ID: 932837321

View in Genome Browser
Species Human (GRCh38)
Location 2:75049698-75049720
Sequence AGGCATGCTTGAAGCCCAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837311_932837321 18 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837310_932837321 22 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837313_932837321 16 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837317_932837321 5 Left 932837317 2:75049670-75049692 CCGGCGCTGATGAAGGGGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246
932837312_932837321 17 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG 0: 1
1: 0
2: 2
3: 47
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837321 Original CRISPR AGGCATGCTTGAAGCCCAGA CGG Exonic
901140215 1:7024205-7024227 AGGCATGCTTGAAAGCAATACGG + Intronic
903043339 1:20548619-20548641 AAGGATGGTGGAAGCCCAGAGGG + Intergenic
903873826 1:26458215-26458237 AGGCAAGCTTCCAACCCAGAGGG - Intronic
903960918 1:27057372-27057394 AGCCATGCTTTTAGCCCAGATGG + Intergenic
905591702 1:39169514-39169536 AGGATTGCTTGAAGCCCAGGAGG + Intronic
906682067 1:47734473-47734495 AGAATTGCTTGAACCCCAGAGGG - Intergenic
908203604 1:61822504-61822526 GGGCAGTCTTGAACCCCAGATGG + Intronic
908440800 1:64151793-64151815 AGAATTGCTTGAACCCCAGAGGG + Intronic
909049944 1:70754525-70754547 AAGCCTGCTTGGAGCTCAGAAGG - Intergenic
910468836 1:87529162-87529184 AGGCACTCTGGCAGCCCAGAGGG + Intergenic
911368213 1:96965946-96965968 AGTCAAGTTTGAAGCCCAAATGG + Intergenic
911756423 1:101561888-101561910 AGGGATGCTTGAGGGACAGAAGG - Intergenic
912106481 1:106283525-106283547 AGGCATGGTTGATGCCAGGATGG - Intergenic
915959648 1:160254700-160254722 AGGACTGCTTGAACCCGAGAGGG + Intronic
916022373 1:160803918-160803940 AGGATTGCTTGAATCCCAGGAGG + Intronic
916047373 1:161010353-161010375 AGAATTGCTTGAAGCCGAGAGGG + Intronic
918534588 1:185560059-185560081 AGGAGTCCTTGAAGCCCAGTGGG + Intergenic
920944381 1:210514918-210514940 AGGAATGGTTGGAGCCCAGAAGG - Intronic
921073306 1:211680045-211680067 AGGATTGCTTTAAGCCCAGGAGG - Intergenic
921336597 1:214093101-214093123 AAGCTTGTGTGAAGCCCAGAGGG + Intergenic
921859990 1:220032440-220032462 TGGCTTTCTTGAAGCCCAGCAGG - Exonic
923352446 1:233122610-233122632 AGGATTGCTTGAAGCCAGGAAGG - Intronic
924607989 1:245551692-245551714 ATGGATGCCGGAAGCCCAGAAGG + Intronic
1063012124 10:2033719-2033741 AGGAAAGCTTCAGGCCCAGACGG - Intergenic
1064065915 10:12181466-12181488 AGGCCTGCATGACACCCAGAGGG - Intronic
1064321116 10:14305541-14305563 AGGCAATCTTTAAGGCCAGATGG + Intronic
1065219475 10:23481403-23481425 AGGATTGCTTGAAGCCCAAGAGG + Intergenic
1065570007 10:27061144-27061166 AGGCATGCCAGTAGCCCACATGG - Exonic
1068758762 10:60683857-60683879 AGGCATGCAGGAAGAACAGAAGG + Intronic
1069480428 10:68776771-68776793 AGGACTGCTTGAAGCCAAGGAGG - Intronic
1069754701 10:70766570-70766592 ATGCAAGTCTGAAGCCCAGAAGG - Intergenic
1069756221 10:70775783-70775805 AGGGATGGGGGAAGCCCAGAGGG + Intronic
1070581688 10:77725179-77725201 ATGCATGTTTGAAACCCAGCAGG - Intergenic
1070699315 10:78588175-78588197 AAGCATTTTTGGAGCCCAGAGGG + Intergenic
