ID: 932839830

View in Genome Browser
Species Human (GRCh38)
Location 2:75071856-75071878
Sequence CTCAGTTCTCTCTTCCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932839830_932839832 -9 Left 932839830 2:75071856-75071878 CCAAACTGGAAGAGAGAACTGAG 0: 1
1: 0
2: 1
3: 23
4: 240
Right 932839832 2:75071870-75071892 AGAACTGAGAACAAACCACTGGG 0: 1
1: 0
2: 2
3: 34
4: 249
932839830_932839831 -10 Left 932839830 2:75071856-75071878 CCAAACTGGAAGAGAGAACTGAG 0: 1
1: 0
2: 1
3: 23
4: 240
Right 932839831 2:75071869-75071891 GAGAACTGAGAACAAACCACTGG 0: 1
1: 0
2: 5
3: 34
4: 407
932839830_932839834 7 Left 932839830 2:75071856-75071878 CCAAACTGGAAGAGAGAACTGAG 0: 1
1: 0
2: 1
3: 23
4: 240
Right 932839834 2:75071886-75071908 CACTGGGTTTGACAATTATCAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932839830 Original CRISPR CTCAGTTCTCTCTTCCAGTT TGG (reversed) Intronic
904685461 1:32256747-32256769 CAAAGTTCTCTCTTGCAGTGTGG + Intronic
907050093 1:51324446-51324468 TTCAGTTCTCTCTTCACGCTTGG + Intronic
911459341 1:98169767-98169789 CTCACTCCTCTATTCCATTTTGG + Intergenic
912527807 1:110297653-110297675 CTGTCTTCTGTCTTCCAGTTTGG - Intergenic
912602239 1:110948187-110948209 CTCAGTTCTCTTTTCTTGTCTGG + Exonic
913460210 1:119077290-119077312 CTCAGTTATCTTTTCCTCTTGGG - Intronic
914402574 1:147337118-147337140 TTCAGCTATCTCTGCCAGTTGGG + Intergenic
914991065 1:152500051-152500073 CTCAGTGCTGTCTTCCAGGTAGG + Intergenic
915026740 1:152837661-152837683 CTCCCTAATCTCTTCCAGTTGGG - Intergenic
917395121 1:174585444-174585466 ATCTGTTCTCACTTCCAATTGGG - Intronic
919342579 1:196331834-196331856 CTCAGTTATTTGTTCCATTTCGG - Intronic
919469448 1:197960180-197960202 CTCACTTCTCTCTTGAATTTGGG - Intergenic
923019996 1:230155758-230155780 CTAATCTCTCTCTTCCAGTCAGG - Intronic
923662435 1:235969901-235969923 CTCAGTTCTTTTTTCTAATTGGG - Intergenic
924410173 1:243796204-243796226 CTGATTTCTTTCTTCCATTTAGG + Intronic
1064364836 10:14698319-14698341 CTCAAATCACTCTTTCAGTTGGG - Intronic
1064403966 10:15044251-15044273 AACATTTTTCTCTTCCAGTTTGG + Intronic
1064562053 10:16603318-16603340 CTCATTTCTCCCCTCCAGTGGGG - Intronic
1066348284 10:34611402-34611424 ATCTGTTCTGCCTTCCAGTTCGG - Intronic
1067493326 10:46736339-46736361 CTGAGTTTTCCCTCCCAGTTAGG + Intergenic
1067601334 10:47604065-47604087 CTGAGTTTTCCCTCCCAGTTAGG - Intergenic
1068238541 10:54271779-54271801 CTGAGTTATCCCTTCCAGTTAGG - Intronic
1068600017 10:58946863-58946885 CTGACTTCTCTCTTCCAGTTTGG + Intergenic
1068604800 10:58992834-58992856 CTCAGCTGTCTCTCCCTGTTTGG + Intergenic
1068819909 10:61362823-61362845 CTTAATTCTCTCTTCCAATAAGG + Intergenic
1069294151 10:66823178-66823200 CTCAGTTCTCACCACCAGCTAGG - Intronic
1071337643 10:84613927-84613949 CTGAGTTCTCACTTCTAGCTTGG + Intergenic
