ID: 932841297

View in Genome Browser
Species Human (GRCh38)
Location 2:75085283-75085305
Sequence GTTTTTTAGGAGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 2, 2: 22, 3: 56, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932841297_932841301 -4 Left 932841297 2:75085283-75085305 CCCTCCATGATCTCCTAAAAAAC 0: 1
1: 2
2: 22
3: 56
4: 325
Right 932841301 2:75085302-75085324 AAACCCAGCCCAGAACTCCTTGG 0: 3
1: 10
2: 34
3: 64
4: 413
932841297_932841308 12 Left 932841297 2:75085283-75085305 CCCTCCATGATCTCCTAAAAAAC 0: 1
1: 2
2: 22
3: 56
4: 325
Right 932841308 2:75085318-75085340 TCCTTGGGGAGATAAATTTGAGG 0: 2
1: 18
2: 46
3: 87
4: 325
932841297_932841303 -2 Left 932841297 2:75085283-75085305 CCCTCCATGATCTCCTAAAAAAC 0: 1
1: 2
2: 22
3: 56
4: 325
Right 932841303 2:75085304-75085326 ACCCAGCCCAGAACTCCTTGGGG 0: 3
1: 7
2: 26
3: 57
4: 263
932841297_932841302 -3 Left 932841297 2:75085283-75085305 CCCTCCATGATCTCCTAAAAAAC 0: 1
1: 2
2: 22
3: 56
4: 325
Right 932841302 2:75085303-75085325 AACCCAGCCCAGAACTCCTTGGG 0: 3
1: 8
2: 26
3: 59
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932841297 Original CRISPR GTTTTTTAGGAGATCATGGA GGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
903173574 1:21568095-21568117 CTCTTTTAGGTGATCATGGGGGG + Exonic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
905826638 1:41030592-41030614 TTTTACTAGGAGATCAGGGAAGG - Intronic
906451223 1:45949905-45949927 GTCTTTTGCGAGAACATGGATGG + Intronic
906883333 1:49617187-49617209 GTATTTTAGGAAAGCAAGGAGGG - Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
907911774 1:58833584-58833606 GTTTCATAGGGGATCAGGGAGGG - Intergenic
907921303 1:58915252-58915274 GTACTTTGGGAGCTCATGGAGGG + Intergenic
908626056 1:66043805-66043827 GTTCTCTAGTAAATCATGGATGG + Intronic
908933802 1:69348781-69348803 CTTTTTTAAGAGATAATTGATGG + Intergenic
910139733 1:84013917-84013939 GTCTTTTACAAGAACATGGATGG + Intergenic
912139647 1:106707628-106707650 GTCCTTTAGAAGAACATGGATGG - Intergenic
912279943 1:108302818-108302840 GATTTTTAGGAGCTCTTGTAAGG + Intergenic
912288283 1:108391539-108391561 GATTTTTAGGAGCTCTTGTAAGG - Intronic
912885064 1:113462398-113462420 GTCTTTTGTGAGAACATGGATGG + Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914414173 1:147463061-147463083 GTCTTTTGGGGGAACATGGATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916173287 1:162017971-162017993 GTCTTTTATGGGAACATGGATGG + Intronic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918709742 1:187712103-187712125 GTTTTTTAATAGATCTTTGATGG + Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
919423539 1:197402359-197402381 GTCTTTTGTGAGAACATGGATGG - Intronic
919641232 1:200046650-200046672 CATTTTTAAGAGATCATGAAAGG + Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920816349 1:209336773-209336795 GTCTTTTATGGGAACATGGATGG + Intergenic
921102762 1:211944728-211944750 GTTTTATATGAGCTCATTGATGG - Intronic
921126253 1:212180596-212180618 GGTTTTTGGGAGCCCATGGATGG + Intergenic
922180543 1:223229537-223229559 CTTTTTTAGTATTTCATGGAAGG + Intronic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
923827183 1:237513288-237513310 GTTCTGTAGGACATCAAGGATGG - Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1062849438 10:732057-732079 GTCTTTTATGGGAACATGGATGG + Intergenic
1064642111 10:17425782-17425804 GTTGTTTAGGAGATAATTGCAGG + Intronic
1065246884 10:23767750-23767772 CTGTATTAGGAAATCATGGAGGG - Intronic