1070956460 10:80466864-80466886 ATGCATTGTTTAAGCCCAGAAGG + Intronic
1072123977 10:92429514-92429536 AGGATTGCTAGAAGCCCAGGAGG - Intergenic
1073466125 10:103695417-103695439 AGGATTGCTTGAAGCCCAGGAGG + Intronic
1074254384 10:111785560-111785582 AGGATTGCTTGGAGTCCAGAGGG - Intergenic
1074876121 10:117614628-117614650 AGGCATGTTTGAAGAGCAGCGGG + Intergenic
1075407771 10:122206044-122206066 AGGAATCCTTGGCGCCCAGAGGG - Intronic
1077649081 11:3953337-3953359 GGGAATGGTTCAAGCCCAGATGG + Intronic
1081431857 11:42985085-42985107 AAGCAAGCTTGGAGCCTAGATGG - Intergenic
1081749076 11:45494939-45494961 AGGCCTGCCTGAACCCCAGGTGG - Intergenic
1083817115 11:65139812-65139834 AGAAATGCTTGAACCCCAGGAGG - Intergenic
1085633265 11:78137482-78137504 AGGCATCCTGAAAGCCAAGACGG - Intronic
1086113949 11:83227531-83227553 TGGCATGTTTGAAGTCCTGAGGG + Intronic
1086414538 11:86575669-86575691 AGGCGTGCATGAAGCTCTGAGGG - Intronic
1089104749 11:115993145-115993167 AGTCATGCTTGTGGCCCAGAGGG - Intergenic
1091971393 12:4789896-4789918 CTGCAGGGTTGAAGCCCAGAGGG + Intronic
1091998831 12:5016849-5016871 GGGCAGCCTTGAAGCCCCGATGG + Intergenic
1094865733 12:34528301-34528323 ATGCATGTCTGAAGCACAGAAGG - Intergenic
1097601060 12:61694282-61694304 AGGCATGCTTGCATGACAGATGG + Intergenic
1098317587 12:69208421-69208443 AGGATTGCTTGAACCCAAGAGGG + Intergenic
1098537547 12:71611032-71611054 AGCCATGGTTGAATCTCAGATGG - Intronic
1101862466 12:108494187-108494209 AGGACTGGTTGAAGGCCAGAGGG - Intergenic
1102010585 12:109616125-109616147 GGTCTTGCTTGAAGCCAAGAGGG - Intergenic
1102264931 12:111475253-111475275 AGAATTGCTTGAACCCCAGAGGG + Intronic
1102770593 12:115472711-115472733 AGGATTGCTTGAGTCCCAGAAGG + Intergenic
1104491018 12:129193416-129193438 AGGCAGGTTAGAAACCCAGAAGG + Intronic
1104960414 12:132486079-132486101 AGGCAAGTTTGAAACCCAAAGGG + Intergenic
1106071227 13:26413026-26413048 AGGCATGCTTGAAAGTCAGAGGG + Intergenic
1106162291 13:27212278-27212300 AGGCATTCCGGCAGCCCAGAGGG - Intergenic
1106243562 13:27928378-27928400 AGGCTTGGGTGGAGCCCAGAGGG - Intergenic
1106247622 13:27962699-27962721 AGGCAAGCTTGAGGCCAAGATGG - Exonic
1106260284 13:28060691-28060713 AGAATAGCTTGAAGCCCAGAGGG - Intronic
1108873680 13:55018560-55018582 AGGCATGCTTGAGTCACAGCTGG - Intergenic
1110394808 13:75017060-75017082 ATGCATGCTTGAAGGGTAGATGG - Intergenic
1113769396 13:112898685-112898707 ATTCAGGCTAGAAGCCCAGACGG + Intronic
1119276850 14:73364715-73364737 AGGATTGCTTTAAGCCCAGGAGG - Intronic
1119357787 14:74021290-74021312 AGGCATCCTTAAAGCCCGGTGGG + Intronic
1120815734 14:88855993-88856015 AGGATTGCTTGAGCCCCAGAGGG + Intronic
1124346764 15:28928172-28928194 AGGCATGCTAGAAGACAAAAAGG - Intronic
1124357078 15:29003685-29003707 AGGCAAGCCTGAAGCCCGCAGGG + Intronic
1124809687 15:32923089-32923111 AGCCATGCACAAAGCCCAGAGGG - Intronic
1125776664 15:42222148-42222170 AGGAGTGCTTGAACCCCAGGAGG - Intronic
1125931953 15:43606509-43606531 AGAATTGCTTGAACCCCAGAGGG + Intronic
1125945052 15:43705984-43706006 AGAAGTGCTTGAACCCCAGAGGG + Intergenic
1126560260 15:50035687-50035709 AGGGGTACCTGAAGCCCAGAAGG + Intronic