1071652878 10:87411937-87411959 CTGAGTTTTCCCTCCCAGTTAGG - Intergenic
1073728921 10:106268145-106268167 CCCAGTTCTCTCTTTCTTTTGGG + Intergenic
1073745061 10:106459040-106459062 TTGACTTCTCTCTTCCTGTTTGG + Intergenic
1074195202 10:111178030-111178052 CTCAGTACTCACTGCCAGCTAGG + Intergenic
1074467365 10:113695448-113695470 TGCAGTTCTGTATTCCAGTTAGG - Intronic
1076027086 10:127124464-127124486 CCTAATTGTCTCTTCCAGTTGGG - Intronic
1077901413 11:6492572-6492594 GTCAGTTCACTCTTCCATTCCGG - Intronic
1079307632 11:19337665-19337687 CTCAGTTCTCACTGCTAATTGGG - Intergenic
1080298325 11:30755344-30755366 CTCACCTCTGGCTTCCAGTTGGG - Intergenic
1080767473 11:35309980-35310002 CTCAGGTCTCTATTCCAGAATGG + Intronic
1083058160 11:59842999-59843021 CTCTTTTCTCCCTTCCAGTCAGG + Intronic
1085642605 11:78202065-78202087 TTCAGTTATCTCTTCCTTTTTGG - Intronic
1086616216 11:88823719-88823741 CCAAGTTCTCTTCTCCAGTTGGG - Intronic
1087011730 11:93520743-93520765 TTCAGTTCTCTTTTCCAGGCTGG - Intronic
1087875986 11:103358175-103358197 CTATGTTCTTTCTTCCTGTTCGG + Intronic
1088905586 11:114153309-114153331 CCCAGGTCTCTCTGCCAGTGAGG + Intronic
1090246855 11:125222240-125222262 CCCCTTGCTCTCTTCCAGTTGGG + Intronic
1090814741 11:130282743-130282765 CACATTTCTCTCTTCCACGTTGG + Intronic
1090873422 11:130767950-130767972 CTAAGTTCTTTTTTCCAGTGAGG + Intergenic
1091049878 11:132357714-132357736 ATCAGTTCACTGTTTCAGTTTGG - Intergenic
1092004375 12:5056731-5056753 CCCAATTCTCTCTTCCACCTCGG - Intergenic
1092077457 12:5685462-5685484 TTCTCTTCTCTGTTCCAGTTGGG - Intronic
1093400179 12:18736706-18736728 TTTAGTTCTCTCTTCCAGAAAGG + Intronic
1094350591 12:29520669-29520691 GACAGTTCTTTATTCCAGTTTGG + Exonic
1094808072 12:34109727-34109749 CTCAGTTCCCTCTGCCACTCCGG - Intergenic
1098752146 12:74307858-74307880 CACAGTTCTCTCTTCTTGTACGG + Intergenic
1099653606 12:85460706-85460728 CTCAATTCTCTCTTTGAGATAGG - Intergenic
1101528411 12:105552709-105552731 CTCAGTCCTCTCTGACAGTCTGG - Intergenic
1103035054 12:117649820-117649842 TTCAGTTCTCTGTTTCTGTTGGG - Intronic
1104880342 12:132066628-132066650 CTCAGTTTTCCTTTCCTGTTGGG + Intronic
1105052083 12:133063755-133063777 CTCAGATCTCTCTTCAAGGAGGG - Intergenic
1107427880 13:40312544-40312566 CTCAGTTCCCTCATCAAATTAGG - Intergenic
1107445720 13:40468787-40468809 CTGTGTTCTCTTGTCCAGTTAGG - Intergenic
1110542865 13:76725618-76725640 CTCTCTTCACTCTTCCAGATGGG + Intergenic
1110803594 13:79729110-79729132 CTGATTTCTCTTTTCCAATTTGG + Intergenic
1110867949 13:80419271-80419293 CTCATTTCACTCTTCAAGATAGG - Intergenic
1111797415 13:92940295-92940317 CTCAGTTCTAACCTCAAGTTTGG - Intergenic
1112578320 13:100656951-100656973 ATCAGTTCTCTCCTCCCTTTTGG + Intronic
1113386862 13:109857028-109857050 CTTACTTCTCTATTACAGTTAGG - Intergenic
