ID: 932837322

View in Genome Browser
Species Human (GRCh38)
Location 2:75049705-75049727
Sequence CTTGAAGCCCAGACGGAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932837312_932837322 24 Left 932837312 2:75049658-75049680 CCCTCATAGTCGCCGGCGCTGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837311_932837322 25 Left 932837311 2:75049657-75049679 CCCCTCATAGTCGCCGGCGCTGA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837317_932837322 12 Left 932837317 2:75049670-75049692 CCGGCGCTGATGAAGGGGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837310_932837322 29 Left 932837310 2:75049653-75049675 CCAGCCCCTCATAGTCGCCGGCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
932837313_932837322 23 Left 932837313 2:75049659-75049681 CCTCATAGTCGCCGGCGCTGATG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932837322 Original CRISPR CTTGAAGCCCAGACGGAACC TGG Exonic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
912525485 1:110279768-110279790 CCTAAAGCCCACAGGGAACCAGG - Intronic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
915826651 1:159085223-159085245 CTTGCAGCCCAGATGGACACAGG - Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1069721420 10:70551951-70551973 CACGAAGCCCAGAAGGAAACGGG - Intronic
1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG + Intergenic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1070736003 10:78864064-78864086 TTTGAAGCACAGACAGAATCTGG + Intergenic
1073283871 10:102375421-102375443 CATGGAGCCCATACGCAACCTGG - Exonic
1075687384 10:124373746-124373768 CTTCAAGCCCAGCTGGACCCAGG - Intergenic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG + Intronic
1081570817 11:44289763-44289785 CTTAGAGCCCAGACTGAAGCTGG - Intronic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1087361871 11:97170915-97170937 CTTGAAGCCTAAATGGTACCAGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092999693 12:13982390-13982412 CTTGAAGGCAAGAAAGAACCCGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1107608477 13:42087111-42087133 CTTGAAGCTCATACAGAACTAGG + Intronic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG + Exonic
1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG + Intergenic
1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG + Intronic
1131585613 15:93689761-93689783 CTTGGAGCCTAGAGGGAACAGGG + Intergenic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1135952060 16:26923852-26923874 CTTGAAGCTCAGACAGAAATAGG + Intergenic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1141962950 16:87421521-87421543 CTTGCAGCCCAGCCTGATCCTGG - Intronic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1148355253 17:46971521-46971543 CTTGAACCCCACACAGATCCTGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
925375123 2:3378674-3378696 CTGGAAGCCCCGGTGGAACCAGG - Intergenic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
932747980 2:74350435-74350457 CTTAAAGCCCAGATCCAACCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
934882538 2:97996092-97996114 CTTCACGGCCAGACAGAACCAGG + Intergenic
936940291 2:117877926-117877948 CTTGAAGCCAGCACAGAACCAGG + Intergenic
1169674086 20:8133999-8134021 CTGGAAGCGCAAACGGAACTTGG + Intronic
1173126842 20:40345151-40345173 CTTGAAGCCAACACAGCACCAGG - Intergenic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG + Intergenic
953346148 3:42177689-42177711 GTTGAAGCTCAGACAGAAACTGG + Intronic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
954457533 3:50607955-50607977 GTTGGAGTCCAGACGGAAGCTGG + Exonic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
961575536 3:127833066-127833088 CTGGAAGGCCACACAGAACCTGG - Intergenic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
967072042 3:185970963-185970985 TTTGAAGCCAAGAAGCAACCTGG - Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970535914 4:17029615-17029637 CTTGAAGCTCTGGCAGAACCAGG + Intergenic
971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG + Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1015429156 6:133110105-133110127 CTTGAAGCCCAGACAGGACAGGG + Intergenic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG + Intronic
1024451571 7:49551519-49551541 CCTGAAGTCCAGTCTGAACCTGG + Intergenic
1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG + Intergenic
1027188623 7:75985736-75985758 CTTGAAGGGCAGGCGGAACTGGG - Exonic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034857358 7:154564084-154564106 CTCGAAGCCCTGACTGTACCTGG - Intronic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG + Intronic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1189354440 X:40300278-40300300 CCTGAGGCCCAGGCGGACCCTGG - Intergenic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1193748288 X:85310906-85310928 CATGAAGCCCAGAAGGAACTAGG + Intronic
1196238892 X:113316956-113316978 CTTGGAGCACTGACAGAACCTGG + Intergenic