCTGG + Intergenic
931645847 2:64421199-64421221 GGGACACTGTTTCCACTGGGAGG + Intergenic
932818216 2:74878564-74878586 GGGATTCTGTCCCCACTGGGTGG + Intronic
932935345 2:76096045-76096067 GTCAGTCTGCCCCCACTGGGGGG + Intergenic
934169221 2:89325548-89325570 GGGACTCTGTTCACAGTGGGAGG + Intergenic
934198072 2:89857036-89857058 GGGACTCTGTTCACAGTGGGAGG - Intergenic
934550335 2:95257466-95257488 GTCATTCTGCCCCTACTGGGGGG + Intronic
934815978 2:97326845-97326867 GGGACTCTGTTCACAATGGGAGG + Intergenic
934821718 2:97381639-97381661 GGGACTCTGTTCACAATGGGAGG - Intergenic
937895904 2:126976690-126976712 GGGCTTGTGTCCCTGCTGGGTGG - Intergenic
938876540 2:135537144-135537166 GAGCTTCTCTCCCCACTGAGGGG - Intronic
942133133 2:172900052-172900074 GGAACTCTGTCCCCACTGTCAGG - Intronic
944534156 2:200693587-200693609 GGGTATCTGTCCTCTCTGGGAGG + Intergenic
944570120 2:201035998-201036020 GTCAGTCTGTCCCTACTGGGGGG + Intronic
947354212 2:229275405-229275427 GTGGTTCTGTCACTACTGGGAGG - Intergenic
947801054 2:232928572-232928594 GGGAATGTGTCCCCGCTGGAGGG + Intronic
948402390 2:237693035-237693057 AGGATCCTGTCCGCGCTGGGCGG - Intronic
1169153387 20:3308109-3308131 AGGATGCTGTTCCCCCTGGGTGG - Intronic
1172162157 20:32876160-32876182 TGGATTCTGGCCCCAGTCGGGGG + Intronic
1174869571 20:54170692-54170714 GGGCTGCTGTCCCTCCTGGGAGG + Intronic
1175224566 20:57437498-57437520 GGGATTCTGACTCAACTGGCAGG - Intergenic
1178478679 21:32959894-32959916 AGGATTCTATGCCCACTGGTAGG - Intergenic
1178885835 21:36484041-36484063 GGACTTATGGCCCCACTGGGCGG + Intronic
1181270278 22:21654470-21654492 CAGATTCTGTACCCACTGGCTGG + Intronic
1183803302 22:40186383-40186405 TGCATTCTGTTCCTACTGGGCGG - Intronic
1184665512 22:45986980-45987002 GGGACTCTGTCCCTCCTGGGAGG - Intergenic
1185091544 22:48778444-48778466 AGGATTCTGTTTCCAGTGGGAGG + Intronic
950496233 3:13336064-13336086 AGGACTCTGTTCCCACTGGGTGG + Intronic
952154633 3:30629386-30629408 GTTCTTCTTTCCCCACTGGGAGG - Intronic
956962047 3:74414560-74414582 GAGATTCTGACCCCATAGGGTGG - Intronic
958861540 3:99450770-99450792 GTCAGTCTGCCCCCACTGGGGGG - Intergenic
959949684 3:112165666-112165688 GTCAGTCTGTCCCTACTGGGGGG + Intronic
960055056 3:113271100-113271122 GGGATTCTCTCCCCTCTGGCCGG + Intronic
960448629 3:117778711-117778733 GTGAGTCTGCCCCTACTGGGGGG - Intergenic
960563551 3:119111987-119112009 GTCAGTCTGCCCCCACTGGGTGG + Intronic
962690914 3:137897339-137897361 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
964688501 3:159423805-159423827 GTCAGTCTGTCCCTACTGGGGGG - Intronic
965964677 3:174472796-174472818 GGGATTCAGTCCACAGTGAGAGG - Intronic
967258070 3:187613526-187613548 GGCCTTCTCTCTCCACTGGGAGG - Intergenic
967319121 3:188178221-188178243 GGAATTCTGGCCCCAGTGGAGGG + Intronic
967882075 3:194308522-194308544 GGTATTTTCTCCCCTCTGGGAGG - Intergenic
968159020 3:196409836-196409858 TGGAATCTGTCCACACTGGATGG - Intronic
969709691 4:8835649-8835671 GGGCTATTGTCCCCACTGAGGGG - Intergenic
970611563 4:17729493-17729515 GTCATTCTGCCCCTACTGGGGGG - Intronic
972090292 4:35273102-35273124 TGGATTCAGCCCTCACTGGGAGG + Intergenic
972923191 4:43968979-43969001 GGACTTCTGTCCCCCATGGGCGG + Intergenic
977029454 4:91863714-91863736 GTCATTCTGCCCCTACTGGGGGG + Intergenic
978565535 4:110077334-110077356 GTCAGTCTGTCCCTACTGGGGGG - Intronic
979726914 4:123973451-123973473 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
980542101 4:134208509-134208531 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
981415050 4:144483164-144483186 GTCAGTCTGTCCCTACTGGGAGG - Intergenic
982328070 4:154149974-154149996 GTCATTCTGTCCCTACTCGGGGG + Intergenic
984563017 4:181293081-181293103 CAGATTCTCTCCCCCCTGGGAGG + Intergenic