1127298242 15:57628755-57628777 AGGCAGTCTAGAAGCGCAGAAGG + Intronic
1128690815 15:69723598-69723620 ATGAAGGCTTGAAGCCCAGAGGG - Intergenic
1129883345 15:79021432-79021454 GGGCAAGCTTGAGGCCCAGTGGG - Intronic
1130579933 15:85127106-85127128 AGGATCGCTTGAAGCCCAGGAGG + Intronic
1131677150 15:94682183-94682205 AGGCAAGCTCCATGCCCAGAAGG + Intergenic
1131831771 15:96359255-96359277 AGGCATTCTGGATGCCCTGACGG - Intergenic
1134134874 16:11671458-11671480 AGGCAGGATGGGAGCCCAGAGGG - Intronic
1134165620 16:11927028-11927050 AGGATTGCTTAAAGCCCAGGAGG + Intergenic
1134241044 16:12507186-12507208 AGCCAGGATTGAAGCACAGAGGG + Intronic
1134489689 16:14687416-14687438 AGGATCGCTTGAAGCCCAGGAGG - Intronic
1134495071 16:14726536-14726558 AGGATTGCTTGAAGCCCAGGAGG - Intronic
1134500455 16:14765656-14765678 AGGATTGCTTGAAGCCCAGGAGG - Intronic
1134526995 16:14952269-14952291 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1134545409 16:15104081-15104103 AGGATTGCTTGAAGCCCAGGAGG + Intronic
1134580126 16:15363394-15363416 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1134714582 16:16350802-16350824 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1134722457 16:16394166-16394188 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1134944970 16:18317703-18317725 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1134952234 16:18357856-18357878 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1135310576 16:21401919-21401941 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1135363523 16:21834353-21834375 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1135448269 16:22536728-22536750 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1136150156 16:28342270-28342292 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1136166392 16:28456089-28456111 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1136196581 16:28658943-28658965 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1136212921 16:28773068-28773090 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1136257648 16:29052987-29053009 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1136307320 16:29381081-29381103 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1136320845 16:29483324-29483346 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1136435418 16:30222664-30222686 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1137462125 16:48674395-48674417 AGGCATGTTGAAAGCCGAGATGG + Intergenic
1139631499 16:68234496-68234518 AGGCCTGCCTGAGGCCCAGAAGG + Intronic
1139855449 16:69976068-69976090 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1139885165 16:70203185-70203207 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1140058914 16:71550270-71550292 AGGCTTGCTTCGAGCCCAGGAGG - Intronic
1140367349 16:74392327-74392349 AGGATTGCTTGAAGCCCAGGAGG - Intergenic
1140525306 16:75618006-75618028 AGGCTTGCTTGAGTCCCAGGAGG + Intronic
1142480162 17:214121-214143 AGGAGGGCCTGAAGCCCAGAGGG - Intronic
1146578767 17:34017522-34017544 AGGCATGCTGAAAGCCAAAAAGG + Intronic
1147442724 17:40457326-40457348 AGGAAGACTTGAAGCACAGAGGG + Exonic
