ID: 932837317

View in Genome Browser
Species Human (GRCh38)
Location 2:75049670-75049692
Sequence TGCTGCCCCTTCATCAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837317_932837322 12 Left 932837317 2:75049670-75049692 CCGGCGCTGATGAAGGGGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837317_932837321 5 Left 932837317 2:75049670-75049692 CCGGCGCTGATGAAGGGGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837317 Original CRISPR TGCTGCCCCTTCATCAGCGC CGG (reversed) Exonic
903959435 1:27047447-27047469 TGCTGCCCCTACCCCAGGGCAGG - Intergenic
906394660 1:45451536-45451558 AGCTGCCCCTTCACCACCCCGGG - Intronic
915096742 1:153468333-153468355 TTCTGCCCCTCCGTCAGCCCAGG + Intergenic
916236089 1:162590427-162590449 TGATGTCCCTTCATCATTGCTGG + Exonic
922195213 1:223353730-223353752 TGCTGCCCCTTCCTCTGTCCTGG - Intronic
923203818 1:231738965-231738987 TACTGCCCCTGCCTCAGCCCTGG + Intronic
923765636 1:236890242-236890264 TGCTGCCCCTGAATCATCACAGG + Intronic
1069813570 10:71179680-71179702 TGCTGCCCCCACAGCAGGGCTGG - Intergenic
1070766041 10:79056974-79056996 TGCTGTCCCTTCTGCAGCCCAGG + Intergenic
1072501671 10:96024009-96024031 AGCTGCCTCTTCCTCAGCTCAGG + Intronic
1075085189 10:119410011-119410033 TGCTGCTCCTGCAGCTGCGCCGG + Intronic
1076672877 10:132132796-132132818 TGCTACCCCTTCCCCAGCCCAGG - Intronic
1077800107 11:5528569-5528591 TAATGTCCCTTCATCAGCCCAGG + Intronic
1079136048 11:17776603-17776625 TGCTGCCATTTCATCACTGCAGG + Intronic
1081460910 11:43272285-43272307 AGCTGTCCCTTCATCATCACTGG - Intergenic
1083324996 11:61868800-61868822 TGCTGCTCCGTCATCATCTCTGG + Intergenic
1083671826 11:64304233-64304255 AGCTGGCCCTTTATCACCGCTGG - Intronic
1084412872 11:69014196-69014218 AGCTGCCCCTGCACCTGCGCTGG + Intergenic
1084548188 11:69824978-69825000 TTCGGCCCCTTCCTCAGCTCAGG - Intergenic
1089311244 11:117559733-117559755 CTCTGCCCCTTCTTCAGCCCAGG - Intronic
1090889160 11:130907760-130907782 TGCTGCCTCTGCAGCACCGCAGG + Intronic
1091348278 11:134870588-134870610 TGCTACCCCTTCTTGAGGGCAGG + Intergenic
1091409455 12:229619-229641 TACTGCCCCTTCATGAGGTCGGG + Intronic
1099691218 12:85954501-85954523 GTCTGCCCCTACATCAGTGCAGG + Intergenic
1100167116 12:91928640-91928662 TCCTCCCCCTTCATCAGCTTGGG - Intergenic
1101394602 12:104334793-104334815 TGCTGCCCCCTCATCTTCACTGG + Intronic
1101759261 12:107645632-107645654 AGCTCCCCCTTCATGAGCACTGG - Intronic
1101836671 12:108300610-108300632 TGCTTCCCATCCATCAGGGCTGG + Intronic
1103563642 12:121804849-121804871 TGATGCCCCTTTTTCAGAGCCGG - Exonic
1107817411 13:44256458-44256480 TGCTGCCCCTTATTCCCCGCGGG + Intergenic
1110560821 13:76909171-76909193 TGCTCCCTCTTCATCACTGCAGG + Intergenic
1111561281 13:89951558-89951580 TGTTGCCCTTTCCTCAGCGCGGG - Intergenic
1113112537 13:106839186-106839208 TGCTGCCTCTTCCTCAATGCTGG - Intergenic
1119759607 14:77141359-77141381 TGCTGTCCCTTCTCCCGCGCAGG - Intronic