1066552990 10:36580226-36580248 GATTTTTAAAAAATCATGGATGG - Intergenic
1067348934 10:45458076-45458098 GTTTTCTAGGAGACTAAGGAGGG + Exonic
1067665775 10:48277279-48277301 GTTTTTCATGGGAACATGGATGG - Intergenic
1068284869 10:54921634-54921656 GTCTTTTATCAGAACATGGATGG - Intronic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069234194 10:66049632-66049654 GTCTTTTATGGGAACATGGATGG + Intronic
1071080959 10:81810551-81810573 CTTTTTAAAGAAATCATGGAAGG - Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1072033610 10:91544058-91544080 GTATTTTGGGAGACCAAGGAGGG + Intergenic
1074859056 10:117496417-117496439 TTTTTTTAGTAGAACATGTAAGG - Intergenic
1074979645 10:118609215-118609237 GTTTCTTAGGAGGGAATGGATGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1078511651 11:11988666-11988688 GTCTTTGAGGACACCATGGAGGG + Intronic
1079680253 11:23287615-23287637 GTCTTTTGGGAGAACATGGATGG + Intergenic
1080177139 11:29378668-29378690 TTTTTTTAGGAGATCATTAAGGG - Intergenic
1080991117 11:37536878-37536900 ATTTTTTGTGAGATCATGGATGG + Intergenic
1082305633 11:50570602-50570624 GATATTTGGGAGCTCATGGAAGG - Intergenic
1083238941 11:61371473-61371495 GTTTTATAGGACATCTTGAAAGG - Intergenic
1083575875 11:63790826-63790848 GTACTTTAGGAGATCAAGGGAGG + Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084293079 11:68188736-68188758 GTTTTTTAGGAAATCACTGTTGG - Intronic
1089687538 11:120165975-120165997 GTCTTTTATGGGAACATGGATGG - Intronic
1090081055 11:123613070-123613092 GATGTTTAAGAGATCATTGAGGG + Intronic
1090762634 11:129850570-129850592 GTTTCCTAGGACTTCATGGAGGG - Intronic
1091279725 11:134374978-134375000 GTTTTTGAGGAGACGATGGCGGG + Exonic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092995317 12:13944216-13944238 GGGTTTTAGGAAATCATGGAAGG - Intronic
1094274110 12:28649687-28649709 GTTTTTTACAAAATCTTGGAGGG + Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1095842928 12:46714173-46714195 GTTTTTTGTGAGAACATGAATGG - Intergenic
1096088228 12:48880701-48880723 GGTTTATATGAGATCATGCAAGG - Intergenic
1096949995 12:55458485-55458507 GTTTTTTGTGGGAACATGGATGG + Intergenic
1097237972 12:57552629-57552651 GATTTTTAGGAGACCCTTGAGGG + Intronic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098850939 12:75594926-75594948 GTCTTTTGGGGGAACATGGATGG + Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1101423198 12:104565946-104565968 GTTTCTTGGGAGAGCAGGGATGG + Intronic
1101871314 12:108567806-108567828 TTTTTTTAGGATAGCAGGGAGGG - Intronic
1102648314 12:114418254-114418276 GTACTTTGGGAGATCAAGGAGGG + Intergenic
1106704296 13:32264566-32264588 GTTCTTTAGGAGAGGAAGGAAGG - Intronic
1109316966 13:60761136-60761158 GTTTTTTGCCAGAACATGGATGG - Intergenic
1109392598 13:61711650-61711672 GTTATTTTGGAGATCAAGTATGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111529767 13:89521721-89521743 GTTTTTAAAGATATCAAGGAAGG + Intergenic
1111648499 13:91061740-91061762 GTTTTTTAAGAAATCTTGTAGGG + Intergenic
1115788248 14:36850496-36850518 TTTTTCTAAGAGACCATGGATGG - Intronic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1118179886 14:63481936-63481958 ATTTTTTAGAAGATGATGGTAGG + Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1120291532 14:82578807-82578829 TTTTGTTAGAAGATCATGTAGGG - Intergenic
1120725643 14:87936950-87936972 GTTCTTCATGATATCATGGATGG + Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124964753 15:34424536-34424558 GTTTTCTAGCTGATCATGGCTGG - Intronic
