ID: 932837319

View in Genome Browser
Species Human (GRCh38)
Location 2:75049678-75049700
Sequence GATGAAGGGGCAGCACCGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837313_932837319 -4 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837311_932837319 -2 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837310_932837319 2 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837308_932837319 19 Left 932837308 2:75049636-75049658 CCGGGTGGATTTCATTTCCAGCC 0: 1
1: 0
2: 0
3: 18
4: 203
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156
932837312_932837319 -3 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837319 Original CRISPR GATGAAGGGGCAGCACCGGA AGG Exonic
901822401 1:11838468-11838490 CATGAAGAGGCAGCTCCGCATGG - Intronic
902305041 1:15530503-15530525 GATGGAGGGGGAGCAGCAGAAGG + Intronic
902630370 1:17701216-17701238 GATGAAGGTGGAAGACCGGAAGG + Intergenic
902670665 1:17971103-17971125 GATGAAGGGACACCACAGGATGG + Intergenic
903471148 1:23588232-23588254 GAAGAAGGGGCTGCTCTGGAGGG + Intronic
904285702 1:29452150-29452172 GGTGAAGGGGCAGCGCATGATGG - Intergenic
905262374 1:36729011-36729033 GATGAAGGGCCAGGACAGCAAGG + Intergenic
907272191 1:53297650-53297672 AATGAAGAGGCTGCAGCGGAAGG + Intronic
907408455 1:54268453-54268475 GGTGAAGGGGCAGGGCAGGAAGG - Intronic
907408692 1:54269846-54269868 AATGAAGGGGCACCACTGGTAGG + Intronic
914984601 1:152445407-152445429 TATAAAGGGGCAGAACGGGAAGG - Intergenic
915171142 1:153977923-153977945 GATGAAGGGGCGGCTGGGGAAGG - Intergenic
915306603 1:154983376-154983398 GGTGAAGGGGCAGAACAGGCAGG + Exonic
923537200 1:234862477-234862499 AATGAAGGGGCAGCCAGGGATGG + Intergenic
1067660281 10:48232217-48232239 GCTGAACGGGCAGCACCTGGAGG - Exonic
1067763826 10:49070509-49070531 GGTGAAGGGGCACCCCAGGAAGG + Intronic
1069571537 10:69497340-69497362 GATGAAAGGGCGGCACAGGCTGG - Intronic
1069825130 10:71250195-71250217 AATGAAGGGGCAGTGCCGGTGGG + Intronic
1072834339 10:98695206-98695228 GAAGAAGGGGAAGGACAGGATGG + Intronic
1073464388 10:103685576-103685598 GAATAGGAGGCAGCACCGGAGGG - Intronic
1076562468 10:131376124-131376146 GATGAGGGGGCAGGAGCGGGAGG + Intergenic
1076712433 10:132345738-132345760 GATGGAGGGGCAGAACCGTCAGG + Intronic
1079914759 11:26355025-26355047 GATGAAGGGGCATCTTCAGAGGG - Intronic
1080658472 11:34276541-34276563 GATGAAATGGCAGGCCCGGATGG - Intronic
1080752666 11:35165293-35165315 GTTGAAAAGGCAGCACCAGAGGG + Intronic
1083319883 11:61839057-61839079 GAGGCAGGGGCAGGGCCGGACGG - Intronic
1083761670 11:64822031-64822053 GATGAAGAGGGAGCAGGGGAAGG - Intergenic
1084010057 11:66342783-66342805 GATGAAGGAGCTGGACCGGTAGG - Intronic
1084622708 11:70284204-70284226 GATGAGGGGGCACCATCTGAAGG - Intronic
1088786903 11:113190472-113190494 GGAGAAGGGGCAGCAGCAGATGG - Intronic
1088861397 11:113803202-113803224 GATGAAGGGGCCCCGCCGGGGGG - Exonic
1090113540 11:123941985-123942007 GATGAGGGTGCAGCAACAGAGGG + Intergenic
1091409451 12:229611-229633 CATGAAGGGGCAGTACCCGTGGG - Intronic
1091718605 12:2796154-2796176 GATGAGGACGCAGCAGCGGATGG - Intronic
1092159830 12:6310306-6310328 GAGGCAGGGGGAGGACCGGACGG + Intergenic
