ID: 932840238

View in Genome Browser
Species Human (GRCh38)
Location 2:75074994-75075016
Sequence CTGCTGTCATTTTCCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932840235_932840238 18 Left 932840235 2:75074953-75074975 CCAGGATGGTTGGTCACTTTAGA 0: 2
1: 2
2: 8
3: 47
4: 204
Right 932840238 2:75074994-75075016 CTGCTGTCATTTTCCCTCACTGG 0: 1
1: 0
2: 2
3: 13
4: 237
932840234_932840238 27 Left 932840234 2:75074944-75074966 CCAGGAAAACCAGGATGGTTGGT 0: 3
1: 20
2: 54
3: 156
4: 360
Right 932840238 2:75074994-75075016 CTGCTGTCATTTTCCCTCACTGG 0: 1
1: 0
2: 2
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932840238 Original CRISPR CTGCTGTCATTTTCCCTCAC TGG Intronic
901884114 1:12210764-12210786 CTCCTGTCTTTCTCCCTCAGTGG + Intergenic
902807177 1:18868323-18868345 CCCTTGTCATTGTCCCTCACAGG - Intronic
903023395 1:20410261-20410283 CTGATGTCACTTCCCCTCCCTGG + Intergenic
905300924 1:36985741-36985763 CTGCTGTCATTTGACCTCAAAGG + Intronic
907622049 1:55991542-55991564 CTGCTCTCCTTTTTCCTTACAGG - Intergenic
908834640 1:68216714-68216736 CTGCTGCCTTTTTCCATCTCAGG - Intronic
909958552 1:81806022-81806044 CAGCTGCCATTTTCAATCACTGG + Intronic
910322723 1:85966900-85966922 TTGGTGTCAGTTTCCCTCCCAGG - Intronic
911274501 1:95844493-95844515 CTGCTGACTTTTTCTCTCATGGG + Intergenic
911792345 1:102033475-102033497 CTACTGTCATTTGCCATCTCAGG - Intergenic
913256754 1:116960935-116960957 CTGCTGTCAGTTTCCCCAAGAGG - Intronic
916145900 1:161739132-161739154 CTCGTGTCCTTGTCCCTCACAGG - Intergenic
916768033 1:167880609-167880631 TTGCTGTCTCTCTCCCTCACAGG - Exonic
917443272 1:175085302-175085324 CACCTCTCATCTTCCCTCACGGG + Intronic
917732614 1:177891362-177891384 CTGCAGGCATTTTCCCAGACTGG + Intergenic
917805266 1:178607433-178607455 TTTCAGTCATTTTCTCTCACTGG + Intergenic
919944677 1:202310432-202310454 CTGCTGTCAGATTCCCTCTCAGG - Intronic
920266255 1:204725633-204725655 CTCCTGTCATTTTCTCTTTCTGG + Intergenic
920732171 1:208497424-208497446 CTGCAGACATTTTCCCAGACTGG - Intergenic
920734723 1:208521764-208521786 CTGGTGTCATTTCCCTTCAGTGG + Intergenic
921371548 1:214428151-214428173 CTGCTGTCATTTTTTCTGACTGG - Intronic
922182943 1:223250322-223250344 CTGCTCTCATTTCATCTCACTGG - Intronic
922300481 1:224295119-224295141 CTGAGGTTATTTTCCCTCACAGG + Intronic
924371259 1:243352925-243352947 TTACTATCATTTTCCCTTACAGG - Intronic
1066243830 10:33562867-33562889 CAGGTATCATTTTCCCACACTGG - Intergenic
1066475325 10:35741361-35741383 CTGCTGGCCTTCTCCCTTACAGG - Intergenic
1067716393 10:48694180-48694202 CCCCTGTCATTTTCCTTCTCTGG + Intronic
1070451358 10:76560649-76560671 CTGGTGTCATTTTCCTTTCCAGG - Intergenic