1124981369 15:34570762-34570784 GTTTTCTAGCTGATCATGGCTGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1127180740 15:56414544-56414566 GTTTTTTGTGGGAACATGGATGG - Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131485536 15:92817063-92817085 ATTTTTTAAGAGTTAATGGATGG + Intergenic
1133653932 16:7841148-7841170 GTCTTTTATGGGAACATGGATGG - Intergenic
1133684248 16:8150629-8150651 GTGTTTTGGGAGACCATGGTTGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1134840945 16:17401121-17401143 GTTTTTTCAGAGATCATGGCTGG + Intronic
1135164493 16:20126656-20126678 ATTTTTTAGGAGATCATGGAAGG + Intergenic
1135499544 16:22981773-22981795 GTGTTTTAGGAGCTCACAGAGGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137638307 16:50006671-50006693 GTTTTTTGTGGGAACATGGATGG + Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1139726084 16:68899843-68899865 GAATTTTTGGAGGTCATGGAGGG - Intronic
1139938661 16:70589540-70589562 GTCTTTTATGGGAACATGGATGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140595457 16:76403887-76403909 GTCTTTTATGGGAACATGGATGG + Intronic
1140644744 16:77017418-77017440 CTTTTTTAGCAGGTCTTGGAAGG + Intergenic
1141184470 16:81777545-81777567 TTTTTTAAAGAGATCTTGGAAGG - Intronic
1142317858 16:89360208-89360230 GTCTTTTATGGGAACATGGATGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143597966 17:7926883-7926905 GTGCTTTAGGAGCTCATGGTGGG + Intronic
1145416673 17:22718990-22719012 GTTTTTTAGGACAGCATCCATGG - Intergenic
1145848022 17:28060797-28060819 ATTTTTTATGATAGCATGGATGG + Intronic
1146840162 17:36146487-36146509 TTGTATTAGGAGATGATGGAGGG - Intergenic
1148512492 17:48184335-48184357 TTTTTTTGGGATTTCATGGAAGG + Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149202866 17:54208090-54208112 GTCTTTTATGGGAACATGGATGG + Intergenic
1150518005 17:65835032-65835054 GTCTTTTATGGGAACATGGATGG + Intronic
1150600610 17:66647565-66647587 GGTTTATAGGAGATACTGGAAGG - Intronic
1151143943 17:72021303-72021325 GTTTTTTGCGGGAACATGGATGG - Intergenic
1154320034 18:13341928-13341950 GTTTTTTAAAAAATCATGAATGG + Intronic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157788522 18:50508443-50508465 GTCTTTTGGGGGAACATGGATGG + Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159190062 18:65029711-65029733 ATTTTGAAGCAGATCATGGAGGG - Intergenic
1160665372 19:325691-325713 GCTTTGCAGGAGATCATGGTGGG - Exonic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162790164 19:13058583-13058605 ATTTTTTAGGAGAGCTAGGAGGG + Intronic
1162857446 19:13479741-13479763 GTCTTTTAGGACAGCATGGCAGG - Intronic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163921128 19:20289812-20289834 GTTTCTTAGGTTATCATGCAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1165579280 19:36848439-36848461 GTTTTTTAGGAGACATTGGTGGG + Intronic
1168318551 19:55494790-55494812 GTTTTCTTGGGGAGCATGGAGGG - Intronic
926699441 2:15793434-15793456 GAGCTTTAGGAGATCCTGGAGGG - Intergenic
928562978 2:32510712-32510734 GTCTTTTATGAGATCATCTAAGG - Intronic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930977749 2:57484688-57484710 GTTTTAGAGCAGAGCATGGATGG + Intergenic
932262651 2:70340109-70340131 GTGCTTTGGGAGAACATGGAAGG - Intergenic
932524269 2:72446462-72446484 GTCTTTTATGGGAACATGGATGG + Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
935411683 2:102771049-102771071 GTTTTTTGGGTGTTCATGTATGG + Intronic
935562444 2:104573144-104573166 GTATATGATGAGATCATGGACGG - Intergenic
936273484 2:111070344-111070366 GTCTTTTACGGGAACATGGATGG + Intronic