985342861 4:188973634-188973656 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342877 4:188973680-188973702 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342885 4:188973703-188973725 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342893 4:188973726-188973748 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342901 4:188973749-188973771 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342915 4:188973794-188973816 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342923 4:188973817-188973839 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342938 4:188973862-188973884 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342954 4:188973908-188973930 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342968 4:188973953-188973975 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342990 4:188974022-188974044 GGAATGATGTCCCCACAGGGCGG + Intergenic
985342998 4:188974045-188974067 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343013 4:188974090-188974112 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343021 4:188974113-188974135 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343045 4:188974182-188974204 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343061 4:188974228-188974250 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343075 4:188974273-188974295 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343103 4:188974364-188974386 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343111 4:188974387-188974409 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343133 4:188974455-188974477 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343148 4:188974501-188974523 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343163 4:188974546-188974568 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343190 4:188974636-188974658 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343198 4:188974659-188974681 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343232 4:188974772-188974794 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343240 4:188974795-188974817 GGAATGATGTCCCCACAGGGTGG + Intergenic
985343248 4:188974818-188974840 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343274 4:188974887-188974909 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343288 4:188974932-188974954 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343296 4:188974955-188974977 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343304 4:188974978-188975000 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343322 4:188975024-188975046 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343346 4:188975093-188975115 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343354 4:188975116-188975138 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343370 4:188975161-188975183 GGAATGATGTCCCCACAGGGGGG + Intergenic
985343378 4:188975184-188975206 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343394 4:188975230-188975252 GGAATGATGTCCCCACAGGGCGG + Intergenic
985343410 4:188975275-188975297 GGAATGATGTCCCCACAGGGGGG + Intergenic
985639576 5:1057398-1057420 GGGACTCTGTCCTCACTGCCGGG + Intronic
985753921 5:1701763-1701785 TGTGCTCTGTCCCCACTGGGGGG + Intergenic
989284883 5:39687919-39687941 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
989956578 5:50367498-50367520 GTCATTCTGCCCCTACTGGGGGG - Intergenic
992398561 5:76390093-76390115 GGGAGCCTGTCCACAATGGGTGG + Intergenic
994287891 5:97992044-97992066 GTCATTCTGTCCCTACTGGAGGG - Intergenic
995771475 5:115675254-115675276 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
996224099 5:120969296-120969318 GGGATTCTTTCCCCATTGCATGG - Intergenic
996595334 5:125195114-125195136 GGGATGCTGTCTCTACTGGCAGG + Intergenic
997597700 5:135118129-135118151 GGGATTGTGACCCCAGTGTGTGG + Intronic