1070978036 10:80621277-80621299 CTGCTGACATTTTGCCTGTCCGG - Intronic
1071370871 10:84950333-84950355 CTCCTGGCTTTTTCCCTCTCAGG + Intergenic
1072917670 10:99549324-99549346 GTACTGTCATTTTCCATCAGAGG - Intergenic
1079021618 11:16913572-16913594 CTGCTGTCGCTTCCCCTCAGTGG - Intronic
1079882132 11:25941709-25941731 CTGGTGTCCTTTCCCCTCTCTGG - Intergenic
1081102620 11:39024269-39024291 CAGATGTCATGTGCCCTCACTGG + Intergenic
1082098292 11:48149569-48149591 TTGCTGTCATTTTTCCTGATTGG + Intronic
1083392155 11:62360547-62360569 CTGCTTGCATTTTCCAACACTGG + Intronic
1084455328 11:69264953-69264975 CTGCTGCCCATGTCCCTCACTGG + Intergenic
1086013164 11:82130777-82130799 CTGCTGTCATGTTTTTTCACAGG + Intergenic
1087038195 11:93774237-93774259 CTACTGTGGTTTTCCCCCACTGG + Intronic
1087069819 11:94067149-94067171 CTTCTGTCATAATCCTTCACTGG - Intronic
1087514999 11:99147624-99147646 CTGCTGTCCTTTTCCCTACCAGG + Intronic
1088144050 11:106652908-106652930 CTGCTTACCTTTTCCCCCACAGG + Intergenic
1088417274 11:109603324-109603346 CTGATGACATTTTCACTAACAGG + Intergenic
1088728774 11:112662381-112662403 CTGCTGTCTGATTCCCCCACTGG + Intergenic
1091817804 12:3453163-3453185 TTGCTGGCCTTTTCCATCACAGG - Intronic
1091817945 12:3453853-3453875 CTGCAGTCATTTTCAATCGCCGG - Intronic
1095651306 12:44612946-44612968 CTGTTGTCATTTACTCTCATGGG + Intronic
1098042790 12:66369147-66369169 CTTCTGTCATTTTCTCTAAATGG - Intronic
1099340073 12:81419925-81419947 CTGCTTTCCTTTTCACCCACAGG - Intronic
1100650300 12:96580265-96580287 CTATTGTCATTTTGCTTCACAGG - Intronic
1100893295 12:99150491-99150513 CTGCTGTCTTTTATCCTCAAAGG - Intronic
1103572486 12:121854478-121854500 TTGCTGTCATCCTCCCGCACTGG + Intronic
1104035240 12:125093010-125093032 CTGCTGCCATTCTCCCTCTGGGG - Intronic
1110282649 13:73713189-73713211 ATGCTATAATTTTCACTCACTGG - Intronic
1111354775 13:87084215-87084237 CAGCTGACATTTTCCGACACTGG + Intergenic
1113652257 13:112042318-112042340 ATGCTGTCATAGTCCCTCCCAGG + Intergenic
1115097528 14:29655497-29655519 ATACTGTTATTTTCCCTCATGGG - Intronic
1115559830 14:34573209-34573231 CTCATGTGATTTTCCCACACTGG + Intronic
1115879134 14:37895095-37895117 CTGCGTTCCTTTTCCCTCAATGG - Intronic
1121092144 14:91190309-91190331 CTGTTGTCAGTTTTGCTCACGGG - Intronic
1121521658 14:94590230-94590252 CTGCTGCATCTTTCCCTCACTGG - Exonic
1124407333 15:29404399-29404421 CTGCTCCCCTTTCCCCTCACTGG + Intronic
1125606795 15:40944043-40944065 TTGCTGTCCTTTTCCCACAGTGG + Intergenic
1127171489 15:56307379-56307401 CTGTTTCCAATTTCCCTCACTGG + Intronic
1127341775 15:58053269-58053291 CTGCTGTCATTTTCAGTGATAGG - Intronic
