ID: 932837311

View in Genome Browser
Species Human (GRCh38)
Location 2:75049657-75049679
Sequence TCAGCGCCGGCGACTATGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837311_932837321 18 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837311_932837322 25 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837311_932837319 -2 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837311_932837318 -6 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837311 Original CRISPR TCAGCGCCGGCGACTATGAG GGG (reversed) Exonic
912023635 1:105138874-105138896 ACAGAGCCGGCGGCTAAGAGAGG + Intergenic
1076358085 10:129867296-129867318 TCAGCGGCGCTGGCTATGAGAGG + Intronic
1077060353 11:615193-615215 TCAGCAGCGGCTGCTATGAGGGG - Exonic
1117895873 14:60485886-60485908 TCTGGGCCGGCGGCTCTGAGGGG - Intronic
1127754923 15:62082971-62082993 TCAGGGCCGGTGCATATGAGTGG - Intergenic
1138659993 16:58511236-58511258 GCAGGGCCGGCGACAGTGAGTGG - Intronic
1141720082 16:85751111-85751133 TCAGCGCCGCCCTCTAGGAGCGG - Intronic
1164855534 19:31517845-31517867 TCAAAGCCGGCGATTATGGGGGG - Intergenic
924962167 2:45576-45598 ACAGCGGCGGCGACGACGAGGGG - Exonic
928278255 2:29921449-29921471 TCAGCGCCCGCGGCTTTGGGTGG + Exonic
932416557 2:71576825-71576847 TCAGCGCCTGGGAGAATGAGGGG + Intronic
932837311 2:75049657-75049679 TCAGCGCCGGCGACTATGAGGGG - Exonic
946268555 2:218569293-218569315 TGGGCGCCGGCGTCGATGAGGGG + Intronic
1168809402 20:694404-694426 TCAACCCCGGCAACTATGATAGG - Intergenic
960664312 3:120094831-120094853 TAAGGGCCGGCGACTCTGATTGG - Intergenic
970200558 4:13600324-13600346 TAAGCACCGCCGACTTTGAGGGG - Exonic
999128420 5:149264269-149264291 TCAGCAGCGGGGAATATGAGAGG - Intergenic
1006827679 6:36948173-36948195 TCAGCGCCTGGCACAATGAGAGG + Intergenic
1009412197 6:63378802-63378824 TCAGAGGCGGGGACTGTGAGAGG - Intergenic
1012988734 6:105902989-105903011 TCTGCCCAGGCGACTATTAGGGG + Intergenic
1033152175 7:138924996-138925018 TCAGCGCTGGCTACTTGGAGTGG - Intronic
1043293859 8:78639548-78639570 TCAGCGCCGGCCACCATGCCCGG - Intergenic
1049749744 8:144277497-144277519 TCAGCCCCGGCCACTGTGAGGGG - Intronic
1198073961 X:133177122-133177144 TCATCATCGGCGAATATGAGCGG + Intergenic