1114435284 14:22701391-22701413 CTCATGTCACTCTTTCAGTTTGG - Intergenic
1114721739 14:24889915-24889937 CTTAGTTCTCTGGTACAGTTGGG - Intronic
1115016542 14:28622187-28622209 CTTAGTTCCCTCTTCCACTAGGG - Intergenic
1115304966 14:31924162-31924184 CTGAGTTCTAGATTCCAGTTAGG + Intergenic
1116415110 14:44669581-44669603 CTGCTTTCTCTCTTCCAGCTGGG + Intergenic
1118041415 14:61921045-61921067 CTCTGTGCTCACTTCCAGCTTGG + Intergenic
1119857268 14:77909961-77909983 CTGATTTCACTCTTCCTGTTAGG + Intronic
1119862473 14:77946386-77946408 CTCAAATCTTTCTTCCAGATAGG - Intergenic
1120223695 14:81766101-81766123 CTTATTTCTCTTTTACAGTTGGG + Intergenic
1121525822 14:94618630-94618652 CTGAGTTCTATCTTCCATTAAGG + Intronic
1121538356 14:94706793-94706815 TTTATTTCTCTCTTCCAGTTTGG - Intergenic
1121977828 14:98422294-98422316 TCCAATTCTCTCTTCCATTTAGG + Intergenic
1122942585 14:104988657-104988679 GTCAGTGCTGTTTTCCAGTTTGG - Intronic
1124697367 15:31875921-31875943 CTATGTTCTCTCTTCTATTTTGG + Intergenic
1124898140 15:33796529-33796551 CTCAGTTATTTCATCCACTTGGG + Intronic
1125611846 15:40976689-40976711 CTGAGTTCTTTCTTCCAGAAAGG - Intergenic
1127148201 15:56047619-56047641 CTCATTCCTCTCTCCCAGCTCGG - Intergenic
1130635934 15:85620065-85620087 CTCTGTTCTTTCTTGCATTTGGG + Intronic
1131612880 15:93983533-93983555 GTCTTTTCTCTCTTCCAGTTAGG - Intergenic
1134742469 16:16560087-16560109 CCCTGTTCTCTCCTCCAGTGGGG - Intergenic
1134849277 16:17467856-17467878 CTCAGTGCTCTGTTGCAGGTGGG - Intronic
1134925094 16:18152372-18152394 CCCTGTTCTCTCCTCCAGTGGGG + Intergenic
1135646334 16:24165506-24165528 CTCACTTCTCTGCTCCAGATTGG + Intronic
1138748029 16:59386094-59386116 CTCAGTTGCCTCATCCAGTCAGG - Intergenic
1139314646 16:66057952-66057974 CTCAGCTCTCCCAGCCAGTTAGG + Intergenic
1140021999 16:71247557-71247579 CTCAGCTTTCTCATCCAGGTAGG - Intergenic
1140310117 16:73840851-73840873 ACCATTTCACTCTTCCAGTTGGG + Intergenic
1145097312 17:20042008-20042030 GTCTTTTCTCTCTTTCAGTTTGG + Intronic
1146481676 17:33210004-33210026 CTCTTTTCCCTCTTCCACTTCGG - Intronic
1146527602 17:33580173-33580195 CTGAGTTCTCCATGCCAGTTTGG - Intronic
1146663774 17:34683146-34683168 CTCACTCCTTTCTTCCAATTAGG - Intergenic
1146780852 17:35670839-35670861 CTCCTTTCTCTCTTTCAGCTTGG + Exonic
1149097576 17:52862089-52862111 CGCAGTTGCCTCTACCAGTTTGG - Intergenic
1150210604 17:63439187-63439209 CCCAGTTCTCTCTGCCACATCGG + Intronic
1150607277 17:66704926-66704948 CAGAATGCTCTCTTCCAGTTGGG + Intronic
1155373412 18:25130068-25130090 CTTAGTTGTTGCTTCCAGTTTGG - Intronic
1156048311 18:32902136-32902158 TTCCAGTCTCTCTTCCAGTTAGG - Intergenic
1157551461 18:48584636-48584658 CTCAGGTCTCCTCTCCAGTTTGG - Intronic
1163587596 19:18172614-18172636 CTCAGGTATATCTTCCAGCTGGG + Intronic