999033553 5:148320714-148320736 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
1002903943 6:1433991-1434013 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
1004701885 6:18087269-18087291 GGCATTCTGTCTTCACTGCGAGG - Intergenic
1006041485 6:31259903-31259925 GTCATTCGGTCCCTACTGGGAGG + Intergenic
1006134644 6:31888174-31888196 GGTCTTCTGTCCCCACTGTGGGG - Exonic
1007710750 6:43822485-43822507 GTGATTCTGTTCCCCCTGGGTGG + Intergenic
1010362678 6:75013046-75013068 GTCATTCTGCCCCTACTGGGGGG - Intergenic
1010463750 6:76143121-76143143 GTCATTCTGTCCCTACTGGGGGG + Intergenic
1010476863 6:76298934-76298956 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
1012089485 6:94873695-94873717 GTCATTCTGCCCCTACTGGGGGG + Intergenic
1014674534 6:124348231-124348253 GTCAGTCTGCCCCCACTGGGGGG + Intronic
1015525814 6:134175015-134175037 GCGGTTCTGTCCCCATTGAGAGG + Intronic
1017436628 6:154421691-154421713 GTGATACTGTCCCCATGGGGTGG + Intronic
1017766136 6:157608836-157608858 GGGGGGCTGTCCCCACAGGGCGG + Intronic
1018753523 6:166828342-166828364 TGAATTCTGTCCCCACAGGAAGG - Intronic
1019529205 7:1495244-1495266 GGGAGTCTGTCCCCTCTCTGCGG - Intronic
1020081480 7:5288236-5288258 GGGCTTTTGTGCTCACTGGGTGG + Intronic
1024031797 7:45467890-45467912 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
1025197427 7:56943912-56943934 GGGCTTTTGTGCTCACTGGGTGG - Intergenic
1025674520 7:63633027-63633049 GGGCTTTTGTGCTCACTGGGTGG + Intergenic
1026928511 7:74210141-74210163 GAGCTCCTGGCCCCACTGGGTGG + Intronic
1028685134 7:93583297-93583319 GGGACTCTGTCTCCAAGGGGAGG + Intergenic
1029305376 7:99616133-99616155 GGCAGTCTGTCTCAACTGGGTGG - Intergenic
1030672907 7:112356076-112356098 GGCATTCTGTCCCCACAGTGTGG + Intergenic
1031344273 7:120645739-120645761 TGGATTCTGTGCCCAATGGCTGG + Intronic
1034094876 7:148398159-148398181 CAGATTCTGTCTCCACTGTGCGG - Intronic
1036699354 8:11001780-11001802 GGGCTGCTCTGCCCACTGGGAGG - Intronic
1036824642 8:11966559-11966581 GGAACTCTGTCCCTAATGGGTGG + Intergenic
1040318064 8:46275446-46275468 GGGACTCTGTCCCAACCCGGGGG + Intergenic
1040390186 8:46942889-46942911 GTCAGTCTGTCCCTACTGGGGGG - Intergenic
1047467236 8:125128866-125128888 TGGATTCTCTCCCCACTGCAAGG + Intronic
1047841721 8:128760586-128760608 GTCAGTCTGCCCCCACTGGGGGG - Intergenic
1049663472 8:143831097-143831119 GGGAAGCTGTCCCCAGAGGGTGG - Intergenic
1050442822 9:5683542-5683564 GTCAGTCTGTCCCTACTGGGGGG + Intronic
1050479029 9:6070635-6070657 GAGATTCTGTCCCCCACGGGAGG - Intergenic
1053142414 9:35690066-35690088 GGGAGGCGGTCCCCAGTGGGTGG - Exonic
1057772648 9:97982710-97982732 GCGATTCCGTCCCGACGGGGGGG + Intergenic
1057939293 9:99266790-99266812 GGGCTTCAGACCGCACTGGGAGG + Intergenic
1059155352 9:111984231-111984253 GGGATTGTGTCCCCACAATGTGG - Intergenic
1060508761 9:124217071-124217093 GGGATTCTCTAGCCTCTGGGTGG - Intergenic
1060946823 9:127574597-127574619 GGGACTCCGTGCCAACTGGGAGG - Intronic
1060963528 9:127698734-127698756 GGGATTCTATATCCACAGGGAGG - Intronic
1061726784 9:132586515-132586537 GTAATTCTGTCCCGACTGTGGGG + Intronic
1061763601 9:132867765-132867787 TGGGTTCTCTCCCCACAGGGAGG - Intronic
1062279199 9:135744485-135744507 GGGAGTCTGTCCCCAGGTGGCGG - Intronic
1186046353 X:5541119-5541141 GGGAATTTGTCCCCACAGTGGGG - Intergenic
1186681172 X:11875803-11875825 GGCTTTCTGTCCCCTCTGGGGGG - Intergenic
1186835893 X:13437446-13437468 GGCAATCTGTCCCCTCTGGCTGG + Intergenic
1191180595 X:57559148-57559170 GTCATTCTGCCCCTACTGGGGGG + Intergenic
1191687182 X:63904076-63904098 GTCAGTCTGTCCCTACTGGGGGG + Intergenic
1192837333 X:74814923-74814945 AAGATTCTGTGCCCTCTGGGGGG - Intronic
1196112656 X:111963569-111963591 GTCAGTCTGTCCCTACTGGGGGG - Intronic
1198165275 X:134049557-134049579 GTCAGTCTGCCCCCACTGGGGGG + Intergenic
1199489031 X:148378827-148378849 GAGATACTTTCCCCTCTGGGAGG - Intergenic