1127520757 15:59741071-59741093 CTGGTTTGAGTTTCCCTCACTGG + Intergenic
1127991686 15:64123481-64123503 CTGCTTTCTTGTTCTCTCACAGG + Exonic
1128915498 15:71557596-71557618 CTGATGTGTTTTTCCCCCACAGG + Intronic
1129203442 15:74020465-74020487 TTGCTGTAATTTACTCTCACCGG - Intronic
1130244319 15:82230341-82230363 ATGCTGTCATATACCCTCAAAGG - Intronic
1130456133 15:84110782-84110804 ATGCTGTCATATACCCTCAAAGG + Intergenic
1131460091 15:92611725-92611747 CAGCTGTCATCTTCCCTAAGGGG - Intergenic
1131792427 15:95979802-95979824 CTGCTGTAATTTTCTCTGATGGG - Intergenic
1132168839 15:99626522-99626544 ATGCTGTGATTTTCCCCCAAAGG - Intronic
1132681997 16:1146237-1146259 ATCCTGTCACTTTCCCTCCCAGG + Intergenic
1135770754 16:25216758-25216780 CTGGCGTGTTTTTCCCTCACTGG + Intronic
1135840418 16:25871143-25871165 CCGCTGCCTTTTTCCTTCACAGG - Intronic
1136787615 16:32945155-32945177 CTCCTGTCATTTTCCTTTTCTGG + Intergenic
1136882163 16:33908634-33908656 CTCCTGTCATTTTCCTTTTCTGG - Intergenic
1138090946 16:54174302-54174324 CTGCTGTCTTTCTCACTCCCAGG + Intergenic
1142153483 16:88522834-88522856 CTGCGGCCATCTTCCCTCCCAGG - Intronic
1142211459 16:88810556-88810578 CTCCTGTCACTTACCCTGACAGG - Exonic
1203089846 16_KI270728v1_random:1206812-1206834 CTCCTGTCATTTTCCTTTTCTGG + Intergenic
1143434138 17:6909924-6909946 CTGATGTCTTGGTCCCTCACTGG + Intronic
1149561018 17:57608086-57608108 CTGCAGTCCTTTTCCCTCACTGG - Intronic
1150534288 17:66019869-66019891 CTGCTATCAGTCTCCCTCCCTGG - Intronic
1151194575 17:72422576-72422598 CTGCTGTCATTTCTCCTCCTTGG - Intergenic
1152644610 17:81463019-81463041 CTGCTGTCGTGTCCCCTCCCTGG - Intronic
1153521293 18:5956508-5956530 CTACCGTCATTCTCTCTCACTGG - Intronic
1153673893 18:7438678-7438700 ATGCTTTCATTTTCTATCACAGG + Intergenic
1153927480 18:9846902-9846924 CTGCTGGCCCTTTCCTTCACTGG + Intronic
1154140479 18:11819853-11819875 CTGTTGTCATTTTAATTCACAGG - Intronic
1155981843 18:32188499-32188521 CTGATGTCATCTATCCTCACAGG + Intronic
1156210232 18:34931869-34931891 CTTGTGTCATTTTCCCCCATGGG + Intergenic
1156528523 18:37792483-37792505 ATGCCTTAATTTTCCCTCACAGG - Intergenic
1158518536 18:58150886-58150908 CTCCTGTGATCTTGCCTCACTGG + Intronic
1158923942 18:62230360-62230382 CTCCTCTCATATTCCCTCAGAGG - Intronic
1159577494 18:70197639-70197661 CTGCTGAGATTTTCCTTCAAAGG - Exonic
1162162431 19:8728496-8728518 CTGCTGTCATTGTGCCTCTATGG + Intergenic
1162638266 19:11987374-11987396 CTGTTGTCTTTTTCACTCAATGG - Intergenic
1163539369 19:17898133-17898155 CTCCTGTCACTTTCCCTCTTGGG + Intergenic
1168189189 19:54725664-54725686 CTGCTGTCATTCTACCTAAGAGG + Intronic