1166171849 19:41033469-41033491 CTCACTGCTGTCTTGCAGTTTGG - Intergenic
926016881 2:9461365-9461387 GTCAATTTTCTCTTACAGTTGGG + Intronic
926141227 2:10369646-10369668 CTCAGTTCTCTGCTACATTTAGG - Intronic
926183832 2:10672004-10672026 ATCAGTTCCCTCTTTCACTTGGG + Intronic
926867911 2:17379937-17379959 CTCAGTTCTCCTTTCCCTTTGGG - Intergenic
927766127 2:25810016-25810038 ATCAGTTGTCTTTTCCAGCTTGG + Intronic
928273360 2:29877022-29877044 CTCTAAGCTCTCTTCCAGTTTGG - Intronic
928418221 2:31114742-31114764 CTCAGGTCTTTCTTCAAGTCAGG - Exonic
928986368 2:37186202-37186224 CTGAGTTCTCTCTGCCTGTTGGG + Intronic
929563224 2:42968707-42968729 TCCAGTTCCCTCTGCCAGTTTGG - Intergenic
931123696 2:59249987-59250009 CTCAGTTTTCTCTTTCAGTCAGG + Intergenic
931998646 2:67863359-67863381 CTCAGCTCTCTATTCGATTTTGG - Intergenic
932839830 2:75071856-75071878 CTCAGTTCTCTCTTCCAGTTTGG - Intronic
933155252 2:78965945-78965967 CTCAGATCTCTCTTTCTGTATGG - Intergenic
933256112 2:80082666-80082688 CTCAATTTTTTCTTCCTGTTTGG - Intronic
934664694 2:96161991-96162013 CTCTGTCCTCTTTTCCTGTTGGG - Intergenic
939407132 2:141772862-141772884 CTCAGTTCTTTCTACCCGTCAGG + Intronic
940073986 2:149720307-149720329 CTCAGTCCTCTCTTCCCCTCTGG - Intergenic
940990014 2:160087263-160087285 CTATGTTCTCTCTTCCTTTTTGG + Intergenic
941125346 2:161577861-161577883 CTCAGTTCTAAATTTCAGTTTGG + Intronic
941515147 2:166464329-166464351 CTCAGTTCTTTCTTACACTCTGG - Intronic
941758129 2:169210652-169210674 CTCATTAGTTTCTTCCAGTTTGG - Intronic
942543467 2:177038400-177038422 CTCAGTTCCCTCTTCCATCTAGG - Intergenic
945471370 2:210230810-210230832 CTCTTTTCTGTCTTCCAGATAGG - Intergenic
945874557 2:215264640-215264662 ACCGGTTCTCTCTTCCAGTGAGG + Intergenic
947542187 2:230986952-230986974 CTCATTTCTCTCTTCCTGGAGGG + Intergenic
948364991 2:237448964-237448986 CTAAGTGGTCTCTTCCAGCTTGG - Intergenic
948574947 2:238943880-238943902 CCCAGTCCGCTGTTCCAGTTGGG - Intergenic
1169318977 20:4615623-4615645 CTCAGTTCTCTGTCCCATTATGG + Intergenic
1172310224 20:33912411-33912433 ATCAATTGTCTCTTCCAGCTTGG + Intergenic
1172664252 20:36588192-36588214 CTCAGTTCTCTCTAGTACTTTGG + Intronic
1174097801 20:48103035-48103057 ATCATTTCTCTCTTGCAGTTTGG - Intergenic
1174718625 20:52786784-52786806 CTCAGTGCCCTCTTCCTGCTTGG - Intergenic
1175319405 20:58074712-58074734 CTCAGTTCTCTCATCCTTTTTGG + Intergenic
1175375945 20:58524118-58524140 TTCAGTTTTCTCTTTCATTTGGG + Intergenic
1175610356 20:60346200-60346222 GTCAATTCTCTTTTCCATTTAGG - Intergenic
1178809694 21:35870161-35870183 CTTAGTTATTTCTTTCAGTTAGG - Intronic
1179339278 21:40489257-40489279 CTCAGTTTCCTGTTCCATTTAGG - Intronic
1179660532 21:42871930-42871952 CTCTGTCCTCTCTTCCAGTCAGG - Intronic
1180592082 22:16948838-16948860 TTCAGTTTTCTCTTCCTTTTTGG + Intergenic
