ID: 932840075

View in Genome Browser
Species Human (GRCh38)
Location 2:75073652-75073674
Sequence CAGTGGGTCTGGGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 801
Summary {0: 1, 1: 1, 2: 6, 3: 67, 4: 726}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932840061_932840075 5 Left 932840061 2:75073624-75073646 CCACTGAGGCTGGTCTGGCAGGA 0: 1
1: 0
2: 3
3: 22
4: 275
Right 932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG 0: 1
1: 1
2: 6
3: 67
4: 726
932840059_932840075 6 Left 932840059 2:75073623-75073645 CCCACTGAGGCTGGTCTGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 192
Right 932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG 0: 1
1: 1
2: 6
3: 67
4: 726

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932840075 Original CRISPR CAGTGGGTCTGGGGGGAGGT GGG Intronic
900100162 1:959117-959139 CAGCGGGGCTGGGGCGAGCTGGG - Intronic
900101633 1:964536-964558 CAGTGGGGCTGCGGGGAGGGGGG + Intronic
900131048 1:1087400-1087422 CAGTGGCTCTGGGGCAAGGTGGG + Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900489713 1:2941699-2941721 CAGTGTGTCTGGGGAGAGTGTGG + Intergenic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
900871300 1:5305529-5305551 CAGTGGGTCTGGGGCGGGCTGGG - Intergenic
900964038 1:5945203-5945225 CAGGGGCTGTGGGGGGAGGTGGG - Intronic
900995970 1:6123958-6123980 CAGCGGGGCTGGCAGGAGGTGGG + Exonic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
902355989 1:15900870-15900892 CAGTGGGGGTGGGGTGGGGTAGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902797986 1:18811749-18811771 CAGGGGGTCTGGTGTGAGCTGGG - Intergenic
903016938 1:20367305-20367327 CGGTGGGACTGGGGAGATGTAGG - Intergenic
903140473 1:21335909-21335931 CAGTGGGTCTCCAGGGAGGGAGG + Intronic
903318376 1:22526621-22526643 CAGCGGGCCTGTGGGGAGGGAGG - Exonic
903330647 1:22595376-22595398 CGGTGGGGCTGGGGGCAGGCAGG - Intronic
903349582 1:22710165-22710187 GGGTGGGGCTGGGGGGAGGGTGG - Intergenic
903477430 1:23629171-23629193 CAGTGGGGCTGGGGCAAGGGAGG - Intronic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903795720 1:25927564-25927586 CAGGGGGTCAGGGGGGTGGGGGG + Intergenic
903798182 1:25946103-25946125 CAGTGAGTCTGGGGGCTGGCAGG + Intergenic
904330030 1:29752817-29752839 AAATGGGTCTGGGGGTGGGTGGG + Intergenic
905218295 1:36425924-36425946 CCGGGAGTCTGGGGGGAGGCAGG + Intronic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905668687 1:39777736-39777758 GGGAGGGTCTGAGGGGAGGTGGG - Intronic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
905733774 1:40312819-40312841 CTGTGGGTCAGGGAGCAGGTTGG - Intronic
906036253 1:42751870-42751892 CAGTGGGGGTGTGGGGACGTGGG - Intronic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907449306 1:54532953-54532975 CAGGGTCTCTGGGGGGAGGGGGG + Intergenic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908327983 1:63042550-63042572 CTCTCGGTCTGGGGGGATGTGGG + Intergenic
908703827 1:66930067-66930089 AGGTGGGTGTGGGAGGAGGTGGG - Intronic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
910276221 1:85451755-85451777 TTGTGGGTCTGGGAGCAGGTGGG + Intronic
910281342 1:85504876-85504898 CAGTGGGTCTGGCATGGGGTAGG - Intronic
910758734 1:90716198-90716220 GAATGGGAATGGGGGGAGGTAGG - Intronic
911087156 1:93988600-93988622 CAATGGGTGTGGGGGGGGGGGGG + Intergenic
911760993 1:101616541-101616563 CAGTAGGTGCGGGGTGAGGTTGG + Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915345609 1:155195375-155195397 AAGTGGGTCTGGGAGGACTTCGG + Intergenic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915572428 1:156751744-156751766 GAGTGGGTCCGGGAGGAGGGAGG - Intronic
915659601 1:157391561-157391583 CAGTAGGTGTGGGTGCAGGTGGG - Intergenic
917266365 1:173224869-173224891 CAGAGGGTCTAGGTGGAGGGAGG - Intergenic
917359934 1:174164101-174164123 CAATGGGTTGGGGGGCAGGTAGG - Intronic
917362033 1:174187212-174187234 TAGTGGGCTTGTGGGGAGGTTGG - Intronic
917906069 1:179588155-179588177 CTGTTGGTGTGAGGGGAGGTGGG - Intergenic
919801835 1:201359046-201359068 GAGTGGGTGTGGGGGCAGGCAGG + Exonic
921285408 1:213604835-213604857 CTGTGGGTCTGGGGAAGGGTGGG + Intergenic
921790574 1:219285702-219285724 CTTAGGGTCTGAGGGGAGGTAGG + Intergenic
922415067 1:225414023-225414045 AGGTGAGTCTGGGGTGAGGTGGG - Intronic
922702486 1:227769979-227770001 CACTGGGTCTGGCGGGAGAGTGG + Intronic
922738822 1:228004627-228004649 CAGTGGGGCTGGGCTGGGGTGGG - Intergenic
923274217 1:232382926-232382948 CAGTGGGTGTGTGAGGAGGGAGG + Intergenic
923630462 1:235646354-235646376 CAGCGGGTTTGGTGGGTGGTGGG - Intronic
924708773 1:246518173-246518195 CAGCGGGCCTGGGTGGTGGTGGG - Intergenic
924820657 1:247487366-247487388 CAGTGAATGTGGGGAGAGGTAGG + Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
924931675 1:248737814-248737836 CAGTGGGTCATGGGGGATGGTGG + Intronic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063313788 10:4982573-4982595 CAGTGGGTCCAGGGTTAGGTGGG - Exonic
1063314120 10:4984819-4984841 CAGTGGGTCTAGGGTTAGGTGGG + Intronic
1063338862 10:5244255-5244277 CATTTGGTCTGGGGGATGGTGGG + Intergenic
1063346128 10:5313788-5313810 CAGGGGTTGTGGTGGGAGGTGGG + Intergenic
1064482795 10:15756489-15756511 CAGTGGGTCGGGGGGAAGGGGGG + Intergenic
1065967842 10:30783608-30783630 TGGTGGGACTGGGAGGAGGTAGG - Intergenic
1066486633 10:35852076-35852098 CAGTGGGTTTGGGGGCAGAGGGG + Intergenic
1066758175 10:38730794-38730816 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1066963510 10:42241922-42241944 CACGGGGACTGGGGGGAGGGGGG + Intergenic
1067838487 10:49656685-49656707 CAGTGGGGCAGGGGAGATGTTGG + Intronic
1067897206 10:50196373-50196395 CAGTTTTTCTGGGGGGAGGAGGG - Intronic
1067951766 10:50745652-50745674 CAGTTTTTCTGGGGGGAGGAGGG + Intronic
1068577179 10:58697790-58697812 CAGGGGGTGTGGGTGGAGGTTGG - Intronic
1068577196 10:58697875-58697897 CAGGGGGTGTGGGTGGAGTTTGG - Intronic
1069642104 10:69962740-69962762 CAGTGGGCCTGAGAGGAGGGAGG - Intronic
1069727052 10:70586779-70586801 CAGTGTGTGTGGTGGGGGGTTGG + Intergenic
1069989559 10:72306479-72306501 CAGTGATTCTGAGGGTAGGTAGG - Intergenic
1070567194 10:77612913-77612935 CAGTGGGGGTGGGGGGAGTAGGG - Intronic
1071147341 10:82590565-82590587 CAGTAGGTCTGTGGGGAGCAGGG - Intronic