937446751 2:121964925-121964947 GTGTTTTATGGGAACATGGATGG + Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939236623 2:139502613-139502635 GTCTTTTATGGGAACATGGATGG + Intergenic
939756653 2:146121580-146121602 GTGCTTTAGGAGACCAAGGAGGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940447102 2:153788428-153788450 TTTTTTTAGGAGCTCTTGTAAGG - Intergenic
941994779 2:171592051-171592073 TATTTTTAGGAGAAAATGGATGG + Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943087896 2:183335384-183335406 GTTTTTTAAAAAATCATGAATGG + Intergenic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945160695 2:206887388-206887410 TTTTTTCAGGGGCTCATGGATGG - Intergenic
947254080 2:228142538-228142560 GTTTTTTGTGAGAACATGGATGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947661815 2:231875158-231875180 CATTTTTATGAGGTCATGGACGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1169772781 20:9219646-9219668 TATTTTTAGGAGAGGATGGAGGG - Intronic
1170583035 20:17712999-17713021 ATATTTTGGGAGATCAAGGAGGG + Intronic
1173909280 20:46651927-46651949 GTTTTTTGCGGGAACATGGATGG + Intronic
1177834873 21:26177033-26177055 GCATTTTAGGAGATCAAGGAGGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182500059 22:30740157-30740179 GTTTTTAAGGATAACTTGGAGGG + Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949524897 3:4893836-4893858 GTCTTTTGGGGGAACATGGATGG + Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950369998 3:12521089-12521111 GTCTTTTGTGAGAACATGGATGG - Intronic
950511826 3:13433895-13433917 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
950803924 3:15580382-15580404 ATTTCTTAGGAGGTCAAGGAAGG - Intronic
952044914 3:29306831-29306853 GTGTATGAGGAGAACATGGAAGG - Intronic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
955503872 3:59611888-59611910 GTTTTTTTCCTGATCATGGAAGG + Intergenic
956790593 3:72677188-72677210 CTTTGTTAGGAGATCTTGGGCGG - Intergenic
957178009 3:76838073-76838095 GTCTTTTACGGGAACATGGATGG + Intronic
957725908 3:84067055-84067077 GTTTTTTAGGATAGCTTGGTGGG + Intergenic
957763256 3:84587426-84587448 GTGTTTTGTGAGAACATGGATGG - Intergenic
957962651 3:87278791-87278813 ATTTTTGAGGTGAACATGGATGG - Intergenic
958256938 3:91335745-91335767 GTTTTTTACAGGAACATGGATGG - Intergenic
958496909 3:94856545-94856567 GTCTTTTGGGGGAACATGGATGG - Intergenic
958748205 3:98163280-98163302 GTGTCTTAGGACTTCATGGAAGG - Intergenic
959537140 3:107499451-107499473 GTACTTTAGGAGGCCATGGAGGG + Intergenic
959976755 3:112469497-112469519 GTTCTTTGGAAGTTCATGGAAGG - Intronic
961222404 3:125211644-125211666 GTATTTAAGGAGCTCAGGGAAGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
962763557 3:138540932-138540954 GTCTTTTGCGAGAACATGGATGG + Intronic
963178033 3:142322388-142322410 GTTTTTTTAGAGATGATGGTCGG + Intronic
963502854 3:146150415-146150437 GTTTTTTGCGAGAACATGGATGG + Intronic
964717570 3:159738826-159738848 CTTTTTTAGGTGGTCAGGGAAGG + Intronic
967340241 3:188389468-188389490 GATTTCTAAGAGACCATGGAGGG - Intronic
967709992 3:192695850-192695872 GTACTTTAGGAGGCCATGGAGGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
969659910 4:8520605-8520627 GTTTTGTAGGAGATCCTGTTTGG + Intergenic
969833289 4:9816363-9816385 GGTTTTCAGGAGATGAGGGAAGG + Intronic
972419542 4:38873763-38873785 GTTTTATAGGAAATCGTGGGAGG + Intronic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
974475286 4:62371116-62371138 GTTTTCAAGGTCATCATGGAGGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974665924 4:64961488-64961510 GTTCTATAGGATATCATAGAAGG + Intergenic
