ID: 932818554

View in Genome Browser
Species Human (GRCh38)
Location 2:74880542-74880564
Sequence TACGTGTGTGCTACCCCGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932818545_932818554 6 Left 932818545 2:74880513-74880535 CCAGTGCCCCCGTCAAGATGCTG 0: 1
1: 1
2: 2
3: 11
4: 114
Right 932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG 0: 1
1: 0
2: 1
3: 2
4: 45
932818549_932818554 -3 Left 932818549 2:74880522-74880544 CCGTCAAGATGCTGCCCACCTAC 0: 1
1: 1
2: 0
3: 15
4: 159
Right 932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG 0: 1
1: 0
2: 1
3: 2
4: 45
932818548_932818554 -2 Left 932818548 2:74880521-74880543 CCCGTCAAGATGCTGCCCACCTA 0: 1
1: 2
2: 3
3: 5
4: 185
Right 932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG 0: 1
1: 0
2: 1
3: 2
4: 45
932818546_932818554 0 Left 932818546 2:74880519-74880541 CCCCCGTCAAGATGCTGCCCACC 0: 1
1: 1
2: 1
3: 9
4: 139
Right 932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG 0: 1
1: 0
2: 1
3: 2
4: 45
932818547_932818554 -1 Left 932818547 2:74880520-74880542 CCCCGTCAAGATGCTGCCCACCT 0: 1
1: 1
2: 2
3: 4
4: 109
Right 932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG 0: 1
1: 0
2: 1
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932818554 Original CRISPR TACGTGTGTGCTACCCCGGA CGG Exonic
908678891 1:66636605-66636627 TACCTGTGTGCTATCCAAGATGG - Intronic
909486893 1:76184507-76184529 TGTGTGTGTGCTGCCCAGGAGGG - Intronic
911671866 1:100616592-100616614 TATCTGTGTGCTACACCTGATGG + Intergenic
913129842 1:115829258-115829280 GATGGGTGTGCGACCCCGGAGGG + Intergenic
915382349 1:155453210-155453232 TAGGTGTGTGCTACCACGCCTGG - Intronic
923572988 1:235133062-235133084 TAGGTGTGAGCTACCCCGCCTGG - Intronic
1074744512 10:116518343-116518365 TATGTGTGTGCTACACTGTAAGG - Intergenic
1076013671 10:127010566-127010588 TATGTATGTGCTGCCCAGGACGG - Intronic
1077057778 11:603843-603865 TAGGTGTGTGCTACCACGCCCGG + Intronic
1084288776 11:68148413-68148435 TTCGTGTGTGTTTCCCTGGAGGG + Intergenic
1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG + Intronic
1111544933 13:89719968-89719990 TACATGTGTGCTACCACAGCCGG + Intergenic
1112757338 13:102652232-102652254 TAAGTGTGTGCTACCACGCCTGG - Intronic
1113171718 13:107512249-107512271 TAGGTGTGTGCTACCTCGCCTGG - Intronic
1119957086 14:78810214-78810236 TACGTGTGTCTGTCCCCGGAAGG + Intronic
1123391407 15:19877513-19877535 CAGGTGTGAGCTACCACGGAAGG - Intergenic
1125962234 15:43841161-43841183 TAGGTGTGTGCTACCACGCCTGG + Intronic
1134317128 16:13128836-13128858 TACGTGTGTTGTACCCATGATGG + Intronic
1140877562 16:79167081-79167103 CAGGTGTGTGCTACCACGGCCGG + Intronic
1144222078 17:13108629-13108651 CACGTGTGTGCTACCACATATGG + Intergenic
1148625690 17:49067396-49067418 TACGTCTGTCCCACCCCGAAGGG + Intergenic
1159827738 18:73235503-73235525 TACGTGTGTAATGCCCCGGTGGG - Intronic
1160888956 19:1366877-1366899 TACTTCTGTGCTGCCCCCGAGGG + Intronic
1160948180 19:1652863-1652885 CTCGTGTGTGCTTCCGCGGACGG - Intergenic
926017299 2:9465299-9465321 TACGTGTGTGCTACCGTGCCTGG - Intronic
932500050 2:72175256-72175278 TGCTTGTGTGCTAGCCTGGAGGG + Intergenic
932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG + Exonic
943599508 2:189898064-189898086 TACATGTGTGCTACCATGGGAGG - Intronic
1169368736 20:5012034-5012056 TAGGTGTGAGCTACCGCGGCTGG + Intergenic
1174312366 20:49667686-49667708 TAGGTGTGAGCCACCCCGCATGG + Intronic
958900605 3:99881673-99881695 TACATGTGTGCTACCACGCCTGG + Intronic
960536510 3:118821241-118821263 TATGTGTGTGCTCCCCCTGTTGG + Intergenic
962546840 3:136445001-136445023 TAGGAGTGTGCTACCCCGCCTGG + Intronic
962828862 3:139122320-139122342 TACTTGTGTGTTATCCCGGTGGG - Intronic
995368956 5:111396781-111396803 TAGGTGTGTGCTACCACGCCTGG + Intronic
1001932735 5:175684678-175684700 TACTTGAGTGCTATCCTGGAGGG - Intronic
1003328949 6:5113501-5113523 TACGTGGGTGCTGCCCTGAAGGG + Intronic
1004440924 6:15652898-15652920 TAGGTGTGTGCTACCACGCCAGG + Intronic
1041272714 8:56124602-56124624 TAGGTGTGTGCCACCACGGCAGG - Intergenic
1045503527 8:102761538-102761560 CAGGTGTGAGCTACCCCGGCTGG + Intergenic
1049162102 8:141104211-141104233 TAGGTGTGTGCCACCACGGCTGG + Intergenic
1049208410 8:141374135-141374157 GCAGTGTGTGCCACCCCGGAAGG - Intergenic
1053390490 9:37731728-37731750 TAGGTGTGTGCCACCACGGCTGG - Intronic
1056965082 9:91159001-91159023 TACGTGAATGCTACTCTGGAGGG - Intergenic
1057779634 9:98039089-98039111 TACGGGTGTGCTACTCTAGAGGG - Intergenic
1057856337 9:98603768-98603790 ATCTTGTGTGCTACCCTGGAAGG - Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1193360343 X:80573043-80573065 TACGTGTGTGCCACCCCTGACGG - Intergenic
1193723528 X:85015709-85015731 TAGGTGTGTGCCACCACGCACGG + Intronic