1071294119 10:84206871-84206893 CTGTGGGGCTGAGGGTAGGTGGG + Intronic
1071430240 10:85601418-85601440 CAGGGAGACTGGGCGGAGGTGGG - Exonic
1071526531 10:86362865-86362887 CAGTGGGTGTAGTGGGAGGTGGG - Intronic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072221388 10:93330516-93330538 CAGTGGGTCTGGGAGAAGAGGGG - Intronic
1072271735 10:93783506-93783528 CAGTGGGGCTGTGGGGAGGGAGG + Intronic
1072341818 10:94459587-94459609 CAGGGGGGTTGGGGGGAGCTCGG + Intronic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072924020 10:99600344-99600366 CCCTGGGTATGGTGGGAGGTAGG - Intergenic
1073075937 10:100825972-100825994 CAGGGAGTCTGCAGGGAGGTGGG + Intronic
1073155287 10:101341695-101341717 CAGGAGGTCTGGGAGCAGGTTGG - Intergenic
1073533645 10:104255083-104255105 CAGTGGGACGCGGGGGCGGTGGG + Intronic
1074473040 10:113744578-113744600 CAGGGGGGCTGGGGTGGGGTAGG - Intergenic
1074532599 10:114307174-114307196 CAGAGGGTATGGGTGCAGGTAGG - Intronic
1075977225 10:126706420-126706442 CAGTGGGTCTGAGGGTAGGGTGG - Intergenic
1076379563 10:130015771-130015793 CAGTGGGCCTGGGGCCAGGCGGG + Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076482186 10:130792119-130792141 CAGGGGCTCTGGGAGGGGGTGGG - Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076764848 10:132627405-132627427 AGGTGGGTCTGGAGGGCGGTGGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077050273 11:563322-563344 GAGTGGTTCTGGGGGGAGGCTGG + Intronic
1077223388 11:1427126-1427148 CAGTGGGGCTGTGGGGAGAGAGG - Intronic
1077281818 11:1749385-1749407 CAGTGGGTCCGGGGAGATGGAGG - Intronic
1077364896 11:2157666-2157688 CATTGGGCCTGGGGGGATGGAGG + Intronic
1077395091 11:2316677-2316699 CAGAGGGTGTGGGGGCAGGCAGG - Intronic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077538535 11:3135748-3135770 CAGTGGCTCTGGGTGTGGGTGGG - Intronic
1077675795 11:4192128-4192150 CAGTGGGTCTGGGGGGCCTCAGG + Intergenic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1078308782 11:10218317-10218339 CATTGGGTGGGGGGGGGGGTGGG - Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078654149 11:13222511-13222533 CTGTGAGTCAGAGGGGAGGTTGG - Intergenic
1079089617 11:17471412-17471434 CAGTGGGTCTGGTGGGACTGAGG + Intronic
1079184061 11:18220786-18220808 CAGTGGGTCTGGAGGGTCCTGGG + Intronic
1079921582 11:26440064-26440086 CACTGGGTGTGGGCGGAGGGCGG + Intronic
1080277846 11:30523294-30523316 CAGGCAGGCTGGGGGGAGGTGGG + Intronic
1081539290 11:44018377-44018399 GAGTGGGGCTGGGGCGAGTTGGG - Intergenic
1081549868 11:44101099-44101121 CAGTGGGTTGGGGGTGGGGTGGG + Intronic
1081622015 11:44624255-44624277 CAGAGGGGCTGTGTGGAGGTGGG + Intergenic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083594234 11:63911448-63911470 CAATAAGTCTGGGGTGAGGTGGG - Exonic
1083830115 11:65226027-65226049 CAGTGTGTCTGGGGTGAGGTGGG + Intergenic
1083997182 11:66278337-66278359 CCGTGGGGCTCGGGGGACGTGGG - Exonic
1084547230 11:69820470-69820492 CAGGGGCTCTGGGGTGAGTTGGG + Intergenic
1084965077 11:72740218-72740240 CAGTGGACCTGGTGGGAGGCAGG + Intronic
1085029218 11:73259504-73259526 CAGTGGGTCGGTGAGGAGGCTGG - Intergenic
1085048895 11:73369409-73369431 CAGTGGGCCTGGATGGAGCTTGG + Intergenic
1085322701 11:75584392-75584414 CCCTGGGGCTGGGGGGAGGATGG - Intergenic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085407102 11:76269891-76269913 CACTGGGGCTGGGGGAAGATGGG - Intergenic
1085980784 11:81721689-81721711 CAGTGGGTCAGTGGAGAGATTGG + Intergenic
1086010252 11:82094215-82094237 AAGTGAGTCTGAGGTGAGGTTGG - Intergenic
1086508052 11:87526918-87526940 CAATGGATGTGGGGGGAGATGGG - Intergenic
1086817747 11:91394233-91394255 CAGAGGGTCAGAGGTGAGGTAGG - Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087278689 11:96185971-96185993 CAGTAGGTCTGGGGAGGGGCTGG - Intronic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1087884392 11:103460476-103460498 CAGTGGGTGGGGTGGGGGGTGGG + Intronic
1088269582 11:108020026-108020048 CAGTGGGGGTGGGGGCAGGGTGG - Intronic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089529470 11:119116921-119116943 CAGTGGCTCTGTGGGAAGGAGGG + Exonic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089628316 11:119765953-119765975 CAGTGGTTGTGGGGGGCAGTGGG - Intergenic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1091209292 11:133842915-133842937 CAGTGGGTGTGGGGTGATGCAGG - Intronic
1091251158 11:134145450-134145472 CAGTGGTGGTGGTGGGAGGTGGG + Intronic
1091278839 11:134370533-134370555 CAGGGAGTGTGGGGGGAGGCAGG + Intronic
1091412707 12:254642-254664 TAGTGGGTCTGGGAGAAGATGGG - Intronic
1091630250 12:2154514-2154536 CAGTGGGTCAGGGAAGAGGCTGG + Intronic
1092118894 12:6029932-6029954 CAGTGGCTCTGGGGAGGGGGAGG - Intronic
1092698353 12:11199488-11199510 CAGTGGGGCAGGGGAGGGGTGGG - Intergenic
1092971517 12:13700097-13700119 CTGTCTGTCTGTGGGGAGGTGGG + Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1095195621 12:39312380-39312402 CAGTGGGGGTTGGGAGAGGTGGG + Intronic
1095329251 12:40937952-40937974 CAGTAGGTCTGGGGTGAGCCTGG - Intronic
1095975656 12:47939368-47939390 GGGTGGGGCTTGGGGGAGGTGGG - Intronic
1096009889 12:48203953-48203975 GAGTGAGTCTGGGAAGAGGTGGG - Intergenic
1096153936 12:49331443-49331465 CAGTGAGCCTGATGGGAGGTGGG + Intronic
1096806910 12:54146567-54146589 CAGTGGGGGTGGGGGGAGAGTGG - Intergenic
1097221247 12:57452457-57452479 CAGTGAGGGTGGGGAGAGGTGGG + Intronic
1098013528 12:66080190-66080212 CACTGGGTCAGGGGAGGGGTGGG - Intergenic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1099328157 12:81245996-81246018 CAGTGCCTCTGGGGAGAGGAAGG + Intronic
1100031134 12:90192774-90192796 CAGGGGCTGTGGGGGTAGGTGGG + Intergenic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1101812910 12:108123068-108123090 CAGTGCTTCTGGGGGAAGGAAGG + Intergenic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1102173604 12:110860283-110860305 CAGTGGGTCTGGGGGGCAAGTGG + Intronic
1102795289 12:115683874-115683896 GAATGGGTCAGTGGGGAGGTAGG + Intergenic
1103253556 12:119521740-119521762 CAGTGATTCAGGGAGGAGGTGGG - Intronic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1104178115 12:126352055-126352077 CAGTGGGTCAGGGAAGAGGGAGG + Intergenic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104842542 12:131831895-131831917 GAGAGGATCTGGGGGGAGATGGG + Intronic