1096103346 12:48982289-48982311 GATGAGGAGGCAGGACAGGAAGG - Intergenic
1096228044 12:49881894-49881916 GTGGAAGGGGCAGCACCTGAGGG - Intronic
1096525534 12:52207901-52207923 GGTGAGGGGGCAGCACGGGGAGG + Intergenic
1101311711 12:103586747-103586769 TGTGGAGGGGCAGCACAGGAAGG + Intergenic
1105253012 13:18717595-18717617 GATTTAGCGGCAGCTCCGGAAGG + Intergenic
1106100943 13:26694869-26694891 GAGGAAGGGACAGCCCCTGATGG - Intergenic
1108373263 13:49792015-49792037 GCAGAGGGGGCTGCACCGGACGG + Intronic
1110522472 13:76497007-76497029 GATGCAGGGCCAGCAGTGGATGG - Intergenic
1113173182 13:107529765-107529787 GAGGAACGGGCATCACCTGAAGG + Intronic
1114260370 14:21032220-21032242 GGAGAAGAGGCAGCACAGGAGGG + Intronic
1114967563 14:27982190-27982212 AATGAATGGGCAGGACTGGAAGG + Intergenic
1117872425 14:60215194-60215216 GGTTAAAGGGCAGCACCGAATGG - Intergenic
1119134035 14:72200565-72200587 GATGAGGGGGCAGCACAGGACGG + Intronic
1119711863 14:76828207-76828229 GATGGAGGGGCGGCAGCGGCAGG + Intronic
1123064000 14:105606985-105607007 GGGAAAGGGGCAGCACCGTAGGG - Intergenic
1123073314 14:105652628-105652650 GGGAAAGGGGCAGCACCGTAGGG - Intergenic
1125721549 15:41847465-41847487 GAGGAAAGTGCAGCACCGCAGGG - Exonic
1128530391 15:68441297-68441319 GATGAAGGGGAAGTAGAGGATGG - Intergenic
1130671824 15:85919683-85919705 GAGGAAGGGGCAGCAAGGAAAGG - Intergenic
1131049274 15:89335481-89335503 GACGAGGAGGCAGCACCGGATGG - Intergenic
1131667738 15:94588151-94588173 GAGGGATGGGCAGAACCGGATGG + Intergenic
1132353935 15:101157825-101157847 CAGGAGGGGGCAGCACTGGAGGG + Intergenic
1133212859 16:4272817-4272839 AATCAAAGGGCAGCGCCGGACGG + Exonic
1133388498 16:5389928-5389950 GAGGAAGGGGGATCACCTGAAGG - Intergenic
1136508919 16:30723907-30723929 GCTGACGGGGAAGCACCAGATGG - Exonic
1138195900 16:55051904-55051926 AATGAAGGGGCAGTACCGAGAGG - Intergenic
1138599817 16:58047708-58047730 GAGGAAGGGGCGGGACGGGATGG - Intergenic
1140138573 16:72231120-72231142 GATGTGGGGGTAGCACTGGAAGG + Intergenic
1141864517 16:86740954-86740976 GTTGAAGGGGCTGCACTGGCCGG - Intergenic
1143614171 17:8039628-8039650 GCTGCAGGGGGAGCACAGGAAGG + Intronic
1148235053 17:45963354-45963376 GGTGAAGGGCCAGCATGGGAAGG - Intronic
1149579807 17:57741727-57741749 GATGAAGGTGAAGCAACTGAAGG + Intergenic
1150150182 17:62802810-62802832 GAGGAAGGAACAGCCCCGGAAGG + Intronic
1152078996 17:78174973-78174995 GGTGAAGGGCCAGGACAGGAAGG + Intronic
1153884112 18:9447815-9447837 GAAGGAGGAGCAGCAGCGGAAGG + Intergenic
1154212834 18:12394687-12394709 GCTGAAGGGGCCGCACAGTAGGG + Intergenic
1157394562 18:47330986-47331008 GAGGAAGGGCCAGCAGCAGAGGG - Intergenic
1157833466 18:50878697-50878719 GAGGAAGGGGGAGAACGGGAGGG - Intergenic
1163143999 19:15368697-15368719 GATGAAGAGGCGGCAGCTGAAGG + Intronic
1163507934 19:17719432-17719454 CTTAAAGGGGCCGCACCGGAAGG - Exonic
1163846020 19:19638401-19638423 GATGAAGGAGCAGAAGCGGATGG - Exonic
1164156946 19:22602823-22602845 GCTGAAGGAGCAGCACCGAGAGG + Intergenic
1164550969 19:29212406-29212428 GATGAAGGGGAAGGACATGAAGG + Intronic
1164645541 19:29856527-29856549 GATGAAGGGGCGGCTCAGGGAGG + Intergenic
1165168427 19:33872939-33872961 GATGAAGGGGCAGACCCTAAAGG + Intergenic