1147535843 17:41322977-41322999 TGGCATGCTTGAGGCCCAGAGGG + Intergenic
1147537822 17:41332419-41332441 TGGCATGCCTGAGGCCCAGAGGG - Intergenic
1147537990 17:41333372-41333394 CGGCATGCCTGAGGCCCAGAGGG + Intergenic
1148587094 17:48788635-48788657 AGGCATCCTGGAATCCCAGGCGG + Intronic
1149061802 17:52431373-52431395 AGGAATAATTGAAGGCCAGAGGG - Intergenic
1151790328 17:76301477-76301499 AGGATTGCTTGAGCCCCAGAGGG + Intronic
1151886876 17:76928067-76928089 TGGCATCATTGAATCCCAGAAGG + Intronic
1154116874 18:11619040-11619062 AGGATTGCTTGAAGCCCAGGAGG + Intergenic
1155519481 18:26655300-26655322 AAGCATGCTTGGTACCCAGAGGG + Intronic
1156555010 18:38057462-38057484 AGGTATGCTGGAAACCTAGAGGG + Intergenic
1157420622 18:47544916-47544938 AGGAATGCCTGCAGCTCAGAAGG - Intergenic
1158513133 18:58109194-58109216 AGGCAGGCGGGAAGCCCAGGAGG + Intronic
1160010089 18:75100794-75100816 ATACATGTTTGAAGCCCAGCAGG + Intergenic
1161472761 19:4468510-4468532 AGGATTGCTTGAACCCAAGAGGG - Intergenic
1161830828 19:6603030-6603052 AGGATTGCTTGAACCCAAGAGGG - Intronic
1162306603 19:9878307-9878329 AGCCAAGATTGAAGCTCAGATGG - Intronic
1164547878 19:29184096-29184118 AGGCAAGCATGAAGCTCTGAAGG + Intergenic
1164859569 19:31552247-31552269 AGTCATATTTGAAGCCCAAAAGG - Intergenic
1165125031 19:33588393-33588415 AGGCATGTCAGAAGCCAAGATGG + Intergenic
1167521510 19:49958664-49958686 AGACGTGCTGGGAGCCCAGAGGG + Exonic
1167776381 19:51560370-51560392 AGACATGCTGGGAGCCCAAAGGG + Intergenic
1167886333 19:52502979-52503001 AGAATTGCTTGAAACCCAGAGGG - Intronic
1168086026 19:54047379-54047401 AGAATTGCTTGAACCCCAGAGGG - Intronic
1168352092 19:55681894-55681916 AACCATGCTTGGAGCCCAGGAGG - Intronic
926762129 2:16287457-16287479 AGACCTGCTGGAAGCCCAGAGGG + Intergenic
927273262 2:21237656-21237678 AGGCAGGCTGGAAACTCAGACGG - Intergenic
927907487 2:26870614-26870636 AGGATTGCTTGGAGCCCAGGAGG + Intronic
928034954 2:27813994-27814016 AGGATTGCTTGAAGCCAGGAAGG + Intronic
929291936 2:40202814-40202836 ACACATGCTTGCAGGCCAGAGGG - Intronic
929333770 2:40715168-40715190 AGGCATACTTTCACCCCAGAGGG - Intergenic
930256583 2:49100427-49100449 AGTCATCCTTGCAGCTCAGATGG + Intronic
930585170 2:53259719-53259741 AGGCACTCTGGCAGCCCAGAGGG + Intergenic
932837321 2:75049698-75049720 AGGCATGCTTGAAGCCCAGACGG + Exonic
933748719 2:85589400-85589422 AGGCCTGCCTGGAGCCAAGATGG - Intronic
935344129 2:102089170-102089192 AGGCATGTTGAAAGCCAAGATGG - Intronic
937128412 2:119489041-119489063 AGGAATGCTGGGTGCCCAGAGGG + Intronic
937476948 2:122223899-122223921 AGGCTTCCTGGAAGGCCAGAGGG - Intergenic
937761778 2:125613070-125613092 AGGCATGCTTTAAACACAGTGGG - Intergenic
938315942 2:130328010-130328032 GGGCACTCTTGCAGCCCAGAGGG - Intergenic
940334826 2:152515062-152515084 AGTCATGATTGCAGCCCAGGTGG + Intronic
941600735 2:167540674-167540696 AGGCATGCTTGTCTACCAGATGG - Intergenic
944237137 2:197450842-197450864 AGGCACTCTGGCAGCCCAGAGGG - Intergenic
944273412 2:197807387-197807409 AAGCATTTTTGAAGCCTAGAGGG + Intronic
945559260 2:211318399-211318421 ACACATGTATGAAGCCCAGAAGG - Intergenic
947695715 2:232186427-232186449 AGGAAATCTTCAAGCCCAGATGG + Intronic