1104876880 12:132041045-132041067 CAGTGGGTGTGTGAGGAGGATGG + Intronic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105458210 13:20560428-20560450 CAGTGGGCTTGAGGGGAGATTGG - Intergenic
1106207852 13:27616160-27616182 CAGGGGGTCGGGGGTGGGGTGGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1107502348 13:40993384-40993406 CGATGGGTCTGGGGGGAGCGGGG + Intronic
1108203723 13:48067181-48067203 CAGTGGTTGGGGGGGGAGGGAGG - Intronic
1108586609 13:51875582-51875604 CAGTGGGTCTGGAGAGGGGTAGG - Intergenic
1109336136 13:60997158-60997180 GAGTGGGTTAGGGGAGAGGTGGG - Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1111682977 13:91466722-91466744 GAGTGGGACTGGGGAGAGGGAGG + Intronic
1111849844 13:93559027-93559049 CAGTGGTTGTGGGGAGTGGTAGG + Intronic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1113565962 13:111320073-111320095 CAGAGGTCCTGGGGGGAGGCTGG - Intronic
1113782089 13:112982585-112982607 CATTGTGTCTGGTGGGAGGCGGG + Intronic
1113782822 13:112986484-112986506 CAGTGGGACCGTGGGGAGGTGGG - Intronic
1113854845 13:113437477-113437499 CAGTGGGGCTTGGGAGAGGCAGG - Intronic
1114243823 14:20893962-20893984 GAGAGGGTGTGGGGGCAGGTGGG - Intergenic
1114549292 14:23523926-23523948 CACTGGGTGGAGGGGGAGGTAGG + Exonic
1114617612 14:24076582-24076604 GAGTGTGTCTGCGGGGAGGCGGG - Intronic
1114683736 14:24508006-24508028 CAGTGGGTGGGGGTGGGGGTGGG + Intronic
1115065310 14:29252883-29252905 CAGTGGTTCTGAGGAGAGTTTGG + Intergenic
1115500695 14:34046929-34046951 GAATGGGCCTGGGAGGAGGTAGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1118355787 14:65012507-65012529 CTGTGGCTCTGGCAGGAGGTAGG + Intronic
1119086433 14:71743563-71743585 CAGGGGATGTGGGGTGAGGTGGG + Intergenic
1119709856 14:76813681-76813703 CAGTGTGTATGGGGGGTGCTGGG - Intronic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1120415837 14:84216960-84216982 TAGTGGGTCTTGGAGGAGGCTGG + Intergenic
1121002893 14:90464833-90464855 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
1121264252 14:92589035-92589057 CAGAGGGTCTGGGTGAATGTGGG - Intronic
1121309850 14:92929824-92929846 CAGCCGGTCTGGCCGGAGGTGGG + Intronic
1121630410 14:95417819-95417841 CAGTGGGTTAGGTGGGTGGTGGG + Exonic
1121678196 14:95771456-95771478 CAGTGGGGAAGGGGGCAGGTAGG + Intergenic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1122301513 14:100733915-100733937 CAGTAGCTCTGGGGGTGGGTGGG - Intronic
1122413482 14:101537711-101537733 GAGTGGGGCTGGGGTGTGGTGGG + Intergenic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122636736 14:103133529-103133551 CAGAGGGGCTTGGGAGAGGTGGG - Intronic
1122906821 14:104805451-104805473 CGGTGGGTGTGGGAGGGGGTAGG - Intergenic
1122965407 14:105121838-105121860 CAGGGAGTCTGGAGGGCGGTTGG + Intergenic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1123114902 14:105890245-105890267 CAGAGGGTCTGGGCAGTGGTAGG + Intergenic
1123441578 15:20295508-20295530 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1123909854 15:24955756-24955778 CAGTGGGTATTGGCGGCGGTGGG + Intronic
1125922687 15:43534936-43534958 CAGGGGGTCTCTGTGGAGGTTGG - Exonic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1126746340 15:51829791-51829813 CCGTGGGTCTGTGAAGAGGTCGG + Exonic
1128139158 15:65286659-65286681 CCGCGGGTCGGCGGGGAGGTTGG + Exonic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1128727496 15:69998896-69998918 CAGTGGGGCTGGGGAGTGGCAGG - Intergenic
1128742765 15:70095544-70095566 CCGCGGGCCTGGGGGGCGGTTGG - Intronic
1128866652 15:71119619-71119641 CAGTGAGTCTGGTGGCAGGTGGG - Intronic
1129683959 15:77674260-77674282 CAGGGAGTCTTGGTGGAGGTGGG - Intronic
1129695049 15:77735674-77735696 CAGTAGGTCCTGGGGGTGGTGGG + Intronic
1129730311 15:77926790-77926812 CATGGGGTCGGGAGGGAGGTAGG + Intergenic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130354048 15:83113915-83113937 CAGTGGGCCTTGGGAAAGGTGGG + Intronic
1131285520 15:91053789-91053811 CAGTGGGCCTGGGGTTAGGGAGG - Intergenic
1132655718 16:1040986-1041008 CTGGGGGTCTGGGAGGAGATGGG - Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655779 16:1041169-1041191 CTGGGGGTCTGGGAGCAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132887738 16:2189871-2189893 CTGTGGGTTTGGGGGGTGCTAGG + Intronic
1132991779 16:2799123-2799145 AAGTGAGTCTGGGGGGCGGCCGG + Intergenic
1133033711 16:3023453-3023475 CAGTGAGTTTGGGGGCAGGGAGG - Exonic
1133061813 16:3179854-3179876 CAGAGGGTCCGGGTGGAGGGAGG + Intergenic
1133269534 16:4603893-4603915 CAGTGGGTGTGGGGGGTTGGAGG - Intergenic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133966017 16:10532186-10532208 CTGTAGGTCTGGGGTGAGGGGGG + Exonic
1134534243 16:15012745-15012767 CAGAGGCTTTGGTGGGAGGTTGG + Intronic
1134915530 16:18067580-18067602 TCGAGGGTCTGGGGGGAAGTGGG + Intergenic
1135520464 16:23172938-23172960 CAGTGGGGCTGGGGAGGGGCTGG - Intergenic
1135619888 16:23946743-23946765 CAGTAGGTCTGGGGAGGGGCCGG + Intronic
1136135718 16:28255821-28255843 CCATGGGGCTGGGGGGAGGCGGG + Intergenic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136567763 16:31080309-31080331 GAGTAGGTCTTGGGGCAGGTGGG - Exonic
1136724658 16:32348402-32348424 CACGGGGACTGGGGGGAGGGGGG + Intergenic
1136842985 16:33554442-33554464 CACGGGGACTGGGGGGAGGGGGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137527902 16:49252614-49252636 CAGAGGATTTGGGGTGAGGTAGG + Intergenic
1137530516 16:49276166-49276188 CAGAGGGCCTGGGGAGATGTGGG - Intergenic
1137628068 16:49921982-49922004 CAATGGGTCTGTGAGGAGGCAGG - Intergenic
1137768632 16:50996812-50996834 CAGTGGGGCTGGGGGAGGGTGGG - Intergenic
1138419169 16:56888030-56888052 CAGTGAGTCGGGGGAGAGGAAGG + Exonic
1138482576 16:57313317-57313339 CAGAGGGTATGAGGGGAGGCTGG + Intergenic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139861799 16:70027984-70028006 CAGAGGCTTTGGTGGGAGGTTGG - Intergenic
1140224467 16:73066864-73066886 CCGCGGGGCTGGGGGGAGGAGGG - Intergenic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1140716465 16:77730273-77730295 GAGGTGGTTTGGGGGGAGGTTGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141555723 16:84835491-84835513 CAGAGGGCCTGGGGGTGGGTCGG - Intronic