925390684 2:3491915-3491937 CTGCTGTCAGCATCCCTGACGGG + Intergenic
926103190 2:10133679-10133701 CTGATGTCATATTCCCTCCAGGG - Intergenic
926236574 2:11049993-11050015 CTGCTGTCGTTTTCCCACAAGGG + Intergenic
928444570 2:31321513-31321535 ATGCTGTCAGTATCCATCACTGG - Intergenic
929761089 2:44806825-44806847 CTGCTGTTATTTTCTCTGAACGG + Intergenic
931681069 2:64750534-64750556 CTGATTTTATTTTCCCTCTCTGG - Intronic
932840238 2:75074994-75075016 CTGCTGTCATTTTCCCTCACTGG + Intronic
933906092 2:86894369-86894391 TTGCATTCTTTTTCCCTCACAGG + Intergenic
933946009 2:87286701-87286723 CTGCTTTCCTCTCCCCTCACTGG - Intergenic
934020448 2:87945988-87946010 TTGCTGTCAATCTCTCTCACTGG - Intergenic
934697591 2:96411128-96411150 CTCCTGTCACTTTCCCTCAGGGG + Intergenic
935442992 2:103123546-103123568 CTGCTGCCCTTGTCCCTCTCTGG + Intergenic
935754162 2:106264282-106264304 ATGCTGTTATTTGCCCTCAGTGG + Intergenic
935766936 2:106377539-106377561 TTGCATTCTTTTTCCCTCACAGG + Intergenic
935911713 2:107903540-107903562 TTGCATTCTTTTTCCCTCACAGG + Intergenic
936286130 2:111182705-111182727 TTGCTCTCATTGTCCCTCTCTGG + Intergenic
936334202 2:111574885-111574907 CTGCTTTCCTCTCCCCTCACTGG + Intergenic
936366071 2:111857288-111857310 TTGCATTCTTTTTCCCTCACAGG - Intronic
936454120 2:112658129-112658151 CTGGCCTCATTTTCCCTCTCTGG + Intronic
936689516 2:114869864-114869886 GTGCTGTCTTCTTCCCTTACTGG + Intronic
936808974 2:116372818-116372840 CTGCTGTCTTTTTAACTTACAGG - Intergenic
937915287 2:127095907-127095929 CTGCTGCCATTCTCACTTACAGG + Intronic
939941445 2:148356420-148356442 CTACTGTCACTCTCCCCCACTGG + Intronic
946529587 2:220557517-220557539 CTTCTCCCATTTTCCCTCAAGGG + Intergenic
1168775018 20:440176-440198 CTGTGGTCATTTTCCCTGAAGGG - Intronic
1168930358 20:1618632-1618654 CTGCTGTGATGTCACCTCACAGG - Intronic
1169114008 20:3051089-3051111 ATGCTGTCATTTCCCCTGTCAGG + Intergenic
1170505492 20:17021398-17021420 CTCCTGCCATTGTCCCTGACTGG - Intergenic
1172727993 20:37062125-37062147 GTGCTGTCAGTTTCCCTAATGGG + Exonic
1173226871 20:41167277-41167299 GTCCTGACTTTTTCCCTCACTGG - Intronic
1175530419 20:59671139-59671161 CTCCTGTGATTTTCCATGACAGG - Intronic
1175582695 20:60112756-60112778 CTCCTGTCATCTCCCCTCCCTGG + Intergenic
1175942385 20:62543457-62543479 CTGCTGTCATATTCCCTGTGTGG - Intergenic
1178492914 21:33064787-33064809 CTGAAGTCATTTCCCCGCACTGG - Intergenic
1182149080 22:28016110-28016132 CTGCTCTGCTTTTCTCTCACAGG - Intronic
1182230981 22:28837333-28837355 CAGCTATCATTTTCCCTGCCTGG - Intergenic
1182649548 22:31840074-31840096 CTAATGTTATTTTCCCTGACTGG - Intronic
1184578371 22:45393685-45393707 TTGCTGACGTTTTCCCTCATGGG + Exonic