947986546 2:234452738-234452760 AGAATTGCTTGAAACCCAGAAGG - Intergenic
948121418 2:235533815-235533837 ATGGATGCTTGCAGCACAGAGGG - Intronic
948412905 2:237778489-237778511 AGGAATGCCTGAGGCCAAGACGG - Intronic
948829086 2:240588881-240588903 AGGCAAGGTCGAAGCTCAGAGGG + Intronic
1168836872 20:883481-883503 AGGCATCCTTGAAGTCTAGCAGG - Intronic
1169045576 20:2532096-2532118 AGGAATGCTTCCAGCCCAGAGGG + Intergenic
1171050042 20:21849353-21849375 TGGGATGCTTGCCGCCCAGAAGG - Intergenic
1171158512 20:22899221-22899243 AGGCATGGTGGATGCCAAGAAGG - Intergenic
1171330496 20:24333377-24333399 AGGCATGCTTGAAGCACTAAGGG + Intergenic
1171994696 20:31722777-31722799 CGGCAGGCTGGGAGCCCAGAAGG + Exonic
1172059847 20:32179799-32179821 AGGCATCCCTGAAACCCAGAAGG - Intergenic
1173434040 20:43016626-43016648 AGGATTACTTGAAGCCAAGAGGG - Intronic
1173784073 20:45779864-45779886 AGGCTTCCTGGAGGCCCAGAGGG + Intronic
1176205006 20:63883494-63883516 AGGCGTGCCTGAGGCCCAGCTGG - Intronic
1177204515 21:17995456-17995478 GGGAGTGCTTGAAGCACAGAAGG - Intronic
1177715967 21:24840307-24840329 AGGCACTCTGGCAGCCCAGAGGG + Intergenic
1178769178 21:35486772-35486794 AGGCATGCTTGAAGAGAAAAAGG - Intronic
1180137758 21:45872079-45872101 AGGCGTGCTGGATGCCCAGGCGG - Intronic
1180246002 21:46547757-46547779 AGGACTGCTTGAAGCCCAGGAGG - Intronic
1181265389 22:21628216-21628238 AGGCCTGCCTGCAGCCAAGAAGG + Exonic
1183210304 22:36447209-36447231 AGGATCACTTGAAGCCCAGAAGG - Intergenic
1183538426 22:38416262-38416284 AGACAGGCCTGAAGCCAAGAAGG + Intergenic
1184688265 22:46106095-46106117 AGGCTTGCTTGGAGTCCAAAGGG - Intronic
1185288542 22:50013050-50013072 AGGCATGCATGAGGCCAGGAGGG + Intergenic
951176324 3:19605044-19605066 AGGCATGTTGGAAGCCAAGATGG - Intergenic
951858591 3:27225603-27225625 AGTCAGGCTTGAAGGCCATACGG + Intronic
953197797 3:40750486-40750508 AGGCAAGCTTGCCCCCCAGAGGG - Intergenic
953929700 3:46999764-46999786 AGGCAAGGTGGAAGGCCAGAGGG - Intronic
960965302 3:123100334-123100356 AGGCATGCGTGGACCTCAGAGGG + Intronic
962711957 3:138094888-138094910 AGGGGAGCTGGAAGCCCAGAGGG - Exonic
965822103 3:172694740-172694762 AGGCATCAGAGAAGCCCAGACGG - Intronic
965857159 3:173103003-173103025 ATGCATGTCTGAAACCCAGAAGG + Intronic
966740161 3:183225129-183225151 AGGCATCATTGAAGCTGAGAGGG - Intronic
968867253 4:3221189-3221211 AGGCTTGTTTGGATCCCAGAAGG + Intronic
969625022 4:8297957-8297979 AGGCATGTGGGAAGTCCAGAGGG - Intronic
970227455 4:13874521-13874543 AGGCATGTTTAAAGGGCAGAGGG + Intergenic
970774165 4:19653090-19653112 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
971398822 4:26255900-26255922 AGGAATACTTGAGGCCCAAAGGG - Intronic
972380027 4:38510837-38510859 TGGCAGCCTTGAAGCCCACAGGG - Intergenic
973628337 4:52794599-52794621 AGAATTGCTTGAACCCCAGAGGG - Intergenic
974641475 4:64637192-64637214 AGGCATGACTCAAACCCAGATGG - Intergenic
975684699 4:76908210-76908232 AGGCAGGATTCAAACCCAGAGGG + Intergenic
975786390 4:77893203-77893225 AGGATTGCTTGAAGCCAGGAAGG - Intronic
980144290 4:128961998-128962020 AGGCAGGCTGGAACCCCTGAAGG - Intronic