1141758505 16:86011121-86011143 CAGTGGAGCTCGGGGGAGGCAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141992685 16:87619674-87619696 CACGGAGTCTGGGGGGATGTTGG + Intronic
1142227580 16:88885074-88885096 CCGGGGGTCTGGGTGGCGGTAGG + Exonic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142326446 16:89418474-89418496 CAGTGGGTCATGGGAGAGGAAGG - Intronic
1142399506 16:89852016-89852038 CAGGGGATCTGGGGGGTGGGGGG - Intronic
1142399742 16:89852601-89852623 CAGGGGATCTGGGGGGTGGAGGG - Intronic
1203001772 16_KI270728v1_random:169353-169375 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1203133375 16_KI270728v1_random:1705759-1705781 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1203153150 16_KI270728v1_random:1854740-1854762 CACGGGGACTGGGGGGAGGGGGG + Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142475277 17:185080-185102 GAGAGGGTCTGTGGGGAGTTGGG - Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142631087 17:1227296-1227318 ATGTGGGTCTGGGGGGAGACAGG + Intronic
1142738652 17:1917682-1917704 CAGTGGGTCTGGGAGCAGCCTGG - Intergenic
1142847590 17:2689790-2689812 CAGTGGGCCGGGGGCGAGGCTGG - Exonic
1142848675 17:2694090-2694112 AGGTGGGGCTGGGTGGAGGTGGG - Intronic
1143058092 17:4177460-4177482 GAGTGGGTCTGTGGGTGGGTTGG - Intronic
1143460872 17:7102666-7102688 CAGTGGGTCTGGGGTCTGGGGGG - Intronic
1143545529 17:7593014-7593036 AAGTGGGCCGGGGGGCAGGTGGG + Exonic
1143815110 17:9506655-9506677 CAGTGGCAGTGGGGGCAGGTGGG - Intronic
1144011249 17:11150396-11150418 AAGTGGGGCTGGGGGGAGTGGGG - Intergenic
1144686419 17:17228976-17228998 CAGGGGGCCAGGGTGGAGGTGGG + Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1144875354 17:18394479-18394501 CAGAGGATCCCGGGGGAGGTAGG + Intergenic
1144965808 17:19076676-19076698 CAGTGGGGCGGTGGGGCGGTGGG + Intergenic
1144982160 17:19175506-19175528 CAGTGGGGCGGTGGGGCGGTGGG - Intergenic
1144986063 17:19202733-19202755 CAGTGGGGCGGTGGGGCGGTGGG + Intergenic
1145156871 17:20549942-20549964 CAGAGGATCCCGGGGGAGGTAGG - Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145879801 17:28344737-28344759 CAGAGGGTCTGGGCAGAGGAGGG + Exonic
1145880676 17:28350700-28350722 CTGGGGGTCAGGGTGGAGGTGGG - Intronic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1146675662 17:34772257-34772279 CTGTGGGTCTGTGGGCAGCTGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148082734 17:44976542-44976564 GAGTGGGGCTGGGGGCTGGTGGG - Intergenic
1148471064 17:47893721-47893743 CAGGGGTTTTGGGGGGAGGTAGG - Intergenic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1148842474 17:50508138-50508160 CAGCGGTTCTGGGGGGGGATCGG - Intergenic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149557935 17:57587553-57587575 CTTTGGGGCTGGGGGGAGTTGGG - Intronic
1150085893 17:62273097-62273119 CAGAGGATCCCGGGGGAGGTAGG - Intronic
1150635413 17:66909755-66909777 GAGTGGGTCTTGGGTCAGGTTGG + Intergenic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151368101 17:73630253-73630275 CAGTGGGTCTGGGAGGGGCCTGG - Intronic
1151447333 17:74175868-74175890 AAGTGTGTCTGGGTGGAGGTGGG - Intergenic
1151462710 17:74264239-74264261 CAGTGAGCCTGCGGGGAGGCTGG - Intergenic
1151495068 17:74454022-74454044 CAGTGAAGGTGGGGGGAGGTGGG + Intergenic
1151680749 17:75621458-75621480 CCATGGGTCTGGGGGGCCGTGGG - Intergenic
1151805987 17:76405729-76405751 CTGTGGGTCTGGGTGCTGGTCGG - Intronic
1152563445 17:81089854-81089876 CAGTGGGTGTGAGGTGAGGGTGG + Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1152926283 17:83089213-83089235 CAGTGGGTAGGGGTGGAGGGTGG - Intronic
1153601055 18:6781676-6781698 CAGTGTGTCAGGTGGGAGCTGGG - Intronic
1153641988 18:7165329-7165351 CAGTGGTTCTGGGGGGCTGGGGG + Intergenic
1153842899 18:9022997-9023019 CAGTGGGTGGGGGCGGGGGTGGG - Intergenic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1153873740 18:9346147-9346169 CTAGGGGACTGGGGGGAGGTAGG - Intronic
1153881072 18:9422226-9422248 CATTGGGGCGGGTGGGAGGTGGG + Intergenic
1154387081 18:13903694-13903716 GGGTGGTTCTGGAGGGAGGTGGG + Intronic
1154425152 18:14266199-14266221 CAGTGGGTTGTGGGGGTGGTAGG + Intergenic
1156683309 18:39616898-39616920 CCCTGTGTCTGGGGGGAGGGGGG + Intergenic
1156812055 18:41264215-41264237 CAGTGGGTGGGTGGGGAGGGGGG + Intergenic
1157104398 18:44759589-44759611 CAGTGTGTGTGGGGTGAGCTGGG + Intronic
1157531926 18:48428670-48428692 AAGTGGGTGTGGGGAGAGGGAGG - Intergenic
1157572846 18:48724367-48724389 CAGTGGGTGGGAGGGTAGGTGGG - Intronic
1157598483 18:48878262-48878284 CCATGGCTCCGGGGGGAGGTAGG - Intergenic
1157736619 18:50055227-50055249 CAGGGGGGCGGGGGTGAGGTGGG - Intronic
1158018753 18:52815453-52815475 CAGGGGGGCAGGGGGGTGGTGGG - Intronic
1158131569 18:54158194-54158216 CAGTATGTCTGGGGAGGGGTGGG - Intronic
1158628772 18:59093931-59093953 CAGTGGGTCCTGGGCGTGGTGGG - Intergenic
1159480858 18:68989613-68989635 CAGGGGGCCTGCGGGGAGGAAGG + Intronic
1160693683 19:472330-472352 CAGTGCTCCTGGGGGGAGATTGG + Intronic
1160912847 19:1482832-1482854 CAGAGCCCCTGGGGGGAGGTTGG + Intronic
1160936775 19:1599786-1599808 GAGTGGAGCTGGGGGGAGGCTGG + Intronic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161480043 19:4505875-4505897 CAGGGGGGCTGAGGGGAGGCCGG - Intronic
1161506781 19:4648445-4648467 CAATGGGTCAGGGAGGAGGAAGG + Intronic
1161581584 19:5083649-5083671 CAGAGGGGCTGGGAGGAGCTGGG - Intronic
1161683992 19:5694225-5694247 CAGGGGGTCTGGGCTGAGGGAGG - Intronic
1161731787 19:5965117-5965139 CAGTAGGTCTCTGAGGAGGTGGG + Intronic
1162318530 19:9956632-9956654 GACAGGGTCTGGGGGGAGGGGGG - Intergenic
1162387460 19:10368472-10368494 CATTGGGTCTGGGGGGTCTTTGG - Intronic
1162818981 19:13211513-13211535 GGGTGGGTCTGGGGGCAGCTGGG - Intronic
1163021439 19:14482860-14482882 CAGGGCCTCTGGGCGGAGGTGGG - Exonic
1163126514 19:15247176-15247198 GAGTGGGGCTGGGGGGTGGGTGG - Intronic
1163136822 19:15317592-15317614 CAATGGGAGTGGGGGGTGGTGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163659297 19:18567288-18567310 CAGTGGGTCTGGGGAAACCTGGG + Intronic
1164038520 19:21474397-21474419 GAATGGGGCGGGGGGGAGGTGGG - Intronic
1164289459 19:23854236-23854258 CAGTGGGCCTGGTGTTAGGTAGG - Intergenic
1164693272 19:30226207-30226229 AAGAGGGTCTGGGGGGTGGGGGG + Intergenic
1165573016 19:36791454-36791476 CAGTGGGGCTGAGGGGAGTAGGG - Intergenic