974905001 4:68044733-68044755 GTTTTTTGTGGGAACATGGATGG + Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
975105635 4:70565771-70565793 GTTTTTTGTGGGAACATGGAAGG - Intergenic
975212793 4:71720914-71720936 TTCTTTTAGGAGATCTTGTAAGG + Intergenic
975603695 4:76130226-76130248 CTTTTTTAGGAGACCAGGGTGGG - Intronic
976008091 4:80454841-80454863 GTTTTTAAGGATAACATGGTGGG + Intronic
976008439 4:80458727-80458749 ATTTTTGGGGAGATCCTGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977729815 4:100337892-100337914 GTCTTTTGGGGGAACATGGATGG + Intergenic
978211814 4:106146285-106146307 GTCTTTTATGGGAACATGGATGG + Intronic
978319339 4:107477167-107477189 GTTTTTAAGGAGAACTTGGTGGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978793639 4:112687878-112687900 GCTTTTGGTGAGATCATGGAGGG - Intergenic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
980673164 4:136037036-136037058 TTTGTTTAAGAGATCAGGGAAGG - Intergenic
980771074 4:137373999-137374021 GATTTTAAGGAAATAATGGAGGG + Intergenic
980839591 4:138241695-138241717 GTTTTTGAGGAGTGAATGGATGG - Intronic
980934933 4:139217513-139217535 GGTTTTTAGGAGATAATTAAGGG + Intergenic
981079053 4:140620096-140620118 GTATTTTATGGGAACATGGATGG - Intergenic
981283414 4:142987373-142987395 GTCTTTTATGGGAACATGGATGG - Intergenic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982611753 4:157583010-157583032 GATTTGAATGAGATCATGGAGGG + Intergenic
982810815 4:159824030-159824052 GTTTTTATGGAGATCTTGAAGGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
983980429 4:173989205-173989227 GTTTCTTAAGATACCATGGAGGG + Intergenic
984481494 4:180309331-180309353 GTTAATCAGGAGATCATGAATGG - Intergenic
984823271 4:183903219-183903241 GTTTGTGATGAGGTCATGGAAGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
985436805 4:189938641-189938663 CTGATTCAGGAGATCATGGATGG - Intergenic
985623818 5:973160-973182 GTCTTTCAAGAGAACATGGATGG + Intergenic
986499939 5:8388132-8388154 GTCTTTTGTGAGAACATGGATGG - Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987597119 5:20016151-20016173 GTCTTTTGGGGGAACATGGATGG + Intronic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988914369 5:35877511-35877533 GTTTCCTCTGAGATCATGGACGG - Exonic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990170151 5:53038842-53038864 GTGTTTTAGGAGGCCAAGGAGGG + Intronic
990290749 5:54348787-54348809 GTCTTTTAAGAGGTCATGAAAGG + Intergenic
992164991 5:74040655-74040677 GTTTTGTAGGAGATCAAGAAGGG - Intergenic
992172079 5:74112855-74112877 ATTTATTAGGAGTTCATGGGAGG - Intergenic
992172595 5:74119181-74119203 GTTTCTAAGAATATCATGGATGG - Intergenic
993558392 5:89370956-89370978 GTCATTTAGGACAACATGGATGG + Intergenic
994073495 5:95626664-95626686 GTTTTTTAGGGAATCTAGGAAGG + Intergenic
994433330 5:99696148-99696170 GTATTTTGTGAGAACATGGATGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995322141 5:110847543-110847565 GTCTTTTACAAGAACATGGATGG - Intergenic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
997555618 5:134795617-134795639 GTATTTTGGGAGACCATGGTAGG + Intronic
999414363 5:151381802-151381824 GTTTTTAAGGATAACATGGTGGG - Intergenic
999517822 5:152318613-152318635 GCTTTAGAGGAGAGCATGGAAGG - Intergenic
1000834649 5:166138832-166138854 GTATTTTAGGAGGTCAAGGTGGG - Intergenic
1001674087 5:173498071-173498093 TTTTTTTAGGAGTTTATGTATGG + Intergenic