1184782181 22:46654981-46655003 CTTCTGTCATCTTCTCTCACGGG - Intronic
1185073984 22:48673372-48673394 CTGCTGTCAGTTTCCCTCCCAGG + Intronic
950699200 3:14728400-14728422 CTGCTGTCATTTTCCCTTCATGG - Intronic
953391282 3:42535321-42535343 CTCCTGTCATCTTCCTTCTCAGG + Exonic
955051606 3:55416157-55416179 ATGCTCTCATTTTACCTCAGAGG + Intergenic
959009153 3:101054455-101054477 CTGCTGTTATTTTCCAACATAGG + Intergenic
959743705 3:109751622-109751644 CATCTGTCTTTTTGCCTCACTGG + Intergenic
960583227 3:119297994-119298016 CTGCTGTGATCACCCCTCACTGG + Intronic
961048483 3:123726078-123726100 GACCTGTCCTTTTCCCTCACAGG - Exonic
961726811 3:128936157-128936179 CTGCTGTCATTGCCCTGCACTGG + Intronic
962357775 3:134709546-134709568 CTGATGTCTTCTTCCCACACTGG + Intronic
962364729 3:134771092-134771114 GTGCTGAGATCTTCCCTCACTGG + Intronic
965545271 3:169909124-169909146 ATACTGACATTTTCCCACACCGG - Intergenic
967401235 3:189063764-189063786 CTGCTATAAATTTCCCTCTCAGG - Intronic
969246833 4:5940135-5940157 CTGTTCTCTTTGTCCCTCACTGG + Intronic
970144035 4:13014129-13014151 CTGCTCTCCTTTTCCCTACCAGG - Intergenic
970268710 4:14319210-14319232 CAGCTGGCATTTTCCATCAAGGG + Intergenic
970322235 4:14886180-14886202 CTGCTAAGATTTTCCCTCAGTGG - Intergenic
971944386 4:33255230-33255252 CTTCTGCCATTCTCCCTCTCCGG - Intergenic
974068390 4:57101724-57101746 CTGATCTCATTTTCTCTCAGAGG + Intronic
979032204 4:115664481-115664503 CTGCTGTTGTTTTCCCCCTCGGG + Intergenic
979289917 4:118968167-118968189 TTGCTTTCATTTTCACTAACTGG - Intronic
980794851 4:137668078-137668100 CTGCTGACAGTTTCCCTGCCTGG - Intergenic
981139250 4:141249288-141249310 CAGCTTTCCTTTTACCTCACTGG + Intergenic
981268074 4:142811012-142811034 CTGCTGACATTTTTCTGCACTGG + Intronic
981790884 4:148535570-148535592 CTGATCTCATTTCCCCTGACTGG - Intergenic
983083306 4:163414135-163414157 CTGCTGGCATTTTGCCGCAGGGG + Intergenic
983578830 4:169287632-169287654 TGGCTATCATTTTCCTTCACTGG - Intergenic
983779484 4:171650726-171650748 CACTTATCATTTTCCCTCACTGG - Intergenic
987062155 5:14252953-14252975 CTGCTATCATTTCGCCTCACTGG + Intronic
989985428 5:50691351-50691373 CAGCTTTCATTTTACTTCACTGG + Intronic
990988111 5:61659730-61659752 TTGCTGTCTTTTTACCTCCCAGG - Intronic
991070497 5:62474096-62474118 CTGCTTTAATTTTTCTTCACAGG - Intronic
994865118 5:105258658-105258680 CCACTGTCATTTCTCCTCACAGG - Intergenic
995234438 5:109810701-109810723 CTGCAGTCATTTTCACTCTGGGG - Intronic
995550457 5:113276103-113276125 CTGCTGTGCTGTTCCCACACTGG - Intronic
995780480 5:115770052-115770074 CTGCTGATATTTTCCCCCAAAGG - Intergenic