1166009962 19:39934820-39934842 CAGCGGGTCTGGAGGTGGGTTGG + Intergenic
1166111575 19:40626375-40626397 CAGGGGGTCTGGGGCCAGGATGG - Intronic
1167513594 19:49909954-49909976 CAGTCGGTTTGGAGGGTGGTGGG + Intronic
1167557853 19:50206637-50206659 GAGAGGGTCTGGGAGGAAGTGGG + Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1167726413 19:51216075-51216097 CAGTGGGTGTGGGGAGACTTTGG - Intergenic
1168163865 19:54533320-54533342 CAGCGTGTCTGGGGGTGGGTAGG + Intronic
926478991 2:13364487-13364509 CACTGGGTCTGTAGGGTGGTGGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927581155 2:24249352-24249374 CAGTCAGTTTGGGGGGAGGATGG - Intronic
928374706 2:30765056-30765078 CCATGGGTCGGGGTGGAGGTGGG - Intronic
928423343 2:31157225-31157247 CAGTTGGTCTTGGGAGAAGTCGG - Intergenic
928498592 2:31862924-31862946 AAATGGGATTGGGGGGAGGTGGG + Intergenic
929049764 2:37826173-37826195 CAGTGACCCTGGGGGGAGGGTGG + Intergenic
929125420 2:38519105-38519127 TAGTTGGTCTGAGGTGAGGTTGG - Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929579082 2:43070399-43070421 TGGTGGGGCTGGGTGGAGGTGGG - Intergenic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
929780252 2:44952669-44952691 CAGTGTGTCCCGGGCGAGGTAGG - Intergenic
930025496 2:47026900-47026922 CAGAGGCTCTGGGGTGAGGTTGG - Intronic
930713132 2:54568008-54568030 TAGGAGGTCTGTGGGGAGGTCGG - Intronic
931984370 2:67727415-67727437 CATTGTCTGTGGGGGGAGGTGGG + Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933157644 2:78993051-78993073 CAGCGCGTCTGAGGGGAGGCAGG - Intergenic
933775763 2:85770329-85770351 GAGTGGGGTTGAGGGGAGGTTGG + Intronic
933967342 2:87440774-87440796 CAGGGGCTGGGGGGGGAGGTGGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934321492 2:91975234-91975256 CACAGGGACTGGGGGGAGGGGGG - Intergenic
934513468 2:94967737-94967759 AAGTGGGGCTGGGAGGAGATAGG + Intergenic
934575928 2:95401652-95401674 CAGCGGGTCTGGGGAGAGGATGG - Intergenic
935708107 2:105873634-105873656 CAGTGAGGCTGGGGGAAGGGTGG + Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
936071395 2:109374101-109374123 GAGGGGGTGTGGGGGCAGGTGGG - Intronic
936086699 2:109474207-109474229 CAGTGGCTCTCTAGGGAGGTGGG + Intronic
936450459 2:112630086-112630108 CAATGAGGCTGGGGTGAGGTTGG + Intergenic
936677252 2:114729602-114729624 CAGTAGATCTGAGGGGAGGCTGG - Intronic
936929571 2:117773762-117773784 CAGCAGGTCTGGGGTGAGGCTGG - Intergenic
937323609 2:120975588-120975610 CAGTGGATATGGGTGCAGGTGGG + Intronic
940761408 2:157742888-157742910 CAGTGGGATAGGGTGGAGGTTGG - Intronic
941070992 2:160954311-160954333 CAGTGTGTCTGGGGTCAGGGAGG - Intergenic
941222571 2:162802085-162802107 CAGTAGGTCTTGTGTGAGGTTGG + Intronic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943356928 2:186867605-186867627 CAATCTATCTGGGGGGAGGTGGG - Intergenic
943428655 2:187769946-187769968 CATTGGGGCTGGGGCCAGGTTGG + Intergenic
943785632 2:191875487-191875509 CAGTGGCTTTGTGGAGAGGTTGG + Intergenic
943869473 2:192975642-192975664 CAGTGGCTTAGGGGGTAGGTGGG - Intergenic
944483697 2:200181968-200181990 CAGTGGAGCTGGTGGGAGCTGGG + Intergenic
945062952 2:205924602-205924624 CTGGGGGGCTGTGGGGAGGTGGG + Intergenic
946362459 2:219227694-219227716 CCGGGGCTCTGGTGGGAGGTGGG - Intronic
946428625 2:219613245-219613267 CAGTGAGTAAGGGGGGAGATGGG + Intronic
946568809 2:220998352-220998374 CAGTGGGCCAGGTGGGAGATGGG + Intergenic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
946907552 2:224431008-224431030 CAGTGGGTGATGGGGAAGGTGGG - Intergenic
947026231 2:225741030-225741052 CAGTGGGGCTGACGTGAGGTGGG - Intergenic
947610556 2:231522613-231522635 AAGTGGGCCTTGGGGGAGGGTGG - Intergenic
948261395 2:236606893-236606915 CAGTGGATCTGGGGTGAGGCTGG - Intergenic
948648793 2:239425987-239426009 CACTGGGCATTGGGGGAGGTGGG + Intergenic
948667396 2:239545292-239545314 CAGTGGGTCTGGTGTCACGTGGG + Intergenic
949043716 2:241860767-241860789 CAGTGGGACTGAGAGGAGGAGGG - Intergenic
1168779618 20:477656-477678 CACTGGGTCTGGGTATAGGTGGG - Intronic
1168926592 20:1586742-1586764 GAGTGGGTGGGTGGGGAGGTTGG - Intronic
1169060529 20:2657549-2657571 CAGTGGGGATGGGGGCAGGGAGG + Intronic
1169464346 20:5824138-5824160 CAGTGCGGCTGGGAAGAGGTGGG - Intronic
1171022394 20:21597856-21597878 CAGTGAGTCTGGGGGTAAATAGG + Intergenic
1171205214 20:23273803-23273825 CAGAGGGTCTGGTGGGATGGAGG + Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1171963653 20:31513978-31514000 CAGTGTGTGTGGGGGGACGTTGG - Intergenic
1172107988 20:32528016-32528038 CAGTGGGTCTTGGGGTGGGGAGG + Intronic
1172110011 20:32539019-32539041 CAGTGGGGGTGGGGTGGGGTGGG + Intronic
1172899183 20:38321348-38321370 CAGTGTGTCTGGTTGGAGGGTGG - Intronic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1173586562 20:44187168-44187190 CAGTGGGTGTGCGGGGCTGTCGG + Exonic
1173788856 20:45814494-45814516 GAGTGAGTCTGGGGAAAGGTGGG + Intronic
1173907870 20:46641953-46641975 CAGTGGGTCTGGGGGCATAGGGG - Intronic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1175566053 20:59977923-59977945 CAGGGGTTCTGGGGGTAGGGAGG - Intronic
1175804795 20:61821332-61821354 CAGTGGATCTGGGCTGGGGTGGG - Intronic
1175948378 20:62569354-62569376 TAGTGTGTGTGGTGGGAGGTGGG - Intronic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1175997941 20:62819737-62819759 CAGAGGCTCTGGGAGGAGGGAGG - Intronic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177882165 21:26707229-26707251 TAATGGGTCTTGGGGGAGGGAGG - Intergenic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1178851956 21:36219929-36219951 CAGGGGGTGTTGGGGGAGATTGG + Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1179043967 21:37829127-37829149 AAGTGGGAGTGGCGGGAGGTGGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179644948 21:42770164-42770186 CAGAGGCCCTGGGGGGAGCTGGG - Intronic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179886686 21:44317140-44317162 GAGTGGGTCTGGGGCCAGGAAGG + Intronic
1180223344 21:46374083-46374105 CAATTGGGCTGTGGGGAGGTGGG + Intronic
1180309744 22:11159193-11159215 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1180548221 22:16521003-16521025 CACGGGGACTGGGGGGAGGGGGG - Intergenic
1180824832 22:18855036-18855058 CAGTGGGACGGGGGTGGGGTGGG + Intronic
