ID: 932837310

View in Genome Browser
Species Human (GRCh38)
Location 2:75049653-75049675
Sequence CGCCGGCGACTATGAGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837310_932837322 29 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837310_932837318 -2 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837310_932837321 22 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837310_932837319 2 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837310 Original CRISPR CGCCGGCGACTATGAGGGGC TGG (reversed) Exonic
900208259 1:1440669-1440691 CGCCGAGGACTAGGCGGGGCGGG - Exonic
900354576 1:2254104-2254126 CTCCAGTGACCATGAGGGGCTGG + Intronic
901654566 1:10762055-10762077 CTCCGGGGACTCTGAGGGCCGGG - Intronic
903616979 1:24666873-24666895 CGCCGTCGAGGAGGAGGGGCGGG - Exonic
904245076 1:29181785-29181807 CGCCGCCGCCTAAGGGGGGCTGG - Exonic
904678475 1:32212802-32212824 CGCAGGGGACAATGAGGGGTGGG + Intronic
907523448 1:55039939-55039961 GGACGGCGACTACGAGGAGCTGG + Exonic
1064562025 10:16602919-16602941 AGCCGGCGGCTATCAGGGGCTGG + Intronic
1066565432 10:36717101-36717123 AGCCTGAAACTATGAGGGGCTGG + Intergenic
1073812331 10:107164588-107164610 CGCTGGCGGCTGTGGGGGGCCGG + Intergenic
1073921650 10:108466319-108466341 CGCTGGCGGCTGTGGGGGGCAGG + Intergenic
1077392982 11:2308473-2308495 GGCCGGTCACTATGGGGGGCTGG - Intronic
1077393006 11:2308541-2308563 GGCCGGTCACTATGGGGGGCTGG - Intronic
1077393030 11:2308609-2308631 GGCCGGTCACTATGGGGGGCTGG - Intronic
1089742267 11:120592769-120592791 CTCCTGCAACTCTGAGGGGCTGG + Intronic
1106533526 13:30617738-30617760 CTGCGGCGACGAGGAGGGGCGGG - Intronic
1107940565 13:45377813-45377835 AGCCGGGGAGGATGAGGGGCTGG + Intergenic
1107941155 13:45380357-45380379 AGCCGGGGAGGATGAGGGGCTGG + Intergenic
1114676139 14:24441634-24441656 CCCTGGCGAATATAAGGGGCTGG + Exonic
1117912654 14:60649541-60649563 CGGCGGCGCCTATCCGGGGCTGG + Intronic
1121803809 14:96797304-96797326 CGGAGGCGACGAGGAGGGGCGGG - Exonic
1131135689 15:89933476-89933498 AGCCGGGGAGTATTAGGGGCAGG + Intergenic
1138526510 16:57610885-57610907 TGCAGGCTCCTATGAGGGGCAGG - Intronic
1142200736 16:88760033-88760055 CGCTGGGGCCTTTGAGGGGCAGG - Intronic
1143007484 17:3846252-3846274 AGCCGGCGGCCGTGAGGGGCGGG - Intergenic
1145779355 17:27552149-27552171 CGCAGGCGAGAATGATGGGCAGG - Intronic
1151842142 17:76626341-76626363 CACCCGGGACTATGAGTGGCTGG - Exonic
1157996724 18:52566353-52566375 CGCCGGGGCCTATCAGGGGTTGG + Intronic
1160834940 19:1120173-1120195 AGCCGGCTACCATGGGGGGCGGG + Intronic
1168102098 19:54146733-54146755 CGCCGGCCACTGTGCTGGGCTGG + Intronic
932837310 2:75049653-75049675 CGCCGGCGACTATGAGGGGCTGG - Exonic
936005322 2:108882005-108882027 CGCCTGCCACTATGACTGGCTGG - Intronic
1179878922 21:44285487-44285509 TGCCGGCCACTGGGAGGGGCCGG + Intergenic
1182903726 22:33920053-33920075 CGCCGCCGCCTACGAGGCGCAGG + Exonic
969790501 4:9491127-9491149 CGGCGGGGGGTATGAGGGGCTGG - Intergenic
1002368470 5:178730697-178730719 CGCCGGGGACCAGGAGGGGCGGG + Exonic
1016982127 6:149863640-149863662 CGCCGGCGGCCGTGCGGGGCTGG - Exonic
1022923310 7:35037314-35037336 CAGCGGCGACTGTGAGGCGCGGG + Intronic
1035187662 7:157139031-157139053 GGCCGGCGTGGATGAGGGGCAGG + Exonic
1035670974 8:1417038-1417060 CGCCGGGGACAGTGTGGGGCGGG - Intergenic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1043542541 8:81280300-81280322 CGCCGGCGTCCATGAGGCGTGGG + Intergenic
1047665565 8:127087239-127087261 AGCCGTCGAGGATGAGGGGCGGG + Intergenic
1049749742 8:144277493-144277515 CCCCGGCCACTGTGAGGGGTCGG - Intronic
1053072036 9:35107475-35107497 CCCCGGCGCCTCCGAGGGGCTGG + Exonic
1056382226 9:86065629-86065651 CGCCGGCCACTCTCAGGTGCCGG + Intronic