999928247 5:156403177-156403199 CTGCTGTGACTTTTCCTCACTGG - Intronic
1000332952 5:160220182-160220204 CTACTGTTATTCTCACTCACTGG - Intronic
1001087117 5:168708289-168708311 CCACTGTGATTTTTCCTCACTGG - Intronic
1002990789 6:2236425-2236447 CTGCTGTCTTTCTCCTTGACTGG + Intronic
1005562893 6:27059567-27059589 CAGCTGACATTTTCTCTGACAGG + Intergenic
1007522748 6:42464795-42464817 CTGTTGTCATTTTTACTCTCTGG + Intergenic
1008072484 6:47111943-47111965 CTGCTGACCTTTGCCCCCACTGG + Intergenic
1010339662 6:74733663-74733685 CTGCTGCCATTTTCTTTCTCCGG - Intergenic
1010639706 6:78309538-78309560 CTGCTTTCCTTCTCCTTCACTGG + Intergenic
1010656147 6:78514145-78514167 CTGCTGTCCCATTCCCTTACAGG + Intergenic
1011798516 6:90983359-90983381 CTGCTGTCTTTCTCTCCCACAGG + Intergenic
1012707044 6:102545023-102545045 CTGCTGTAATTATCATTCACTGG + Intergenic
1013068861 6:106710062-106710084 CTGCTGCCACTTTCTCTCTCTGG + Intergenic
1014644370 6:123954891-123954913 CTGCTGACAGCTTCCTTCACTGG - Intronic
1014814945 6:125925042-125925064 CTGCTCTCATTTCAGCTCACAGG + Intronic
1015321967 6:131886678-131886700 TAGCTTTCATTTTGCCTCACAGG + Exonic
1015729508 6:136334118-136334140 TTTCTATCATTTTCCATCACGGG - Intergenic
1017981329 6:159402865-159402887 CTGCTGTCAGGTTCACTCAGTGG - Intergenic
1018129508 6:160715758-160715780 CAGCTGCCATTTTCCTTCAAAGG + Intronic
1019879692 7:3847595-3847617 ATGCTCTCATTATCTCTCACTGG + Intronic
1021397340 7:20166596-20166618 CTGCTGACATTTGCCCTGTCAGG - Intronic
1022647925 7:32248769-32248791 TTGCTGACATTTTTCCTCATCGG - Intronic
1023145087 7:37143179-37143201 ATGCTGTCATTATCCCCCAAAGG + Intronic
1023866056 7:44238966-44238988 GTGCCGGCCTTTTCCCTCACAGG + Intronic
1024113121 7:46166583-46166605 CTGCTGCCCTTTTCTCTCTCTGG - Intergenic
1024299724 7:47877661-47877683 CTGCTGTAATTCTCCATCATGGG - Intronic
1024354420 7:48399859-48399881 CTGCTGTTTCTTTCCTTCACTGG - Intronic
1024606915 7:51029066-51029088 TTGCTGTCCTTTTCATTCACCGG + Exonic
1025025991 7:55516602-55516624 CTGATTTCATTTTGTCTCACCGG - Intronic
1026445095 7:70477358-70477380 CTGTTGTTTCTTTCCCTCACTGG - Intronic
1026824063 7:73570427-73570449 CTGCTGCCATCTTTCCTCCCAGG - Exonic
1027421490 7:78021162-78021184 CTGCTTTCATTTCCCCTTAGTGG - Intronic
1027522054 7:79221476-79221498 CTGCTGTCATTTTATATCAAAGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031661729 7:124434579-124434601 CTGTTGTCTTTTTCCCTCCCTGG - Intergenic
1034231769 7:149535134-149535156 CTGCTCTCATTTCCCCACTCAGG - Intergenic
1035061162 7:156070677-156070699 CTGCTCTGATTGTCCCTCCCAGG + Intergenic
1035932043 8:3790935-3790957 CACCTGTCATTTTAACTCACAGG + Intronic
1036439129 8:8764750-8764772 CTGCTCACTTTCTCCCTCACTGG + Intergenic