1121004472 14:90480107-90480129 TGCTGCCTCTTGATCAGCAGAGG + Intergenic
1121604143 14:95228018-95228040 TCCTGCCCCTTTCTCAGGGCAGG - Intronic
1122444544 14:101760108-101760130 TGCAGCTCCTTCATCATCACAGG + Intergenic
1122687245 14:103515192-103515214 TGCAGCCCCTTCACCACAGCAGG + Intergenic
1124095081 15:26641768-26641790 TGATGCCACTTCATTAGTGCAGG - Intronic
1124614878 15:31234306-31234328 TTCTGCCCCTTCCTCAGCAAGGG - Intergenic
1125201776 15:37106725-37106747 TCCTACCCCTACTTCAGCGCAGG + Intergenic
1125513817 15:40307106-40307128 GGCTGCCCCCACAGCAGCGCAGG + Intronic
1126164661 15:45644653-45644675 TTCTGCCCCTTCACCTACGCAGG - Intronic
1129165143 15:73772829-73772851 TGCATCCCCTTCATCAGCCTGGG + Intergenic
1129680801 15:77657406-77657428 TGTGGCCCCTTCACCAGCTCAGG + Intronic
1132469542 16:94327-94349 TTCTGCCTCTGCATCAGCCCAGG + Intronic
1132495463 16:261194-261216 TGCTGCTCCTTCACGAGCACAGG + Intronic
1136025232 16:27464474-27464496 TTCTGCCCCATCTTCAGCTCCGG + Exonic
1137564694 16:49525605-49525627 TGCAGTCCCTTCACCAGCCCCGG - Intronic
1138176199 16:54900473-54900495 AGCTGCCCCTTCATCATAACAGG + Intergenic
1138229877 16:55329057-55329079 GGGTGCACCTTCAACAGCGCTGG - Exonic
1138756218 16:59489029-59489051 CACTGCCTCTTCATCAGCTCTGG - Intergenic
1140480302 16:75258859-75258881 TGCTGCGCCTGCCCCAGCGCTGG - Intronic
1142753614 17:2002789-2002811 TGCTGCCCCTGCCTCCTCGCCGG - Intronic
1144463745 17:15479950-15479972 TGGTGCCCTTTCATCTGGGCTGG - Intronic
1146370692 17:32264262-32264284 AGCTGCCTCTTCATCAGCCCAGG - Intergenic
1148341900 17:46878263-46878285 TGCTGACCCTTCACCAACACAGG + Intronic
1157394785 18:47332431-47332453 TGCAGCCCCTTCAACAGTGAAGG + Intergenic
1161534678 19:4811802-4811824 TGGTGCCCCAGCATCAGCCCTGG + Intergenic
1162128357 19:8511304-8511326 ACCTGCGCCTTCATCTGCGCCGG - Intronic
1164479343 19:28599326-28599348 GGCAGCCTCTTCATCAGCGATGG + Intergenic
1166141560 19:40808035-40808057 TGCTGCCCCATCATGGGGGCTGG + Exonic
1166938973 19:46351607-46351629 AGCTGCCCCATCAGGAGCGCGGG + Intronic
1167112421 19:47470119-47470141 TACTGCCCCAGCATGAGCGCAGG + Intronic
926316503 2:11714311-11714333 TGCAGCCCCTTCAGCATCTCTGG + Intronic
927444604 2:23147963-23147985 TGATGCCCCTTGATGAGTGCTGG - Intergenic
927517326 2:23680024-23680046 TGCTGCCCCTTCAGCCCCGAAGG + Intronic
930716534 2:54598735-54598757 TGCTGCCTCTTCAGCAGGGATGG + Intronic
931217448 2:60259945-60259967 TGCTGCTTCTTCATCACAGCTGG + Intergenic
932675455 2:73776836-73776858 TACTGCTACTTCATCAGCACAGG + Intronic
932837317 2:75049670-75049692 TGCTGCCCCTTCATCAGCGCCGG - Exonic
932860914 2:75290352-75290374 TGCTGCCCCATCATGAACCCTGG - Intergenic
937277100 2:120692120-120692142 TGCTGGCCCTTCTGCTGCGCTGG + Intergenic
937910227 2:127072068-127072090 AGCTGCCCCTCCTTCAGGGCAGG - Intronic
943583068 2:189706962-189706984 TGCTGCCACTTCAGGAGCACTGG + Exonic
946047583 2:216833996-216834018 TGCCGCCCCTACATGAGCTCTGG - Intergenic
948624679 2:239261729-239261751 TGCTGCCCCTTCCTCCCCGTGGG - Intronic
949047872 2:241880442-241880464 TGGTGCCCCTTGATTGGCGCTGG - Intergenic
1169388316 20:5169372-5169394 TGGTGCCCCTGCAGCAGCCCTGG - Intronic
1173727070 20:45305532-45305554 TGCTGCTCCTTCTTCAGCCCTGG - Exonic
1174104114 20:48149968-48149990 TGCGTCCCCTAAATCAGCGCTGG - Intergenic
1174295422 20:49542111-49542133 TGCTGCCCCTTGAGCAGGTCAGG - Intronic
1175024137 20:55883339-55883361 TGCTTCCCCTTCATCTGTCCTGG + Intergenic
1175234311 20:57499367-57499389 TGCTCCCCCTCCAGCAGCTCAGG + Intronic
1180170778 21:46057119-46057141 TGCTGCCCCTTCCCCAACCCGGG + Intergenic
1184291839 22:43501533-43501555 TGCTGCCCTTGCATCATCTCCGG + Intronic
1184439273 22:44498487-44498509 TGCGGCGTCTTCATCAGGGCGGG + Intergenic
1184460516 22:44635204-44635226 TGATGCCCTTGCATCAGGGCAGG + Intergenic
1185351266 22:50340724-50340746 TGCTGTCCCTGCATCCCCGCAGG - Intergenic
952981657 3:38741048-38741070 TGCTGCCCCTTTCACAGCCCTGG + Intronic
956451232 3:69377445-69377467 TGCTGCCCTTGCTTCAGTGCAGG + Intronic
960936763 3:122909302-122909324 TGCTGGCCCTTCATCTGTTCAGG - Exonic
962347032 3:134625905-134625927 TGCTGGCCCTGCATCAGCACTGG - Intronic
966821981 3:183932130-183932152 TGCTGCCCTGTCATCTGTGCTGG + Intronic
968532928 4:1104720-1104742 TGCTGCCCCAGCATCTGAGCTGG - Intronic
992107509 5:73462147-73462169 TGATGCCACTTCATCAGGGCTGG + Intergenic
992448026 5:76851186-76851208 TGCTGCCCATTCCTCTGCTCAGG - Intronic
999014404 5:148084348-148084370 TGCTGCCACTTCACCAGGTCAGG + Intronic
1003109070 6:3238476-3238498 AGCTGCCCCTTCTCCAGCGGCGG + Intronic
1003399840 6:5782454-5782476 TGCAGCCACCTCATCAGAGCAGG - Intergenic
1019621619 7:1995265-1995287 CGCTGCCCGTTCACCAGCTCAGG - Intronic
1023738637 7:43257515-43257537 TGCTACCCCTCCATCAGAGTGGG - Intronic
1026872780 7:73863262-73863284 TGGAGACCCTTCATCAGAGCTGG - Intronic
1032433325 7:131880484-131880506 TGCTGCCCCCTCCTCATCTCAGG + Intergenic
1033012283 7:137635387-137635409 TGCTGCCCCTTCTAAAGCGGAGG - Intronic
1034520518 7:151615876-151615898 TGCTGCACCTTCAACACCACTGG + Intronic
1038456377 8:27674373-27674395 TGCTGGCCCTTCATCACTGTGGG + Intronic
1039618165 8:38973707-38973729 TGCTACCCCTTCATAAGCAGAGG - Exonic
1042741956 8:72059044-72059066 CGGTGCCCCTTCTTCAGCCCTGG - Intronic
1049447845 8:142639639-142639661 TGCTGCTCCACCATGAGCGCTGG - Intergenic
1051578131 9:18640798-18640820 TGCTGCCACTGCGTTAGCGCAGG + Intronic
1053869408 9:42474439-42474461 TTCTGCCCCTAAATCAGTGCTGG + Intergenic
1057266347 9:93620339-93620361 TGCTGCCCCTGCCCCAGCGTGGG - Intronic
1060976558 9:127768342-127768364 TGTTGCCCCTTCCCCAGCCCTGG - Intronic
1061042918 9:128150078-128150100 TCCTGCCCCTTCACCAGTGCAGG + Intronic
1062568123 9:137172235-137172257 TGCTGCCTCTGCCTCAGAGCTGG - Exonic
1062582144 9:137233471-137233493 CGCTGACCCTCCATCAGGGCAGG - Intronic
1062717148 9:138016719-138016741 TGCTGCCCCATCTTGAGGGCCGG + Intronic
1187663749 X:21579864-21579886 TGCTGCCACTTCTTCAGAACTGG - Intronic