1181019344 22:20090775-20090797 CTTAGTTCTCTCTTCAGGTGTGG + Intronic
1181512569 22:23395380-23395402 CACAGTTCTGTCTACCAGTGTGG - Intergenic
1181678901 22:24477474-24477496 CTCAGTTCTCACTTCTAGGGAGG + Intergenic
1182019212 22:27066790-27066812 CTGAGTTCTCTCTTCTACTTTGG - Intergenic
1183695240 22:39418010-39418032 GTCCTTTCTCCCTTCCAGTTGGG - Intronic
952339206 3:32431553-32431575 CTCAGTGCTCACTCCCAGGTGGG + Intronic
952517886 3:34124305-34124327 CTTGGTTCTCTCTCCCAGTGTGG + Intergenic
952700051 3:36318087-36318109 CTCACTTCTCACTTCTACTTAGG + Intergenic
953993380 3:47500986-47501008 CTCACTTCACTCTTGCAGTCAGG + Intronic
954607292 3:51922374-51922396 CTCTGTTCTCTCTTCTTTTTAGG - Intergenic
957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG + Intergenic
960403812 3:117235559-117235581 CTCATTTCTGCCTTCCAGTTGGG - Intergenic
961176924 3:124843194-124843216 CTCAGTTCCTTCTTCCAGCTGGG - Intronic
961440733 3:126951692-126951714 GTCAGTTCCCTCATCCAGCTGGG + Intronic
961493905 3:127276632-127276654 CTCTGTCCTCTCTTCCAGGTGGG + Intergenic
963371977 3:144412418-144412440 CTCAGGTGTCTCTCCCACTTTGG + Intergenic
965205731 3:165717896-165717918 CTCTGTCCTCTCTTCCAGAAGGG - Intergenic
967607101 3:191459669-191459691 CTCCCTTCTATTTTCCAGTTGGG - Intergenic
971393512 4:26207518-26207540 CTTAGTTCACTTTTCTAGTTTGG + Intronic
971838686 4:31803127-31803149 CTCAGTGCTCTACTCCACTTGGG + Intergenic
973040827 4:45468417-45468439 CCTATTTCTCTCTTCCTGTTAGG + Intergenic
975484471 4:74919394-74919416 TTCAGTTCTCACTGCCAGCTTGG + Intergenic
975610395 4:76196985-76197007 CCCAGTTTCCTCCTCCAGTTAGG - Intronic
976922293 4:90455386-90455408 CTCTGTTCTCTCTTCCAGAAGGG - Intronic
978625074 4:110676096-110676118 CTCAGTTCTCTCTCCTACTTAGG - Intergenic
978799055 4:112737682-112737704 CTCAGTTCTTGCTGCCAGCTGGG + Intergenic
979454276 4:120908949-120908971 ATCACTTCTCTCCTCCAGATGGG + Intronic
981445132 4:144827838-144827860 CTGAGTTTACTCTTTCAGTTTGG - Intergenic
982928590 4:161371815-161371837 ATCATTTCTCTCTTGCTGTTAGG + Intergenic
983969444 4:173853042-173853064 GTCTGTTCACCCTTCCAGTTAGG + Intergenic
984247389 4:177291583-177291605 CTCCTTTCTCTATTCCAGTCAGG - Intergenic
985005285 4:185528992-185529014 TTCAGCTCTCTCTTCTAATTTGG - Intronic
985116608 4:186598307-186598329 CTGAGTTCTCTCTTCAATTCTGG - Intronic
986538118 5:8813935-8813957 CTCAGTTGTCTCTTCAACTAAGG + Intergenic
988950560 5:36254799-36254821 CCCTGTGCTCTCTTTCAGTTTGG + Intronic
989466731 5:41765191-41765213 CCCAGATCTCTATTCCAGTTAGG + Intronic
990499232 5:56378803-56378825 ATATGTTCTTTCTTCCAGTTTGG - Intergenic
991989115 5:72320144-72320166 CTCAGCTCTCTCCTGCAGGTTGG - Exonic
992076545 5:73197566-73197588 CTCAGGGCTCTCTTGCACTTTGG + Intergenic
994245370 5:97471036-97471058 CTCTGTCCTCTCTTCCAGCCTGG + Intergenic