1037061460 8:14515280-14515302 CTGCTGTATTTTTGCCTCAGAGG + Intronic
1037726198 8:21484427-21484449 TTGCTTTGATTTTCCCTGACAGG - Intergenic
1038112493 8:24514819-24514841 CTGATGTCATTCTCCTTCCCTGG + Intronic
1041356592 8:57006757-57006779 ATGCTGTGATTTTCACCCACAGG - Intergenic
1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG + Intronic
1043007477 8:74837437-74837459 CAGCTGTCAGTTTCCCTTATTGG + Intronic
1043164293 8:76884052-76884074 CAACTGCCATTTTCCCTCACAGG + Intergenic
1043267535 8:78285558-78285580 CTCAGGTGATTTTCCCTCACTGG - Intergenic
1044765922 8:95573693-95573715 CTGCTCTCAGTTTCTCTTACTGG - Intergenic
1047487055 8:125340989-125341011 CTGCTTACGTGTTCCCTCACTGG + Intronic
1048787331 8:138063961-138063983 CTGCTGTCCCTTACCCACACAGG - Intergenic
1049026338 8:139991986-139992008 GTCCTGCCCTTTTCCCTCACAGG - Intronic
1049595537 8:143481625-143481647 CTGCCTTCAGTTTCCCTCCCAGG - Intronic
1050821281 9:9882940-9882962 CTTCTCTCTTTCTCCCTCACTGG + Intronic
1052405219 9:28051087-28051109 CTGCTTTCCTTTTCCTACACAGG + Intronic
1052918471 9:33942790-33942812 CAGCAGTCATTTTCCTTCAGTGG - Intronic
1053141763 9:35686924-35686946 CTCCTCTCATTTTCCTTTACTGG - Intronic
1054965776 9:71025810-71025832 CTGGTGTCCTGTTCCCTCAGTGG - Intronic
1056755170 9:89377118-89377140 CTGCTGTGTTTTGCCCTCTCTGG - Exonic
1057560788 9:96126621-96126643 CCTATGTCATTTTCCCTCGCAGG + Intergenic
1059174824 9:112160201-112160223 CTGCTATCATCTTCTCTCTCAGG - Intronic
1059295861 9:113270027-113270049 TTGCTTTTGTTTTCCCTCACTGG - Intronic
1062716583 9:138013477-138013499 CTGCTGTGATATTCACTCCCTGG + Intronic
1186374222 X:8981110-8981132 CTGCTGTCCTTACCCCTCTCAGG + Intergenic
1187391626 X:18890096-18890118 CAGCTTTCTTTTCCCCTCACAGG + Intergenic
1187751524 X:22470964-22470986 CTGCTGTAATTTGACCTCTCTGG - Intergenic
1189770553 X:44421874-44421896 CTGCTATCATTTTACTTAACTGG - Intergenic
1190443310 X:50497208-50497230 CACCTGTCATTTTCACTAACAGG - Intergenic
1191922399 X:66270750-66270772 CTGATCTCATTTCTCCTCACTGG + Intergenic
1192044402 X:67656790-67656812 GTGCTGTCATTTGCTCCCACTGG - Intronic
1192057229 X:67785296-67785318 ATGATGCCATTTTCCCTCTCTGG - Intergenic
1194452442 X:94061381-94061403 CTGCTGTCATGTTCAATCATTGG + Intergenic
1197007357 X:121517607-121517629 TTTCTGTCATTTTTCCTCCCTGG + Intergenic
1197765388 X:130056724-130056746 CTGGTGTTTTTTTCCCCCACTGG + Exonic
1199124073 X:144093141-144093163 TTGCTGTCAATCTCTCTCACTGG + Intergenic
1199300217 X:146204686-146204708 ATGCTCTCTTTTTCCTTCACGGG + Intergenic
1200179194 X:154140275-154140297 CTGCTGTCATCTTGACTCAGGGG - Intergenic