1181115642 22:20631337-20631359 CTATGGGTCCTGGGGGAGGTGGG + Intergenic
1181672938 22:24434201-24434223 CAGAGGATCTGGGGGAAGGCAGG - Intronic
1182007389 22:26972137-26972159 CAATGGGTCTGGGAGGCGGTTGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182251869 22:29007147-29007169 CAGCTGGTCTGGGCAGAGGTGGG + Intronic
1182307440 22:29380393-29380415 CGGGGGTTCTGGGGAGAGGTTGG - Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1183406426 22:37632714-37632736 CAGAGGGGCTGGGGAGAGGAAGG + Exonic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183744676 22:39685746-39685768 CCGGTGGCCTGGGGGGAGGTGGG - Exonic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184362623 22:44027305-44027327 CAGTGGGCCAGGATGGAGGTCGG + Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184892828 22:47390023-47390045 CAGTGGGTGTGCGTGGAGCTGGG - Intergenic
1184893071 22:47391326-47391348 CAGTGGGTGTGTGTGGAGCTGGG - Intergenic
1184893116 22:47391548-47391570 CAGTCGGTGTGGGCAGAGGTGGG - Intergenic
1185289245 22:50015579-50015601 CAGGGGGCCTGGGGCGCGGTCGG - Intronic
1185338397 22:50280966-50280988 CATCAGGTCTGGGGGGAGGCTGG + Exonic
1203274978 22_KI270734v1_random:80941-80963 CAGTGGGACGGGGGTGGGGTGGG + Intergenic
949326309 3:2868839-2868861 TGGTGGGTTTGGGGGGTGGTGGG + Intronic
949900369 3:8809616-8809638 CAGATGGTCTGTGGGGAGGCAGG + Intronic
950404617 3:12796924-12796946 GAGTGGGCCTGTGGGGAGGGGGG - Intronic
950649004 3:14395743-14395765 CAGCAGGTCTGGGGTGGGGTTGG - Intergenic
950671765 3:14531628-14531650 CAGTGGCCTTGGGAGGAGGTAGG + Intronic
950960844 3:17105192-17105214 GAGTGGGTGTTGGGGAAGGTGGG + Intergenic
951190990 3:19771410-19771432 CTGTGGATCTGGGGGAAGATTGG - Intergenic
952075048 3:29685844-29685866 CAGAAGGTGTGGGGAGAGGTGGG - Intronic
952145077 3:30523616-30523638 AAGTGGGGCTTGGGGAAGGTAGG + Intergenic
953071228 3:39521961-39521983 GAGTGGGTATGGGAGGAGGGTGG + Intronic
953210101 3:40868151-40868173 GGGTGGGGCTGGGTGGAGGTGGG + Intergenic
953254191 3:41273677-41273699 GAGTGGGGGTGTGGGGAGGTGGG + Intronic
953782580 3:45884598-45884620 GAGTGAGTCTCGGGGGAGGAAGG - Intronic
953788395 3:45928522-45928544 AAGTGGGTCTGGAGAGAGGGTGG + Intronic
954480680 3:50797184-50797206 CGGTATGGCTGGGGGGAGGTTGG + Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955058314 3:55474886-55474908 AGGTAGGGCTGGGGGGAGGTTGG + Intronic
955142657 3:56285106-56285128 CAGATGTGCTGGGGGGAGGTAGG - Intronic
955401518 3:58595127-58595149 GAGTGGGACTGGGGGGGTGTGGG - Intronic
955588685 3:60510709-60510731 TTGTGTGTGTGGGGGGAGGTGGG - Intronic
956600031 3:71010828-71010850 CACTGGGTGGGGGGGGAGGGGGG - Intronic
959937277 3:112042083-112042105 GAGTGGGTTTGCGGGGAGGTGGG + Intronic
960343098 3:116498900-116498922 CAGGGGGTGTGTGGGGGGGTTGG + Intronic
961479452 3:127170758-127170780 AGGTGGGCTTGGGGGGAGGTGGG + Intergenic
961635294 3:128329409-128329431 CAGCGGGGGTGGGGGGGGGTGGG - Intronic
961823847 3:129588598-129588620 CAGTGGGTTGGGGGGGACTTGGG + Intronic
962109441 3:132428741-132428763 GACTCCGTCTGGGGGGAGGTAGG - Intronic
962678032 3:137770586-137770608 CACTGGGTCTGGGTTGAGGAAGG + Intergenic
962927867 3:140011842-140011864 CAGTGGGTGTGGGGTGAGAGTGG + Intronic
965499757 3:169443395-169443417 CAATAGGTCTGGGGGTAGATTGG - Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966542249 3:181105351-181105373 AAGGTGGGCTGGGGGGAGGTGGG - Intergenic
966753745 3:183348400-183348422 CAGTGGGTCGGGGGTCGGGTAGG + Intronic
966861945 3:184235353-184235375 CAGTGGGTCTGAGGAGGGCTGGG + Intronic
966890819 3:184406326-184406348 CAGTGGGTGTGGGTGGGGGTGGG - Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
967835998 3:193963328-193963350 CAGTGGGTCTGGGTGTTGGGGGG - Intergenic
968554095 4:1238630-1238652 CAGAGGGTCTGGGAGGATCTCGG - Intronic
968624715 4:1621898-1621920 CAGTGGTGGTGTGGGGAGGTGGG + Intronic
968726525 4:2250445-2250467 CAGTGGGCCTGTGGAGAGGCTGG + Exonic
968808319 4:2788822-2788844 GAGTGGGGATTGGGGGAGGTAGG + Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969315846 4:6380966-6380988 CCCTGGGTCTGGTGGGAGGTGGG - Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
971757341 4:30720970-30720992 CAGTGGGGCTGGGAAGAGGTGGG - Exonic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974774582 4:66463054-66463076 CAGCGAGGCTGGGGGGAGGGGGG - Intergenic
976141006 4:81991506-81991528 CAGTGGGGGTGGGGTGGGGTGGG + Intronic
976592562 4:86863577-86863599 CAGTTTCTCTGGGGGGTGGTGGG + Intergenic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979279253 4:118846901-118846923 CCGTGTGTGTGGGTGGAGGTGGG - Intergenic
979831879 4:125314891-125314913 CAATGGGGCTGGGGCGAGGGAGG + Intergenic
980084846 4:128380448-128380470 CAGTAGGTCTGGGGCGGGGCTGG + Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
980129380 4:128804038-128804060 CAGTAGGTCTGGGGTGGGGCTGG + Intergenic
980680001 4:136148012-136148034 TAGTGTGTCTGTGGGCAGGTGGG + Intergenic
981042124 4:140233170-140233192 CGGTGGGGGTGGGGGGGGGTGGG - Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981728057 4:147868673-147868695 CAGTGGGGGTGGGAGAAGGTAGG + Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982267841 4:153556107-153556129 TACTGGGGCCGGGGGGAGGTGGG + Intronic
982303260 4:153901532-153901554 CAGTGTGCCTAGGTGGAGGTGGG + Intergenic
983153939 4:164320803-164320825 GAGTGGGGCTGGGGGGTTGTAGG + Intronic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985089415 4:186348335-186348357 TAGGGGGTGTGGGGGGAGTTTGG - Intergenic
985489407 5:170724-170746 CAGTGGGCCTGGGAGGGCGTGGG - Intronic
985752514 5:1688962-1688984 CATTGGGTCTGGAGAGTGGTCGG + Intergenic
986195438 5:5533404-5533426 CAGTGGCTCTGTGGGGAGGTCGG + Intergenic
987242771 5:16017626-16017648 CAGAGGGTCTGGTGGGGGCTGGG + Intergenic
988373844 5:30407773-30407795 CAGTGGGCCTGTGGTCAGGTAGG - Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989318249 5:40106342-40106364 CAGTGGGCCTGGTGTTAGGTAGG + Intergenic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
990700453 5:58469597-58469619 CAGGGGGTCGGGGGGGAAGGTGG - Intergenic
991326645 5:65440722-65440744 CAGTTGGTCTGGGTGGATCTAGG - Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
994092011 5:95817961-95817983 AAGGGGGTCTGGGTGAAGGTAGG + Intronic