996753820 5:126915722-126915744 CTCATTACTCGCTTTCAGTTTGG - Intronic
997720217 5:136072163-136072185 CTCTTTTCTCTCTTGCTGTTAGG - Intergenic
998771091 5:145546604-145546626 ATCAATTATCTCTTCCAGATAGG + Intronic
999081683 5:148850243-148850265 CTCAGATCCCTTTTCCGGTTGGG - Intergenic
1000593524 5:163186978-163187000 CTCAGTTCTCTGGTCCAGATCGG + Intergenic
1000972511 5:167729611-167729633 ATCAATTTTCTCTTGCAGTTTGG + Intronic
1001998109 5:176178285-176178307 CACATTTGTCTCTTCCATTTAGG + Intergenic
1003398231 6:5771182-5771204 CTCAGTTCTCCACTGCAGTTGGG + Intronic
1004092937 6:12523807-12523829 CTGACTTCTCTCTTCCTATTTGG + Intergenic
1005290955 6:24378346-24378368 CTCTCTGCTCTCTGCCAGTTTGG - Intergenic
1005746654 6:28844345-28844367 TTTAGTTTTCTTTTCCAGTTTGG - Intergenic
1005766590 6:29016982-29017004 CGCTGTTCTCTCTTCCTCTTTGG - Intergenic
1005946611 6:30600556-30600578 CCCAGTTCTCTCCTTCACTTTGG - Exonic
1007728604 6:43932176-43932198 CTCATTTTTCTCTTCCCCTTAGG - Intergenic
1007778070 6:44234782-44234804 CTCTGGTCTCACTTCCAGTCAGG - Intergenic
1014146493 6:118003813-118003835 CTCATTTCTCTCTGCCAGGAAGG - Intronic
1014375744 6:120670969-120670991 TTCACTTCTCTTTTCCAGCTCGG - Intergenic
1014380991 6:120742069-120742091 CTCAGATTTCTCATCAAGTTAGG + Intergenic
1014871363 6:126600533-126600555 CTAAGTTCTTCCTTCCACTTTGG + Intergenic
1015292260 6:131550639-131550661 CTGAGTGCTCTATTCCATTTAGG - Intergenic
1016283555 6:142447781-142447803 GTTAGTTCACTCTTCCATTTGGG + Intergenic
1016306924 6:142694517-142694539 AGCACTTCTCTCTTCCTGTTGGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018883037 6:167904236-167904258 GTCTGCTCTCTCTCCCAGTTTGG + Intronic
1019046405 6:169151554-169151576 CCCAACTTTCTCTTCCAGTTTGG - Intergenic
1021549278 7:21852573-21852595 CTCCAATCTCTCTACCAGTTTGG - Exonic
1021638449 7:22714456-22714478 CTGAGTTCTCTCTTGCATTCTGG - Intergenic
1021799500 7:24290167-24290189 CTCAGGACTTTCTTGCAGTTTGG + Intronic
1021935526 7:25627203-25627225 CTCATTTCTCTTTTACATTTGGG - Intergenic
1022081330 7:27024794-27024816 ATCAGTTGTCTTTTCCAGCTTGG - Intergenic
1023009023 7:35908689-35908711 CTTTGTTCTCTCTTCGAGGTGGG + Intergenic
1023072031 7:36444647-36444669 CTTATTTCTATTTTCCAGTTTGG - Intronic
1026534143 7:71226452-71226474 CTCAGTCCTCTGTTCCACTGGGG + Intronic
1030484184 7:110145680-110145702 TTCACTAGTCTCTTCCAGTTTGG + Intergenic
1030601073 7:111593121-111593143 CTCAGTTCTCTCATCAGCTTAGG - Intergenic
1030888958 7:114973504-114973526 CTCAGCTTTCCCTTGCAGTTAGG - Intronic
1032520146 7:132537690-132537712 TTCACTTCTCTCTTCCTGTCTGG - Intronic
1032706714 7:134426412-134426434 CTGAGTTCTCACTTGCGGTTGGG - Intergenic
1033213291 7:139476386-139476408 CTCTCTTCTCTGTTCCAGTCTGG - Intronic
