ID: 932837312

View in Genome Browser
Species Human (GRCh38)
Location 2:75049658-75049680
Sequence ATCAGCGCCGGCGACTATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837312_932837321 17 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837312_932837319 -3 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837312_932837318 -7 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837312_932837322 24 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837312 Original CRISPR ATCAGCGCCGGCGACTATGA GGG (reversed) Exonic
917646383 1:177032780-177032802 ACCAGCGCCGGCGAGTATACAGG + Exonic
1077060354 11:615194-615216 ATCAGCAGCGGCTGCTATGAGGG - Exonic
1079457122 11:20645970-20645992 ATCAGAGCTGCTGACTATGAAGG + Intronic
1112352902 13:98651529-98651551 ATCAGCGATGTCGACCATGAAGG - Intergenic
1150168019 17:62963538-62963560 ATCAGCGCAGGGGACCATGTGGG + Intergenic
932837312 2:75049658-75049680 ATCAGCGCCGGCGACTATGAGGG - Exonic
948804566 2:240447890-240447912 AGCTGCGCCGGTGACAATGACGG - Intronic
953725723 3:45396494-45396516 ATCAGGACCTGAGACTATGACGG + Intronic
970200559 4:13600325-13600347 ATAAGCACCGCCGACTTTGAGGG - Exonic
985336988 4:188906289-188906311 ATCAGCGTCTGCCACTTTGATGG + Intergenic
1046999715 8:120561819-120561841 ATCAGCCCTGGCTACTATGTTGG + Intronic
1049749745 8:144277498-144277520 TTCAGCCCCGGCCACTGTGAGGG - Intronic
1050181799 9:2931112-2931134 ATCAGTCAAGGCGACTATGATGG + Intergenic