ID: 932837313

View in Genome Browser
Species Human (GRCh38)
Location 2:75049659-75049681
Sequence CATCAGCGCCGGCGACTATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837313_932837321 16 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837313_932837318 -8 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837313_932837319 -4 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837313_932837322 23 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837313 Original CRISPR CATCAGCGCCGGCGACTATG AGG (reversed) Exonic
1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG + Intronic
1112382195 13:98902360-98902382 CATCAGCGCCGGGGACGTGGTGG + Exonic
1124722375 15:32121206-32121228 CATCAGCTCCACCGACCATGTGG - Intronic
1135822048 16:25692975-25692997 CGTCAGCACCCCCGACTATGGGG + Exonic
1142967361 17:3589998-3590020 CATCAGCGCCAGGGACTCGGTGG - Exonic
1149599649 17:57885264-57885286 CAGCAGCGGCGGCGTCTATGAGG - Exonic
1150168018 17:62963537-62963559 TATCAGCGCAGGGGACCATGTGG + Intergenic
1164855536 19:31517847-31517869 CCTCAAAGCCGGCGATTATGGGG - Intergenic
927887554 2:26727980-26728002 CATCGGCTTCGGCGACTACGTGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
947749183 2:232523924-232523946 CTGCAGCGCCGGCGGCGATGCGG + Exonic
1169478071 20:5950327-5950349 CATCCGCGACGGCGACTTCGTGG - Exonic
1172008631 20:31833828-31833850 CTTCAGCCCCGGCCACTGTGTGG - Exonic
1185243088 22:49756796-49756818 CATCAGGGCAGGCAACTCTGAGG - Intergenic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG + Intronic
1048356345 8:133657031-133657053 CATCAGAACCTGTGACTATGTGG - Intergenic
1049749746 8:144277499-144277521 CTTCAGCCCCGGCCACTGTGAGG - Intronic