980809244 4:137853742-137853764 AGGCACTCTGGCAGCCCAGAGGG - Intergenic
980899895 4:138895027-138895049 AGGAAATCTTGAAGCACAGATGG + Intergenic
981174328 4:141663510-141663532 AGGCATGATTGAAGCATAAATGG + Intronic
982293827 4:153806479-153806501 AGGCACCCTGGCAGCCCAGAGGG - Intergenic
982738787 4:159036289-159036311 AGGAAGGCTTGTAGCCCAGCTGG + Intronic
983808618 4:172027677-172027699 AGGCATGTTGCAAGCCAAGATGG + Intronic
987923707 5:24314554-24314576 AGGCACTCTGGCAGCCCAGAGGG - Intergenic
989158570 5:38368458-38368480 AGGAATGATTGAAAGCCAGATGG - Intronic
991104118 5:62824683-62824705 ACACATGCTTTAAGACCAGATGG - Intergenic
992165640 5:74048251-74048273 AGTCATGGTTGATGCCCAAAGGG + Intergenic
992630899 5:78679197-78679219 AGGCAGACTTGCAGGCCAGAGGG + Intronic
993224048 5:85142205-85142227 AGGATTGCTTGAACCCCAGGAGG - Intergenic
994507908 5:100665148-100665170 ACGCATGTTTGAAACCCAGCAGG + Intergenic
996681204 5:126229347-126229369 AGGCACTCTGGCAGCCCAGAAGG - Intergenic
996766731 5:127041713-127041735 AGGGATGCTTAAAGCCAGGAAGG + Intergenic
997586963 5:135048983-135049005 TGCCATGCTAGAGGCCCAGATGG - Intronic
997892652 5:137688676-137688698 AGGCAGGATTCAAGCCCAGACGG - Intronic
998458123 5:142289474-142289496 AGGCATCCATGATGCCCAGAAGG - Intergenic
998806070 5:145918905-145918927 AGGCATGCACTAAGCACAGAAGG - Intergenic
999325388 5:150640539-150640561 AGGCATGAGTGGAGCCCGGAGGG + Intronic
1002454616 5:179339007-179339029 AGGCAAGCCTGGAGCCCAGGAGG + Intronic
1002716725 5:181232757-181232779 AGAGATGCATGAAGCCCAGCTGG + Exonic
1002776609 6:333287-333309 TGGCATGGTTGAAGCCCATTTGG + Intronic
1003115642 6:3282127-3282149 AGGCCAGCTGGAAACCCAGAAGG + Intronic
1004019851 6:11767552-11767574 AGGCATGCTGGCTGCCCAGCAGG - Intronic
1004232841 6:13848787-13848809 AGGCAGGCTTGAAGCCCACTCGG - Intergenic
1004536773 6:16510646-16510668 AGGACTGCTTGAACCCCAGGAGG + Intronic
1005450542 6:25967623-25967645 AGGATTGCTTGAGCCCCAGAAGG - Intronic
1006739579 6:36297765-36297787 AGGCATGCCTGAATGCCGGATGG - Intronic
1007830762 6:44636667-44636689 TGGCATGTTTCTAGCCCAGATGG + Intergenic
1008087077 6:47256433-47256455 AGGATTGCTTGAGCCCCAGAGGG + Intronic
1009481887 6:64169567-64169589 AGGACTTCCTGAAGCCCAGATGG + Intronic
1010865801 6:80975402-80975424 AGGCAAGTTTGAAACCCAGTAGG - Intergenic
1010939178 6:81895896-81895918 AGGCATTCTTAATGGCCAGAAGG + Intergenic
1012146189 6:95686021-95686043 AGGCATGTTTGTAGCAGAGAAGG + Intergenic
1013348388 6:109284259-109284281 AAGCATGCTTCAGGCACAGAGGG + Intergenic
1014433561 6:121397182-121397204 AGAATTGCTTGAACCCCAGAAGG - Intergenic
1014746506 6:125207195-125207217 AGGCATTCAGTAAGCCCAGATGG + Intronic
1015613883 6:135054793-135054815 AGGCCTGCGGGAAGCCAAGATGG - Exonic
1015971323 6:138745526-138745548 AGGATTGCTTGAACCCCAGAAGG - Intergenic
1016090942 6:139978163-139978185 AGGCATGCTTGAAGTCTATGGGG + Intergenic
1016959840 6:149662736-149662758 AGGACTGCTTGAAGCCGGGAAGG + Intronic
1017507907 6:155085342-155085364 AGGCATGTTTGAAGGGCACAGGG + Intronic
1020216722 7:6197592-6197614 AGAAATGCTTGAACCCAAGAGGG + Intronic
1020785450 7:12567954-12567976 AGGCTTGGTTGGAGACCAGAGGG - Intergenic