1001721046 5:173857183-173857205 GTTTCTTAGAAGATCATGCAAGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1004153234 6:13141350-13141372 GTTCTTTAGGACATCATGAATGG - Intronic
1004878844 6:19985230-19985252 TTTTTTTAGCAAATCATTGAAGG + Intergenic
1009186872 6:60584687-60584709 GTTTTTTACAGGAACATGGATGG + Intergenic
1011784985 6:90833522-90833544 AGTCTTTAGGAGATCAGGGAGGG + Intergenic
1012106917 6:95173867-95173889 CATTTTTAGTAGTTCATGGAAGG + Intergenic
1013316168 6:108945295-108945317 GTTTTTTGGAAGAACATGAAGGG + Intronic
1014256153 6:119161605-119161627 GCTTTCTAGGAAATGATGGAAGG + Intergenic
1014896284 6:126904004-126904026 GTTTTTTAGAAGATAATCAATGG - Intergenic
1015474048 6:133638995-133639017 GTCTTTTGAGAGAACATGGATGG - Intergenic
1016095123 6:140027445-140027467 GTCTTTTATGGGAACATGGATGG - Intergenic
1016501812 6:144728536-144728558 GTTAAATAGGAGATGATGGAAGG + Intronic
1016567242 6:145469859-145469881 GTTATTTACAACATCATGGATGG + Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553666 7:1617788-1617810 GTCTTTAAAGAGATAATGGAGGG + Intergenic
1020163333 7:5789024-5789046 GTGTTTTAGGAGGTCAAGGTGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1021336542 7:19409611-19409633 GTTCTTTGCGAGAACATGGATGG - Intergenic
1021525113 7:21578185-21578207 ATTTTACAGGGGATCATGGAGGG - Intronic
1023063016 7:36347347-36347369 GTTTTTTAGCACATGATTGATGG - Intronic
1024385456 7:48746960-48746982 GTTCTTTGCGAGAACATGGATGG - Intergenic
1025270215 7:57504565-57504587 GTCTTTTATGAGAACATGTATGG - Intergenic
1025583758 7:62754549-62754571 GATTTTTAGGAGCCCATGGAGGG + Intergenic
1025589054 7:62832186-62832208 GATATTTAGGAGCTCATTGAGGG + Intergenic
1026213838 7:68330703-68330725 GTGTTTAAGGAAATCACGGAGGG - Intergenic
1026397211 7:69967508-69967530 GTGTTTTAGGAGCTCAGGGAAGG + Intronic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027250916 7:76398132-76398154 GTTCCTCAGGAGATCAGGGAAGG - Intronic
1027597348 7:80190793-80190815 CCATTTTAGGAGATCATGAAGGG + Intronic
1028088885 7:86672609-86672631 TTTTTTCAGGAGACCATGGCTGG + Intronic
1028740962 7:94274558-94274580 GGTTTCTAGGAGATCATTGTAGG - Intergenic
1028979300 7:96949574-96949596 GTTTGTTATGAGATCCTGGGAGG + Intergenic
1029641919 7:101826446-101826468 GTACTTTAGGAGACCAAGGAGGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1032161263 7:129512639-129512661 GTTTTTTAGGAGCTATAGGATGG + Exonic
1032616025 7:133471908-133471930 GTGTTTTAGGAGTTCAGGAAAGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1035889742 8:3330435-3330457 GTCTTTTGTGAGAACATGGATGG + Intronic
1037626464 8:20611561-20611583 GTTTTCTAGGTAAACATGGAAGG + Intergenic
1038032769 8:23658832-23658854 GTTTTTTAAAAAATCATGAAAGG + Intergenic
1038517311 8:28198147-28198169 GCACTTTAGGAGATCAAGGAGGG + Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1038711282 8:29948921-29948943 GTTTCTTAGAAGATTAAGGAAGG + Intergenic
1039495184 8:37975025-37975047 GTTTTTGAAGAAGTCATGGATGG + Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1042255963 8:66804048-66804070 GTTTTAAAGGAGATCATGTATGG - Intronic
1043245260 8:77991382-77991404 GTTTTTTCGGAGATGGTGGCAGG + Intergenic
1043321752 8:78995611-78995633 GTCTTTTATGACAACATGGATGG + Intergenic
1043592686 8:81848438-81848460 GTTATTTGGGAGATAAAGGATGG - Intergenic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044719224 8:95129692-95129714 TTATTTTAGGAAATGATGGAAGG + Intergenic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048319867 8:133390099-133390121 ATTTATGAGGAAATCATGGAAGG - Intergenic