1165829940 19:38725534-38725556 CATGAGAGGGCAGGACCGGAGGG + Intronic
1167740463 19:51322182-51322204 GGTGAAGGGGCAGGACCGCATGG - Intronic
1167959427 19:53094481-53094503 GGTGCAGGGGCATCAGCGGATGG - Intronic
925405227 2:3601774-3601796 GATGAAGGGGCGGGGCGGGAAGG - Intronic
925979278 2:9164091-9164113 GGGGCAGGGGCAGCACTGGAAGG + Intergenic
928373171 2:30755926-30755948 GATGGATGGAGAGCACCGGATGG - Intronic
932837319 2:75049678-75049700 GATGAAGGGGCAGCACCGGAAGG + Exonic
934563249 2:95323895-95323917 GATGAGGGGCCAGCTCCTGAGGG + Intronic
936161248 2:110085743-110085765 GATGAAGGCGAAGAACTGGAAGG + Exonic
936183415 2:110285611-110285633 GATGAAGGCGAAGAACTGGAAGG - Intergenic
936236063 2:110743780-110743802 GGTGATGTGGCAGCTCCGGAAGG - Intronic
937328126 2:121004518-121004540 GATGAAGGGCCAGGACCAGAAGG + Intergenic
941199006 2:162486249-162486271 GATGAGGGGGCAGAAAAGGAAGG + Intronic
941229833 2:162897969-162897991 GAGGAAGGAGCAGTACAGGATGG - Intergenic
948000058 2:234560440-234560462 GAGGAAGAGGAAGCACTGGAGGG + Intergenic
948865869 2:240774442-240774464 GATGAAGGAGCAGCCAAGGAAGG - Intronic
1168956331 20:1836932-1836954 GAGGAGGGGGCAGCGCAGGATGG - Intergenic
1171266608 20:23776427-23776449 GATGGAGGGGCAGGGGCGGAGGG - Intergenic
1173664687 20:44755656-44755678 GATGAAGGGGCAGCTTTGCAAGG - Intronic
1175988699 20:62777006-62777028 GAAGGAGGGGCAGGACAGGAAGG + Intergenic
1180201611 21:46228262-46228284 GATGAAGGGGCTGAAGCGGAGGG + Intronic
1180220351 21:46354644-46354666 GACGCAGGGGCAGCACCGCGTGG + Intronic
1180880203 22:19198084-19198106 ACTGAAGGTGCAGCACGGGAGGG - Intronic
1181852826 22:25762199-25762221 GAAGCAGGGGCAGCACTGCAGGG - Intronic
1183091798 22:35527232-35527254 GATGGAGGAGCAGCAGGGGATGG + Intergenic
1183427260 22:37746495-37746517 GAGGAGGGGGCTGCCCCGGAGGG - Intronic
1183481486 22:38067941-38067963 GATGCAGGGAGAGCACCGGGAGG - Intronic
1183504681 22:38202471-38202493 GAGGAAGGGGCAGCGCAGGCCGG + Intronic
1183945040 22:41320660-41320682 GATGGAGAGGCAGAAACGGAAGG + Exonic
1184291838 22:43501525-43501547 GATGCAAGGGCAGCACCAGCTGG - Intronic
1184655103 22:45937122-45937144 GATGGAGGAGCCGCACTGGATGG - Intronic
951506929 3:23457498-23457520 GATGAAGCAGCAGCAGCTGATGG - Intronic
952827045 3:37532626-37532648 GATGAATGGACAGCACCTGTGGG - Intronic
960620249 3:119630284-119630306 GAAGGAGGGGAAGCACCAGAAGG + Intergenic
961651808 3:128420694-128420716 GATGACAGGACAGTACCGGAGGG + Intergenic
962352368 3:134665269-134665291 GATCCAGGGGCAGCACCAGGAGG - Intronic
969238555 4:5885205-5885227 GGTGAAGGGGCATCACAGGCAGG - Intronic
969625414 4:8302530-8302552 GAGGAAGGGGTAGCAGGGGATGG - Intronic
973649291 4:52981791-52981813 GATGAATGGGCAGCAGTTGAAGG + Intronic
981765990 4:148250855-148250877 GAGGAATTGGCAGCACTGGATGG - Intronic
982209044 4:153020312-153020334 GATGAAGCAGCAGCGCCGGCTGG + Intergenic
984762750 4:183376797-183376819 GGGGATGGGGCAGCACCGCAGGG - Intergenic
985246297 4:187982925-187982947 AGTGAAGGGGCAGCTCTGGAGGG + Intergenic
987192322 5:15490979-15491001 GATGAAGGAGAAGCACCGTAGGG - Intergenic
992130705 5:73689722-73689744 ACTGAAGGAGCAGCACTGGAAGG + Intronic
