ID: 932831225

View in Genome Browser
Species Human (GRCh38)
Location 2:74991989-74992011
Sequence AACCATATAAAGTAACTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932831223_932831225 8 Left 932831223 2:74991958-74991980 CCTTTTTGGAAAAGAGGCAGGGA No data
Right 932831225 2:74991989-74992011 AACCATATAAAGTAACTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932831225 Original CRISPR AACCATATAAAGTAACTTCC CGG Intergenic
No off target data available for this crispr