994390729 5:99190060-99190082 TAGTGGGGGTGGGGGGAGATAGG - Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
996308671 5:122078424-122078446 CAACGTGTCTGGGGGGAGGAGGG - Intergenic
996739905 5:126789173-126789195 CACTGTGTCTGGCGGGAGGGAGG + Intronic
996827650 5:127703428-127703450 CAGTGGGTCTGGCTTGAGATGGG + Intergenic
996885963 5:128353993-128354015 CAGTGGGTCAGTGGGGAGACAGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997228944 5:132228853-132228875 CACTGGGCCTGGGCGGAGGCTGG - Intronic
997355893 5:133262845-133262867 CAGGTGGTGTGGGGGGAGGTGGG + Intronic
998250606 5:140549678-140549700 AAGTGGGCCTGGTGGGAGCTGGG - Intronic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
998540179 5:142973831-142973853 CCGTTGGTTTAGGGGGAGGTGGG + Intronic
998726234 5:145017864-145017886 TTTTGGGTCTGGGTGGAGGTGGG - Intergenic
999132444 5:149294809-149294831 GGCTGGGGCTGGGGGGAGGTGGG - Intronic
999286981 5:150399953-150399975 CAGTGAGCCTGCGGGGAGGCTGG + Exonic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999496760 5:152106795-152106817 CAGTAGGTCTGGGGGATGGCGGG - Intergenic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001187009 5:169583897-169583919 CAAGGGGCCTGGTGGGAGGTGGG + Intronic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001509284 5:172307563-172307585 CCTTGGGCCTGGGGGGAGGCAGG + Intergenic
1002066126 5:176652629-176652651 CTCTGGGTCTTGGTGGAGGTAGG + Intronic
1002330626 5:178437862-178437884 CAAGGGGCCTGGGGGGAGGTGGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1003421092 6:5959193-5959215 CAGTGGGTGGCGGGGGAGGGGGG + Intergenic
1003565936 6:7222275-7222297 CAGTTGGTCTGGGGTGATCTAGG + Intronic
1004797370 6:19102788-19102810 CAGTGTTTCTGGGTGGGGGTTGG - Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005618466 6:27597970-27597992 CAGTTTGTCTGGGGGGAGGGGGG - Intergenic
1005865089 6:29931365-29931387 GAGTTGGTGTGGGGGGAGGGAGG + Intergenic
1006388999 6:33747708-33747730 GAGTGGGACTGGGGAGAGATGGG + Intergenic
1006803108 6:36771820-36771842 CACTGGGGCTGGGGGGCGGGGGG + Intronic
1007835011 6:44667510-44667532 CAGGGGGTGTTGGGGGAGCTGGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007909448 6:45498943-45498965 AAGTGGGCCTGGGGTGATGTTGG + Intronic
1007960347 6:45953348-45953370 GGGTGAGTCTGGAGGGAGGTTGG + Intronic
1008064000 6:47028025-47028047 CAGAGGGTCTCTGGGGAGGCAGG + Intronic
1008617878 6:53243645-53243667 CAGCAGGTCTAGGGCGAGGTCGG + Intergenic
1008637635 6:53427018-53427040 CAGTGAGGCAGGGGAGAGGTGGG + Intergenic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1012246945 6:96936878-96936900 CAGTGGGCCTGCGGGTAGGCAGG - Intronic
1012535000 6:100284639-100284661 CAGTGGGTCAGTGGGCAGGTGGG - Intergenic
1015826359 6:137316804-137316826 CAGTGGTTCTGGCAGGAGGTAGG - Intergenic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1015837152 6:137432708-137432730 CAGGGGCTGTGGTGGGAGGTGGG + Intergenic
1016307162 6:142696445-142696467 CAGGGGTTCTGGAGGGAGTTGGG + Intergenic
1016378627 6:143450369-143450391 CAGTGGCTCTGGGCGAAGGAAGG - Intronic
1016384968 6:143521909-143521931 CAGAGGGTCTGGATGCAGGTGGG + Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016575409 6:145564783-145564805 CAGGGGGTGTGGAGGGAGCTGGG + Intronic
1017068594 6:150552075-150552097 CAGGGGGACTGTGGGGAGGGTGG + Intergenic
1017721769 6:157248083-157248105 CAGTGTGTCTGGGGGTGGGGTGG + Intergenic
1017980646 6:159398335-159398357 CAATGGGTTTGGGGTGGGGTGGG + Intergenic
1018776874 6:167025411-167025433 CACTGTGTGTGGGGAGAGGTGGG - Intronic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1018900332 6:168048735-168048757 CAGTGGGCGTGGGGGGCGCTTGG + Intergenic
1018971187 6:168530644-168530666 CAGTGGGTGTGGGGGCGGGGGGG - Intronic
1019165082 6:170093475-170093497 CAGTGGCTCTGGTGGCAGATCGG - Intergenic
1019319568 7:409476-409498 GAGTGGGGCCGGGGCGAGGTGGG - Intergenic
1019637898 7:2086171-2086193 CACTGGGCCTGTGGGGAGGGAGG - Intronic
1019908132 7:4080181-4080203 GAGTGAGTCTGGGGAGAGCTGGG + Intronic
1021245617 7:18257976-18257998 CAGTGGGTCTGAGATGGGGTTGG - Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1023319242 7:38975863-38975885 CTGGGGGTGTGGGTGGAGGTGGG - Intergenic
1023494231 7:40777632-40777654 CTGTGGGTCTGGGGAAAGCTGGG + Intronic
1023606991 7:41940176-41940198 CAGTAGGTCTGGGGACAGGATGG - Intergenic
1023676458 7:42635291-42635313 CAGTGGGTCTGGGGAGGGTGGGG - Intergenic
1023843995 7:44111076-44111098 CAGGGGCTCTGAGTGGAGGTGGG + Intronic
1023896549 7:44438572-44438594 CACTGGGTGTGGGGTGGGGTGGG - Intronic
1023938694 7:44756834-44756856 AAGTGGGTTGGGGGAGAGGTGGG - Intronic
1024132522 7:46369134-46369156 CAGGAGGTCTGGGTTGAGGTAGG - Intergenic
1025099713 7:56124329-56124351 CAGGTGGTCTCGGTGGAGGTTGG - Intergenic
1025978981 7:66392430-66392452 CAGTGGGTATGGGTGGATTTTGG + Intronic
1026110186 7:67453363-67453385 CAGTGGGGGTTGGGGGGGGTGGG + Intergenic
1026207134 7:68267689-68267711 GAGTGGGTGTGGGAGGGGGTGGG + Intergenic
1026539470 7:71267849-71267871 AAGTGGGGGTGGGGGCAGGTGGG - Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1027960434 7:84939662-84939684 CTGTGGCCCTGGGGGTAGGTGGG + Intergenic
1028845159 7:95472065-95472087 CAGTGGGTGTGTGTGGTGGTGGG + Intergenic
1029201269 7:98840647-98840669 GAGGGGGTCAGGGAGGAGGTGGG + Intergenic
1029201288 7:98840747-98840769 AAGGGGGTCAGGGAGGAGGTGGG + Intergenic
1029252569 7:99247579-99247601 GAGTAGGTCTGGTGGGAGGGAGG - Intergenic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1031709886 7:125032256-125032278 CACTGGGGCTTGTGGGAGGTGGG - Intergenic
1031946781 7:127850473-127850495 CAGTGGCTCTGCCGGGAGGTAGG + Intronic
1032089171 7:128902723-128902745 CAGTGGGCCTGAGGGCAGGGAGG + Intronic
1032327820 7:130948405-130948427 CAGGGGAGCTGGGGGGAGGAGGG + Intergenic
1032448513 7:132004995-132005017 CAGTGGGTCTGGCAGGAGCAAGG + Intergenic
1032652869 7:133897990-133898012 GGGTGGGTGTGGGGTGAGGTGGG - Intronic
1032789503 7:135232112-135232134 CAGTGGTTGGGGCGGGAGGTGGG + Intronic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033537892 7:142328843-142328865 CACTGAGTCTGGGGTGAGGGAGG - Intergenic
1034557723 7:151860569-151860591 CAGTGGGCCTCGGGTGGGGTGGG - Intronic
1034908595 7:154973216-154973238 CCATGGGTCTTGGGGGTGGTTGG - Intronic