1033227351 7:139572548-139572570 CTCTCTTCTCCTTTCCAGTTTGG + Exonic
1035608090 8:942399-942421 TTCTGTTCTCTCCTCCAGGTGGG - Intergenic
1038055851 8:23856902-23856924 CTCAGTGCTCTCTTCCAGAAAGG + Intergenic
1039341130 8:36651351-36651373 CTAAGTTTTCTCTTCTTGTTGGG - Intergenic
1039527580 8:38230815-38230837 CTCAGTTATGTCTTCCTGTTTGG + Intronic
1039617893 8:38970934-38970956 CTAAGTTCTCTCTTCCTTTAGGG - Exonic
1040942266 8:52845513-52845535 TTCTGTTCTCCCTTCCAGATAGG + Intergenic
1041676605 8:60546459-60546481 CTCAGCCCTCTCTCCCTGTTTGG - Intronic
1042581255 8:70281434-70281456 CTTAAATCTCTCTTCCACTTAGG + Intronic
1045488168 8:102650181-102650203 CTCACTTCCATCTGCCAGTTTGG + Exonic
1045920385 8:107522154-107522176 TTAAGTTCTCTCCTCCATTTAGG - Intergenic
1046275572 8:111955628-111955650 CTGAGTTCTCTCTACCATTCAGG - Intergenic
1047967437 8:130056752-130056774 CTCAGTTCTGTCTGCCAGGAAGG - Intronic
1047973418 8:130106753-130106775 TTCAATGCACTCTTCCAGTTAGG - Intronic
1048810272 8:138279482-138279504 CTAAATTCTGCCTTCCAGTTGGG - Intronic
1049679739 8:143912826-143912848 CGCAGTTCTCTGTTGCAGTCGGG - Intergenic
1049755695 8:144310426-144310448 CTCAGGTCTCACGTCCACTTTGG + Intronic
1051951540 9:22640239-22640261 CTAGATTCTCTTTTCCAGTTAGG + Intergenic
1051993332 9:23180896-23180918 CCCAGTTCTCTCTGCTAGTGTGG - Intergenic
1052201836 9:25791898-25791920 CTAAGTAATCTCTTCCATTTAGG + Intergenic
1052581346 9:30359167-30359189 ATTAGTTCTCCCTTCCAGTGGGG - Intergenic
1057930322 9:99187485-99187507 CTCACTTCTGTTTTCCAATTTGG + Intergenic
1059580544 9:115543217-115543239 CTCAGTTTTCACCTCCAGTATGG - Intergenic
1186051021 X:5595722-5595744 CTCTGTTCTCTTTACAAGTTTGG + Intergenic
1186336158 X:8590901-8590923 CTCAGATCTCTTTTCCAGCATGG + Intronic
1187358600 X:18602546-18602568 CTCACTAATCTCTTCCAGTTAGG - Intronic
1188455974 X:30366277-30366299 CTCATTTCTCTCTTCTATGTGGG - Intergenic
1188609174 X:32074906-32074928 CTCAGCTCTCTTTTCCTCTTCGG - Intronic
1189294193 X:39907351-39907373 CTCCGTTCTCTGTTCCAGCTCGG - Intergenic
1189592399 X:42529114-42529136 CTCACTCCTCCCTTCCACTTGGG + Intergenic
1189600329 X:42617179-42617201 CTCAGTTCAGTCTTCTAGCTAGG + Intergenic
1189608865 X:42709918-42709940 CTCTGTTCTCTCTTCCCTTCTGG + Intergenic
1189656555 X:43250916-43250938 CTCATTTCTCCCTTTCAGTATGG - Intergenic
1189817300 X:44836652-44836674 CCCAGCTCTCTTTTCCAATTTGG - Intergenic
1192172982 X:68868222-68868244 CTCAGCTCTCTCTCCCCGTGTGG + Intergenic
1195111919 X:101658125-101658147 CTCAGGTCTGTCTTCCTTTTGGG - Exonic
1197866942 X:131029034-131029056 CTCAATTTTCTCTTCCATTTCGG - Intergenic
1198070524 X:133143872-133143894 GTGTCTTCTCTCTTCCAGTTTGG + Intergenic
1200440875 Y:3210700-3210722 CTCAGTACTCTCCTCAACTTTGG + Intergenic
1201427268 Y:13866137-13866159 CTCAGATCTCTTTTCCAGCGTGG - Intergenic