1048754598 8:137723594-137723616 GTTTTTTACAGGAACATGGATGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050421263 9:5467663-5467685 GTTTTCCAGGATATCATGTAAGG + Intronic
1050974956 9:11926310-11926332 GTTTTTGGGGGGAACATGGATGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052948906 9:34192088-34192110 GTACTTTAGGAGGCCATGGAGGG - Intronic
1054077432 9:60551749-60551771 GGGTTTTAGGAGAGCATTGAGGG - Intergenic
1054082909 9:60645460-60645482 GGGTTTTAGGAGAGCATTGAGGG - Intergenic
1055196645 9:73602132-73602154 GTTTTTTAGGGGAAAATGAATGG - Intergenic
1055912396 9:81367620-81367642 GTCTTTTATGGGAACATGGATGG + Intergenic
1056246618 9:84701701-84701723 GTATTTTAGGAGGTAAAGGAGGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1056681114 9:88720057-88720079 GTTTGTGAGGAGAACAAGGAAGG + Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1058185981 9:101855411-101855433 GTTATCTAGGAGATTATAGAGGG - Intergenic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1058725916 9:107804002-107804024 ATTGCTTAGGAGATCATGGTAGG + Intergenic
1060495625 9:124116400-124116422 GTATTTTACCAGAACATGGATGG + Intergenic
1060990297 9:127845152-127845174 GTTTTCTTGGAGATCAAAGATGG + Intronic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1185871873 X:3671422-3671444 GTGTTTTGGGAGAACATGGCAGG - Intronic
1185907597 X:3950392-3950414 GTTTTTCAGGAGAACAAAGAGGG + Intergenic
1186505641 X:10089847-10089869 GGTTTTCAGGATAACATGGAGGG + Intronic
1186576747 X:10775030-10775052 GGTTTTTTGGAGATCCTGAATGG + Intronic
1188440822 X:30214292-30214314 ATTTGCAAGGAGATCATGGAGGG + Intergenic
1188574881 X:31636032-31636054 GATTCTTCAGAGATCATGGATGG + Intronic
1189316989 X:40063513-40063535 GCTTTTGAGGAGATCTTAGAAGG - Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190668341 X:52716096-52716118 GTTTTTTTGGTGTTCAAGGAAGG + Intergenic
1190671076 X:52742308-52742330 GTTTTTTTGGTGTTCAAGGAAGG - Intergenic
1190857405 X:54310228-54310250 ATTTTGTAGAAGATAATGGAAGG - Intronic
1191885930 X:65887958-65887980 GTTTTATGGGAGAGCATGGTAGG - Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1192598209 X:72433873-72433895 GGTTGTTAGGAGACCATGTAAGG + Intronic
1193030732 X:76895928-76895950 GTCTTTTAGGGGAACATGAATGG + Intergenic
1193093780 X:77524989-77525011 GTATTTTGGGAGATCAAGGTGGG - Intronic
1193203835 X:78724659-78724681 GTTGATTAGGAGATAATTGATGG - Intergenic
1193456420 X:81736985-81737007 GTTTTCTAGGGGATCTTGGGTGG - Intergenic
1194094029 X:89614470-89614492 GTCTTTTATGGGAACATGGATGG + Intergenic
1194380560 X:93185952-93185974 GTGTTTTAAAAAATCATGGAAGG - Intergenic
1195258604 X:103112159-103112181 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
1195472962 X:105253852-105253874 GTCTTTTATGGGAACATGGATGG - Intronic
1196279961 X:113812492-113812514 ATTTTTGAAGGGATCATGGAGGG - Intergenic
1196551434 X:117031342-117031364 GTTTTTTGTAAGAACATGGATGG + Intergenic
1196741433 X:119029286-119029308 GTCATTCAGGTGATCATGGAAGG + Intergenic
1196757012 X:119166846-119166868 ACTTTTCAGGAGATCAGGGAGGG - Intergenic
1197132011 X:123016313-123016335 GTTTTTGGGTAGATGATGGATGG - Intergenic
1197163578 X:123350954-123350976 GATTTGTTGGAGATGATGGATGG - Intronic
1199482234 X:148310447-148310469 CATGTTTAGGAGAGCATGGAAGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1199699853 X:150366990-150367012 ATTTTTAAGGAGATCTTGTAAGG - Intronic
1200446649 Y:3270614-3270636 GTCTTTTATGGGAACATGGATGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic