ID: 932837318

View in Genome Browser
Species Human (GRCh38)
Location 2:75049674-75049696
Sequence CGCTGATGAAGGGGCAGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837312_932837318 -7 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837310_932837318 -2 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837308_932837318 15 Left 932837308 2:75049636-75049658 CCGGGTGGATTTCATTTCCAGCC 0: 1
1: 0
2: 0
3: 18
4: 203
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837311_932837318 -6 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139
932837313_932837318 -8 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837318 Original CRISPR CGCTGATGAAGGGGCAGCAC CGG Exonic
903450845 1:23452709-23452731 GTCTGATGAAGGGGCAGCTGAGG - Exonic
904174232 1:28614597-28614619 CGCTGAAGCCGGGGCAGCAGAGG + Intronic
906959676 1:50411364-50411386 TGATTATAAAGGGGCAGCACAGG + Intergenic
907408691 1:54269842-54269864 TTCTAATGAAGGGGCACCACTGG + Intronic
912587142 1:110777498-110777520 CACTCAGGAAGGGGCAGCAGCGG - Intergenic
912879155 1:113391044-113391066 CGCTGAAGAAGAAGAAGCACTGG + Exonic
913238604 1:116807510-116807532 CGCTGATGCAGTGCCAGCAGGGG - Intergenic
915306601 1:154983372-154983394 AGCCGGTGAAGGGGCAGAACAGG + Exonic
917164932 1:172101126-172101148 CGCTGGAGAAGGTGCATCACAGG + Intronic
922748564 1:228060392-228060414 GGCTGAGGAAGGGGTGGCACAGG - Exonic
923166624 1:231370311-231370333 CTCTGAAGAAAGGGAAGCACAGG - Intronic
1067728221 10:48789756-48789778 TGCTGATGGAGTGTCAGCACTGG + Intronic
1068063262 10:52096315-52096337 ATCTGATGAATGGGTAGCACTGG + Intronic
1069453726 10:68537378-68537400 CTCTGCAGTAGGGGCAGCACTGG + Intergenic
1073284095 10:102376808-102376830 AGCTGATGAGGGGGCAGCTGGGG + Intronic
1075336098 10:121609708-121609730 GCCTGATGAAAGGGCAGGACAGG - Intergenic
1076672878 10:132132800-132132822 GGCTGGGGAAGGGGTAGCACTGG + Intronic
1077024710 11:433964-433986 CGCAGGTGAAGGGGCAGAGCAGG + Intronic
1077790088 11:5429668-5429690 GGCTGAGGAAGGGGCAGGATGGG + Intronic
1081524243 11:43913938-43913960 CCCAGAAGAGGGGGCAGCACTGG + Intronic
1083102632 11:60326097-60326119 CTTTGCTGGAGGGGCAGCACAGG + Intergenic
1083761671 11:64822035-64822057 GGCTGATGAAGAGGGAGCAGGGG - Intergenic
1088113930 11:106295321-106295343 CTCTGAGGAAGGGGCATCTCTGG + Intergenic
1088861401 11:113803206-113803228 TGCTGATGAAGGGGCCCCGCCGG - Exonic
1089582634 11:119490953-119490975 CGGTGCTGGAGGAGCAGCACAGG - Intergenic
1091310884 11:134574482-134574504 CACTGCTGAAGGCACAGCACTGG + Intergenic
1091505481 12:1063359-1063381 GGCTGAGGCAGGGGCATCACTGG - Intronic
1093551165 12:20413430-20413452 GGCTGAGGAAGGGGCTTCACTGG + Intronic
1096103347 12:48982293-48982315 CACTGATGAGGAGGCAGGACAGG - Intergenic
1104437358 12:128766647-128766669 AGCTGATGAGGGGGCAGCCCGGG - Intergenic
1105656960 13:22452167-22452189 CTCTGATGATGGGAAAGCACTGG - Intergenic
1107620501 13:42224229-42224251 CACTGGAGAAGGGGCAGAACAGG - Intronic
1108061903 13:46541577-46541599 AAGTGATGAAGGGGCAGCATTGG - Intergenic
1113785820 13:113001695-113001717 CCCTGATTAAGGAGCAGCATCGG - Intronic
1114405370 14:22451311-22451333 GGCTGAGGAAGGGGAAGGACAGG + Intergenic
1116887090 14:50231851-50231873 TGCTGCTAAAGGGGCAGCAACGG - Intergenic
1118475113 14:66109351-66109373 CTCTGAGGAAGGAGCAGCCCAGG + Intergenic
1119472145 14:74906921-74906943 CGCTGATAGAGGGCCAGCCCTGG + Exonic
1122849858 14:104522309-104522331 CACTGATGAATGGGCAGTCCTGG - Intronic
1123479013 15:20613987-20614009 TGCAGAGGCAGGGGCAGCACGGG + Intergenic
1123638999 15:22386398-22386420 TGCAGAGGCAGGGGCAGCACGGG - Intergenic
1124906675 15:33875142-33875164 CGCTGATGTGGGAGCAGAACAGG + Intronic
1127262811 15:57338296-57338318 CGGTGCTCACGGGGCAGCACTGG + Intergenic
1128063595 15:64750437-64750459 GGCTGATGAGGTGGCAGCGCTGG - Intronic
1128377297 15:67086319-67086341 TGCTGATGAAGTGGCAGGACAGG - Intronic
1129809909 15:78501882-78501904 CACTAATGAACGGGCAGCACAGG - Intergenic
1132353933 15:101157821-101157843 TGCTCAGGAGGGGGCAGCACTGG + Intergenic
1133223403 16:4328695-4328717 TGCTGATGAAGGGGGTGCATTGG + Intronic
1133532098 16:6664852-6664874 AGCTGGTGAAGGGGCAGAACCGG - Intronic
1136064879 16:27751912-27751934 GGCTGATGAACGGGTAGGACTGG + Exonic
1136120970 16:28133929-28133951 TGCTGCTGTAGGGGAAGCACAGG + Exonic
1137870720 16:51947610-51947632 CTCAAACGAAGGGGCAGCACTGG + Intergenic
1138535242 16:57656493-57656515 CACTGAGGAGGGGACAGCACGGG - Exonic
1138558306 16:57785683-57785705 GGCTGATGAGAGGGCAGCAGAGG + Intronic
1141864518 16:86740958-86740980 CACGGTTGAAGGGGCTGCACTGG - Intergenic
1143091869 17:4453658-4453680 CAGTGAAGAAGGGGCAGAACTGG + Intronic
1143097558 17:4486483-4486505 CGATGACAAAGGCGCAGCACAGG - Exonic
1143108829 17:4542462-4542484 ACCTGATGACGGGGCCGCACCGG + Exonic
1144360583 17:14487815-14487837 GGCTGATGCAGGAGCATCACTGG + Intergenic
1147566769 17:41541243-41541265 CGATGATGGTGGGGCAGCAGAGG - Intergenic
1150075833 17:62191354-62191376 CTCTGAGGAAGGAGAAGCACTGG + Intergenic
1152815899 17:82407631-82407653 CGATGAGGAAGGGGCAGCAGTGG - Intronic
1160792616 19:929554-929576 CGCTGTTGCAGCGGCAGCAGCGG + Exonic
1163366225 19:16877500-16877522 CCCTGCTGTAGGGGCATCACGGG + Intronic
1163832624 19:19554344-19554366 CGGTGAGGACGGGGCAGCTCAGG + Intergenic
1164056268 19:21624516-21624538 CCCTGTTGAAGGGGCCCCACAGG - Intergenic
1165316736 19:35060531-35060553 CGCTGATGATGGGGAGGCAGAGG + Intronic
1165463565 19:35958995-35959017 CCGTGATGAAGCGGCAGCCCTGG - Intergenic
1166868082 19:45853189-45853211 GGCTGATGAAGGAGCCGAACGGG + Intronic
1168563757 19:57405342-57405364 CACAGGTGATGGGGCAGCACGGG - Intronic
925102926 2:1264794-1264816 GGCTGAGGCAGGGGCATCACTGG - Intronic
926116522 2:10217207-10217229 CGCAGATGAAAGAGCAGCTCTGG + Intergenic
932086396 2:68766376-68766398 TGCTGAGGAAGAGGCAGCTCTGG + Intronic
932837318 2:75049674-75049696 CGCTGATGAAGGGGCAGCACCGG + Exonic
939032955 2:137098515-137098537 CTGTGATGAGGGGTCAGCACAGG + Intronic
942939312 2:181598043-181598065 CGCTGTTGAAGACGCAGCAGTGG + Intronic
944560826 2:200935818-200935840 GGATGATGAAGGGGTTGCACAGG - Exonic
945100679 2:206259876-206259898 CGCAGCTGAAGGGGCAGCGAAGG - Intergenic
948515011 2:238498285-238498307 CTCTGATGAAGGGGAGGCAGGGG + Intergenic
948624681 2:239261733-239261755 CGGGGAGGAAGGGGCAGCAGTGG + Intronic
1173948929 20:46975114-46975136 TGCCTATGAAGGAGCAGCACAGG + Intronic
1175320805 20:58086906-58086928 CTCTGAGGAAGGGGTAGCATCGG - Intergenic
1177917982 21:27114663-27114685 TGCTGATGCAGGAGCAGAACTGG + Intergenic
1179966269 21:44807909-44807931 CGCTGAGGCAGTGGCAGCTCTGG - Intronic
1180017434 21:45096502-45096524 GGATGATGAAGGGGGAGCACTGG - Intronic
1180170775 21:46057115-46057137 GGTTGGGGAAGGGGCAGCACGGG - Intergenic
1182162385 22:28135961-28135983 CACTGATGAAGGGTCAGTTCTGG + Intronic
1182565501 22:31195544-31195566 CTCTATGGAAGGGGCAGCACTGG + Exonic
1182649641 22:31840774-31840796 CTCTGATGAATAAGCAGCACAGG - Intronic
1184667534 22:45996731-45996753 TGCTGAGGAAGGGGAAGCCCAGG + Intergenic
1184770656 22:46594789-46594811 CCCTGGGGGAGGGGCAGCACGGG + Intronic
1185213586 22:49585980-49586002 CGCTGATGACCGGTCAGCCCCGG - Intronic
950486663 3:13277996-13278018 CACTGATGAGGGGGCAGCAGCGG - Intergenic
952635602 3:35526050-35526072 CGCTGTTGAAGTGACAACACAGG - Intergenic
953749118 3:45595916-45595938 CGAGGATGACGGGGCAGAACTGG - Exonic
956425129 3:69126508-69126530 AGCTGTTGAGGTGGCAGCACTGG - Intergenic
957984411 3:87554645-87554667 CACTGATAAAGAAGCAGCACAGG - Intergenic
958432856 3:94062755-94062777 CGCAGAAGCAGGGGCCGCACAGG + Intronic
965454004 3:168874910-168874932 CGCTGAGGCAGGGGAATCACTGG - Intergenic
966974299 3:185071149-185071171 CGCAGATGCAGGGGCACCAGGGG - Intergenic
968897377 4:3412604-3412626 GGCTGGTGAAGGGGCAGGAGGGG + Intronic
973676504 4:53268682-53268704 GGCAGAGGCAGGGGCAGCACAGG + Intronic
973870289 4:55159448-55159470 CGCTGAAGATCTGGCAGCACAGG + Intergenic
974350912 4:60744910-60744932 CCCTGATCAAGGAGCTGCACAGG - Intergenic
985822334 5:2168908-2168930 CCCTGATGAAGGGACATCCCTGG + Intergenic
986473331 5:8097467-8097489 CGCTGATGAAGGTATAACACTGG - Intergenic
990240579 5:53812565-53812587 AGCTGATGAAGTGACAGAACTGG - Intergenic
995661307 5:114486307-114486329 AGCTGATAAAGGGCCAGCAAGGG - Intronic
997792539 5:136773736-136773758 CCCAGATGAAGGGGAAACACTGG + Intergenic
1002075517 5:176706015-176706037 CCCTGATGAATGGGCAGCTCTGG + Intergenic
1003109068 6:3238472-3238494 CGCTGGAGAAGGGGCAGCTCTGG - Intronic
1005011559 6:21340719-21340741 CCCTGGTGAAGGTGCAGCATGGG - Intergenic
1005810826 6:29514707-29514729 GGGTGAGAAAGGGGCAGCACAGG - Intergenic
1007664959 6:43508619-43508641 CTCTCAGGAAGGGGCAGGACGGG - Intronic
1007964314 6:45989526-45989548 CGATGTTGTAAGGGCAGCACTGG - Intronic
1009306691 6:62099609-62099631 CCCTGGTGAAGGGCCAGCACTGG + Intronic
1019529467 7:1496260-1496282 CGCTCCTGCAGGTGCAGCACGGG + Exonic
1021806203 7:24358461-24358483 CGAGGAGGAAGGGGCAGGACAGG + Intergenic
1024055753 7:45658992-45659014 CCCTGTAGATGGGGCAGCACAGG + Intronic
1028328449 7:89557936-89557958 AGCTGATGCAGGAGCATCACTGG + Intergenic
1028848683 7:95512064-95512086 CCCTGATGAAGGGGAAGCACAGG + Intronic
1029441066 7:100586839-100586861 CGCAGCTGAAGGGGCAGCGGGGG + Intronic
1031744295 7:125473966-125473988 ACCTGATGAAAGGGCTGCACTGG + Intergenic
1032720563 7:134547759-134547781 CTCAGCTGAAGGGACAGCACAGG - Intergenic
1034855893 7:154547046-154547068 CACTGTTGAATGGGAAGCACAGG + Intronic
1036188039 8:6642354-6642376 TGCTGCTGAAGGGTCAGCACAGG - Intronic
1036227116 8:6969014-6969036 AGCTGATGAAGCTGCAGCCCAGG - Intergenic
1036229556 8:6988175-6988197 AGCTGATGAAGCTGCAGCCCAGG - Intergenic
1036232007 8:7007278-7007300 AGCTGATGAAGCTGCAGCCCAGG - Intronic
1036809967 8:11861166-11861188 CCCTGATGAACGGGCACCAGAGG + Intronic
1037837021 8:22220525-22220547 AGCTGAGGAAGGGGCACCTCTGG + Exonic
1039896570 8:41720698-41720720 CCCTGATGAAGGAGGGGCACTGG + Intronic
1042998862 8:74732831-74732853 CACTGATGAATGGGCAGAAGAGG + Intronic
1044176087 8:89124535-89124557 GGCTGATGAATTGGCTGCACAGG + Intergenic
1045271752 8:100668079-100668101 TGCTGATGGAGGGGCTGTACGGG + Intergenic
1047750120 8:127874237-127874259 CACTGGAGAAGGGGCAGCAGTGG + Intergenic
1048528855 8:135229208-135229230 GGTTGATGAAGAGGAAGCACAGG - Intergenic
1049719809 8:144110573-144110595 CACTGGTGAGGGGGCAGCATGGG + Exonic
1051365121 9:16316475-16316497 CGCTCAAGAAGGGGAAGAACTGG - Intergenic
1055924678 9:81497446-81497468 GCCTCATGAAGGGGGAGCACTGG - Intergenic
1056135331 9:83624638-83624660 AGCTGAGGAAAGGGCAGGACAGG + Intronic
1057169753 9:92954592-92954614 CCCTGAGGAAGGAGCAGCTCTGG - Intronic
1057214580 9:93220796-93220818 GTCTGATGCTGGGGCAGCACGGG - Intronic
1057518042 9:95738114-95738136 CCCTGATGAAGAGGCAGCCCCGG - Intergenic
1060976559 9:127768346-127768368 GGCTGGGGAAGGGGCAACACAGG + Intronic
1062004741 9:134233500-134233522 TGCTGAGGAATGGGCTGCACCGG - Intergenic
1186763971 X:12752028-12752050 AGCTGATTAAAGGGCAGAACTGG - Intergenic
1187899354 X:24012739-24012761 AGCTGATGTGGGGGCAGAACTGG - Intronic
1188505389 X:30877077-30877099 TCCTGATGGAGGGGCAGCAGGGG + Intronic
1190308561 X:49101066-49101088 CGCCCGTGAAGGGGCAGGACAGG - Exonic
1192154303 X:68732399-68732421 CTGTGATGACAGGGCAGCACTGG - Intergenic
1197181173 X:123538883-123538905 CCCTGATGCTGGGGCAGAACTGG + Intergenic
1199494886 X:148441804-148441826 AGCTGCTGATGGGACAGCACAGG + Intergenic