1001595638 5:172897005-172897027 GATGAAGAGGCAGCAGCAGATGG - Exonic
1001976794 5:176006842-176006864 GATGATGGAGCAGTACCGCAGGG - Intronic
1002642486 5:180636829-180636851 CAGGACGGGGCAGCACCGGGAGG - Intronic
1002948917 6:1789120-1789142 AATGAAGGGACAGCAGGGGACGG + Intronic
1004070918 6:12296707-12296729 GAGGAAGGGGCAGCAGGGGTGGG - Exonic
1011327007 6:86159571-86159593 AATGAAGGGGCAGCATGAGAAGG + Intergenic
1011765851 6:90618801-90618823 GGTGTAGGGGCAGCAACAGAAGG + Intergenic
1014202649 6:118622816-118622838 GATGAAGGAGAAGCAGCAGAAGG + Intronic
1018630165 6:165815561-165815583 GATGAAGGGGCAGAACTGCATGG + Intronic
1019434947 7:1017754-1017776 GGGGAAGGGGCAGCTGCGGACGG + Intronic
1029733349 7:102451925-102451947 AAAGAAGGGGCAGCCCCAGAGGG + Exonic
1031283307 7:119833232-119833254 AATGAAGGGGCAGCATAAGATGG - Intergenic
1032720562 7:134547755-134547777 GCTGAAGGGACAGCACAGGCTGG - Intergenic
1034074759 7:148221088-148221110 GATGAAGGCACAGCAGCGGTGGG - Intronic
1034449728 7:151130840-151130862 GGTGAGGTGGCAGCCCCGGAGGG - Intronic
1036669944 8:10776718-10776740 GAGGAAGGGGAAGCAAGGGATGG + Intronic
1036679801 8:10863788-10863810 GAGGAAGAGGCAGCACCCCATGG + Intergenic
1037911011 8:22743571-22743593 GAGGAAAAGGCAGCTCCGGAGGG - Intronic
1041171133 8:55142884-55142906 GACGAAGGAGCAGCGCCTGAAGG + Intronic
1043225702 8:77727648-77727670 GATGAAGGAGGAGCAGCAGAAGG - Intergenic
1043372657 8:79612076-79612098 AATGAAGATGCAGCACCGGGCGG - Intronic
1047285050 8:123480529-123480551 GATGAAGCGGCAGCTATGGAGGG + Intergenic
1048937039 8:139366023-139366045 GATCAAGGAGCAGCACCGTGAGG + Intergenic
1048977332 8:139680333-139680355 GGTGAAGGGGCAGATCCGGGTGG - Intronic
1049442044 8:142614070-142614092 GCTGAAGGGGCTGCACCGGTCGG - Exonic
1049507010 8:143008232-143008254 GATGGAGGTGGAGCACCGGCAGG + Intergenic
1051532672 9:18122345-18122367 GATGATGGGTGAGCACCAGATGG + Intergenic
1053561310 9:39198279-39198301 GTTGAGGGGGCAGCAGCAGAGGG - Intronic
1053825406 9:42018517-42018539 GCTGAGGGGGCAGCAGCAGAGGG - Intronic
1054135809 9:61420668-61420690 GTTGAGGGGGCAGCAGCAGAGGG + Intergenic
1054605157 9:67168840-67168862 GCTGAGGGGGCAGCAGCAGAGGG + Intergenic
1056465375 9:86848571-86848593 GATGAAGGGGAAGGAGAGGAGGG - Intergenic
1057214579 9:93220792-93220814 GATGCTGGGGCAGCACGGGCAGG - Intronic
1057518037 9:95738110-95738132 GATGAAGAGGCAGCCCCGGGGGG - Intergenic
1057646839 9:96884365-96884387 GGTGAAGGGTCAGCACCCAATGG - Intergenic
1057796109 9:98159356-98159378 AATGAATGGGCAGCATCAGAGGG - Intronic
1061236086 9:129343434-129343456 GATGAAGAGGGAGCGCAGGATGG + Intergenic
1061298801 9:129692539-129692561 GATGAAGAGGCAGAACCCGGGGG - Intronic
1061533063 9:131229889-131229911 GGAGAAGGGGCAGCACCTGGGGG - Intronic
1062033593 9:134372896-134372918 GGTGAAGGGGCAGCAGGAGAGGG + Intronic
1203778981 EBV:90301-90323 CATGGAGGGGCGGCAGCGGATGG - Intergenic
1190712681 X:53081594-53081616 GAGGAAGGGGCAGAAGCGGGGGG + Intergenic
1192033931 X:67544229-67544251 GAGGAAAGGGCAGCTCCGGGCGG - Intronic
1192180302 X:68912084-68912106 GCTGAAGGGGCTACACAGGAAGG - Intergenic
1197511294 X:127372123-127372145 GGTGGAGGGGCAGAGCCGGATGG - Intergenic