1021093806 7:16512312-16512334 AGGAAGTCTCGAAGCCCAGAGGG - Intronic
1021167935 7:17362791-17362813 AGGCAAGGCTGGAGCCCAGAAGG - Intergenic
1021378213 7:19934987-19935009 AGGCATGCTTCAGCACCAGAAGG + Intergenic
1022160158 7:27702216-27702238 TGTGATGTTTGAAGCCCAGAAGG + Intergenic
1023468112 7:40481108-40481130 AGGATTGCTTGAAGCCAGGAAGG + Intronic
1026415350 7:70174038-70174060 AGGCATGTTGAAAGCCAAGATGG + Intronic
1027768218 7:82373418-82373440 AGGCTTGCTTGAGGAACAGACGG - Intronic
1030515120 7:110529096-110529118 AGGGATTCTTGCAGCCTAGAGGG + Intergenic
1030840114 7:114340833-114340855 AGGGATCCTTGAAGCTCATAAGG - Intronic
1032416517 7:131739255-131739277 AGGATTGCTTGAGTCCCAGAAGG + Intergenic
1037683785 8:21120372-21120394 AGGCAGGCTTGAATTTCAGAGGG - Intergenic
1038014011 8:23498000-23498022 AGCCTTGCTTGAAATCCAGAAGG - Intergenic
1038584429 8:28776536-28776558 AGGAATGCTGGCAGCCCACAGGG + Intronic
1041145881 8:54875354-54875376 GGGCATGCCTGCAGCCCAGAGGG - Intergenic
1041235073 8:55792752-55792774 AGCCATACTTGAATCCTAGAAGG - Exonic
1046134757 8:110011519-110011541 ATGCAAGTTTGAAGCCCAGCAGG - Intergenic
1047208024 8:122819095-122819117 AGGCCTTCTTGAAGGCCAGATGG + Intronic
1047264180 8:123290407-123290429 AGGCAAGCTTGACCCTCAGAAGG + Intergenic
1048482292 8:134809719-134809741 AGGAATGCTTCAAACCTAGAGGG + Intergenic
1048576607 8:135695399-135695421 ATGCAAGCCTGAAGACCAGATGG + Intergenic
1048854864 8:138677833-138677855 AGTCAAGCTTGAGGCCAAGACGG + Intronic
1050232939 9:3547836-3547858 ATGCATGCTTAAATCCTAGAGGG - Intergenic
1051006358 9:12349914-12349936 AGAATTGCTTGAACCCCAGAGGG + Intergenic
1053119849 9:35538433-35538455 GGGGATTCCTGAAGCCCAGAAGG - Intronic
1053187035 9:36025069-36025091 ATGGATGCTACAAGCCCAGAAGG + Intergenic
1054856022 9:69900541-69900563 GGGCTTGGTTGGAGCCCAGAAGG + Intronic
1056406577 9:86281774-86281796 AGGCTTGCTAGAGGCACAGAGGG + Intronic
1059242094 9:112815447-112815469 AGAATTGCTTGAACCCCAGAGGG - Intronic
1059463524 9:114450515-114450537 AGTCTTGCTTGAGGCTCAGAAGG - Intronic
1059833667 9:118126827-118126849 AGGCATGTTGAAAGCCAAGATGG + Intergenic
1188078230 X:25805761-25805783 AGGCACTCTGGCAGCCCAGAGGG + Intergenic
1189187894 X:39070044-39070066 AGGCACTCTGGCAGCCCAGAGGG + Intergenic
1190214490 X:48470519-48470541 TGGGCTGCTTGAAGCCCAGGTGG + Intergenic
1194117195 X:89917720-89917742 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
1194185123 X:90765798-90765820 AGGCACTCTGGCAGCCCAGAGGG - Intergenic
1194762022 X:97806346-97806368 ATGCATGCTGTAAGCTCAGAGGG - Intergenic
1195858976 X:109360227-109360249 AGACATTCTTGAAGCACTGATGG + Intergenic
1196366688 X:114932090-114932112 ACGCATGTCTGAAACCCAGAAGG + Intergenic
1198101188 X:133423197-133423219 AGGCATGCTTTGGGCCAAGAGGG - Intergenic
1199443664 X:147897092-147897114 AGGCACTCTGGCAGCCCAGATGG + Intergenic
1199556395 X:149113987-149114009 AGGCAGTCTGGTAGCCCAGAGGG + Intergenic
1200469988 Y:3574880-3574902 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
1200531750 Y:4347909-4347931 AGGCACTCTGGCAGCCCAGAGGG - Intergenic
1202090504 Y:21183557-21183579 AGGCATGCTGGCAGCCCAGAGGG - Intergenic