1035230400 7:157462381-157462403 CACGGGGTCTGGGGCGAGGCTGG + Intergenic
1035259852 7:157654173-157654195 GGGTGGGTGTGGGGAGAGGTGGG - Intronic
1035344692 7:158190496-158190518 CAGTGGTCCTGATGGGAGGTGGG + Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035842941 8:2832192-2832214 CCGTGAGTCTGTGGGGAGGAGGG + Intergenic
1036048944 8:5174349-5174371 CAGGGGGTCGGGGGGCAGTTAGG - Intergenic
1036381257 8:8237850-8237872 CAGTGGCTTTGGGAGGGGGTCGG - Intergenic
1036434754 8:8723264-8723286 CAGTGGCTGGGAGGGGAGGTGGG - Intergenic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1037522284 8:19691858-19691880 CAGTAGGTCTGGGTGGGGGCTGG - Intronic
1037631053 8:20656793-20656815 CAGTGGGGCTGGGAGAAGCTGGG - Intergenic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1038038899 8:23707450-23707472 GAGTGGGGGTGGGGGGGGGTGGG + Intergenic
1038204444 8:25452529-25452551 CAGTAGGTCTGGGGTGGGGTAGG - Intronic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038863376 8:31412193-31412215 CAGGGGGTCTAGGGGGAGGTGGG + Intergenic
1039322969 8:36453072-36453094 CAGTGGCTCTGGGGATAGTTAGG - Intergenic
1039804208 8:40984793-40984815 CAGTGGATCTGGGAGGAAGTAGG - Intergenic
1040596995 8:48847985-48848007 CTGTGGGTCTGGGGAGGGGTGGG + Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1041163868 8:55072292-55072314 CAGGGGGTCAGGGGGGGGGGTGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044177255 8:89142716-89142738 CAGAGGGCATGGGGAGAGGTAGG - Intergenic
1044269022 8:90218295-90218317 CAGTGGGGCTGAGAGGAGGTTGG - Intergenic
1045063386 8:98426705-98426727 CGCTGGGTCTGGCGGGAGCTGGG - Intronic
1045538611 8:103059666-103059688 CAGTGGGTCTTGGGGGAGTGGGG - Intronic
1046508258 8:115164406-115164428 AAATGGCTCTGGGGGGAGGAAGG + Intergenic
1047334359 8:123921773-123921795 CAGGGCGGCTGTGGGGAGGTTGG + Intronic
1047987990 8:130256392-130256414 CAGAGGATCTGGGGGGTGGGGGG + Intronic
1048136708 8:131753101-131753123 GAGGGAGACTGGGGGGAGGTTGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048573009 8:135670380-135670402 CAGTGGGACAGTGGGGAGGCTGG - Intergenic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049254006 8:141604510-141604532 CAGTGGCTCTCGGGGAAGGGGGG - Intergenic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049363439 8:142225150-142225172 AGGAGGGTCTGGGGGGAGGGGGG - Intronic
1049577473 8:143396401-143396423 CAGTGGGGCTGAGAGGAGGCTGG + Intergenic
1050130366 9:2406348-2406370 CCGTGGAGCTGGTGGGAGGTGGG + Intergenic
1050614423 9:7387434-7387456 CAGTGGGTATGGTGTGAGATAGG - Intergenic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051634111 9:19166136-19166158 CAGGGGGCCAGGGGGCAGGTGGG - Intergenic
1052840751 9:33289474-33289496 GTGTGGGTCTGGGGGGTGGGGGG + Intergenic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1055560461 9:77516720-77516742 CATTGGGGGTGGGGGGCGGTAGG + Intronic
1055640404 9:78314973-78314995 CTGTGGTTCTGTGTGGAGGTGGG + Intronic
1055774617 9:79753909-79753931 GTGTGGGTATGGGGTGAGGTCGG + Intergenic
1057031173 9:91776265-91776287 CAGTGGGTCTGGGGATGGGGAGG - Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057365112 9:94412810-94412832 TAGTGGTTCTGAGGGGAAGTAGG + Intronic
1057658212 9:96975280-96975302 TAGTGGTTCTGAGGGGAAGTAGG - Intronic
1057691599 9:97291268-97291290 CAGGGTGTCTGGCGGGAGGAGGG + Intergenic
1058077951 9:100669563-100669585 GAGTGTGTGTGTGGGGAGGTAGG + Intergenic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060231344 9:121827592-121827614 CAGTGAGTGTGGGGGGACGCGGG + Intronic
1060319022 9:122538140-122538162 CAGGGGGACTGGGGGGCTGTTGG - Intergenic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1061028442 9:128065667-128065689 CAGTGGGGGTTGGGGGAGTTGGG - Intronic
1061804173 9:133128891-133128913 CCGTGGGGCTGGGGGCAGCTGGG + Intronic
1062068161 9:134540041-134540063 CTGTGGGACAGGGAGGAGGTAGG - Intergenic
1062170982 9:135134457-135134479 CAGATGGTCTGGGGCGGGGTGGG - Intergenic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062475530 9:136724969-136724991 CTGTGGCCCTGGGGGCAGGTGGG + Intergenic
1062502097 9:136856035-136856057 CAGCGGGCCTGGGGGCAGCTAGG + Exonic
1062568637 9:137174406-137174428 CAGGAGGTCTCGGGCGAGGTTGG - Intergenic
1062618306 9:137407855-137407877 CAAAGGGTCTGGGGGGAGGCCGG + Intronic
1185593499 X:1293789-1293811 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593520 X:1293875-1293897 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593549 X:1294005-1294027 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593739 X:1294843-1294865 CACTGGGTGTAGGTGGAGGTGGG - Intronic
1186545513 X:10445010-10445032 CAGCAGGTCTCGGGGGAGGCAGG + Intergenic
1187344365 X:18449499-18449521 CAGTGATTCTGGGGGGCGGCAGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1190231778 X:48587791-48587813 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1190311930 X:49122859-49122881 CTGTGGGGCTGGGGTGAGTTTGG - Intronic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1191058872 X:56273454-56273476 CAGTGGGTCGGGGGGCAGTGGGG - Intronic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1192368246 X:70492944-70492966 CAGGTGGTCTGAAGGGAGGTGGG - Intronic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193194240 X:78611150-78611172 CAGGGGGTGGGGGTGGAGGTGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1194172962 X:90611407-90611429 GATGGGGTCTGGTGGGAGGTGGG - Intergenic
1194227734 X:91282026-91282048 TAGTGGGGGTGGGAGGAGGTGGG - Intergenic
1195252568 X:103063494-103063516 TGGTGGGTTTGGGGGCAGGTAGG - Intronic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1197995804 X:132371219-132371241 AAGAGGGTCGGGGAGGAGGTTGG - Intronic
1198211644 X:134521842-134521864 TAGTGTTTCTTGGGGGAGGTAGG + Intergenic
1198801680 X:140454068-140454090 CACAAGGTCTGGGTGGAGGTAGG + Intergenic
1199705534 X:150421862-150421884 CAGTGGGGTTGGGTGGAGCTTGG - Intronic
1199716173 X:150508661-150508683 CAGTGGGGCTGGTGGGAGTGGGG - Intronic
1200085268 X:153601157-153601179 CAACGGGGCTGAGGGGAGGTGGG - Intergenic
1200230461 X:154441406-154441428 CAGTGCCTCTGGGGGGCGGGGGG + Intronic
1200519186 Y:4189125-4189147 GATGGGGTCTGGTGGGAGGTGGG - Intergenic
1200886585 Y:8278099-8278121 CAGTGTGACAGGGGGAAGGTGGG - Intergenic