ID: 932842413

View in Genome Browser
Species Human (GRCh38)
Location 2:75095814-75095836
Sequence AAGGGCACACAGAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932842413_932842418 -6 Left 932842413 2:75095814-75095836 CCCTGTCCCTTCTGTGTGCCCTT 0: 1
1: 0
2: 6
3: 67
4: 505
Right 932842418 2:75095831-75095853 GCCCTTCTAGATGCTCCAGGTGG 0: 1
1: 0
2: 0
3: 19
4: 142
932842413_932842417 -9 Left 932842413 2:75095814-75095836 CCCTGTCCCTTCTGTGTGCCCTT 0: 1
1: 0
2: 6
3: 67
4: 505
Right 932842417 2:75095828-75095850 TGTGCCCTTCTAGATGCTCCAGG 0: 1
1: 0
2: 0
3: 27
4: 232
932842413_932842422 10 Left 932842413 2:75095814-75095836 CCCTGTCCCTTCTGTGTGCCCTT 0: 1
1: 0
2: 6
3: 67
4: 505
Right 932842422 2:75095847-75095869 CAGGTGGTACAGCTACAAGATGG 0: 1
1: 0
2: 5
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932842413 Original CRISPR AAGGGCACACAGAAGGGACA GGG (reversed) Intronic
900474534 1:2869929-2869951 CCGGGCACACAGCAGGCACAAGG - Intergenic
900861545 1:5236378-5236400 AAGCTCACTCAGAAGGCACAAGG + Intergenic
901137220 1:7005758-7005780 AAGGACACAAAGAAGAGAAAAGG + Intronic
901739927 1:11335172-11335194 CAGGGCCCAAAGAAGGGATAGGG - Intergenic
902635576 1:17733064-17733086 AAGGCCACACAGCTAGGACATGG + Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902696866 1:18146023-18146045 AAGGTCACACAGCAGAGCCAGGG - Intronic
902792902 1:18781207-18781229 AAGATCACACAGCAGGTACAAGG - Intergenic
902875231 1:19337026-19337048 AAGGGCACACAGGTGGGCCTAGG - Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
903039070 1:20514911-20514933 ACAGGAACTCAGAAGGGACAAGG + Intergenic
903347371 1:22695265-22695287 AAGGGCACACAGCTGGGAGGTGG - Intergenic
903996444 1:27307924-27307946 AAGGTCACGGAGAAGAGACAGGG - Exonic
904753926 1:32757748-32757770 AAGGCCACACAGCAAGGAGATGG + Intronic
904785966 1:32983261-32983283 AAGGGCAGAGAGAAGGGCAAGGG + Intergenic
905104086 1:35552461-35552483 AAGGTCACACAGCAAGAACATGG - Intronic
905334941 1:37238740-37238762 AAGGCCACACAGCAAGGAGACGG - Intergenic
905412396 1:37779579-37779601 TGGAGGACACAGAAGGGACAGGG + Intergenic
906285595 1:44585723-44585745 AAGGTCACACAGCAGAGCCAAGG - Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906693821 1:47810904-47810926 ATGGGCAGGCAGAAGGGAAAGGG - Intronic
906759077 1:48356318-48356340 AAGGGCATACAAAAGAGAAAGGG - Intronic
906800472 1:48732767-48732789 AAGGGCACACTGAAGGCAATGGG + Intronic
907138532 1:52162469-52162491 AAGGGCAAACAGAAAGGAGCTGG - Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
907255681 1:53177023-53177045 GCTGGCACACAGAAGGGAGAGGG - Intergenic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907504328 1:54906816-54906838 AAGAGCACAGAGAAGGGAGATGG - Intergenic
907604358 1:55802158-55802180 AAGGGCAAACGGAAGGGTCAAGG - Intergenic
911178473 1:94840904-94840926 AAGGGCACGCAGGAGGCTCAAGG + Intronic
911193353 1:94969614-94969636 AAGGGCCGACAGGAGGGACGGGG + Intergenic
911922311 1:103780850-103780872 AAGGGCTCACAGAAGACACTGGG + Intergenic
912952876 1:114132591-114132613 AAGGTCACACAGAAAACACATGG + Intronic
913120651 1:115737580-115737602 AAGAGCAGGCAGAAGGGACCAGG - Intronic
914707513 1:150182600-150182622 AACGACACACAGAAGAGGCAAGG + Intergenic
915002537 1:152606633-152606655 AAAGGCACTGGGAAGGGACAAGG - Intergenic
915160255 1:153914450-153914472 AAGGTCACACAGATGGTAAATGG + Intronic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917535709 1:175872947-175872969 AAAGGGAGAGAGAAGGGACAAGG + Intergenic
917981511 1:180272345-180272367 AAGGGGACAAAGATGGGAGAGGG - Intronic
918060090 1:181053515-181053537 AAGTTAACACAGAAGGGAAAGGG + Intronic
918234810 1:182570340-182570362 AAGGGAAGACAGAGGGGTCAGGG - Intergenic
918274654 1:182942235-182942257 AAGTGCAAACAAAAGGGAAAAGG - Intronic
919517117 1:198539639-198539661 AAGGTCACACAGAGGGTAAATGG - Intronic
920308543 1:205034287-205034309 CAGGGCACACAGCATGGAGAGGG - Intergenic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920541716 1:206783786-206783808 AAGGTCACACAGATGGGAAAGGG - Intergenic
920674678 1:208030772-208030794 AAGAGCACAGAGAGGGGAGAGGG - Intronic
920866641 1:209758880-209758902 AAAGGCACAGAGAAGGAAAAGGG + Intronic
920972845 1:210757328-210757350 AGGAGTACACAGAAGGGACTGGG + Intronic
921564286 1:216698016-216698038 AGGGGCAAACGGAGGGGACAGGG - Intronic
922797349 1:228347010-228347032 AAGGGAAGGCAGAGGGGACACGG - Intronic
923496043 1:234525664-234525686 AAGGTAACATAGAATGGACAGGG - Intergenic
923565093 1:235070441-235070463 AAGGCCCCACAGCAGGGACTTGG + Intergenic
923940319 1:238816363-238816385 AAGGACAGACAGAAAGTACAAGG + Intergenic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
1064252713 10:13719054-13719076 AAGGTCACACAGACGCCACATGG + Intronic
1065845583 10:29739987-29740009 AAGGACACAGAGAAGTGACCTGG - Intergenic
1065970146 10:30799559-30799581 AGGGGCACACTGCAGGCACAGGG - Intergenic
1066760377 10:38742539-38742561 AAGGGGACAGGGAAAGGACAAGG - Intergenic
1066961221 10:42230208-42230230 AAGGGGACAGGGAAGGGGCAAGG + Intergenic
1068990816 10:63148561-63148583 AAGGGCAAACAGAGGGGACCTGG + Intronic
1069564382 10:69453421-69453443 AAGGGCTCACAGAACACACAAGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1069860557 10:71468609-71468631 AAGGGCACCTAGGAGGGAAAAGG - Intronic
1070793893 10:79205778-79205800 AAGGGCACAGAGAGGGGAGGGGG + Intronic
1070992460 10:80744483-80744505 AAGAGAACACAGAAGGGAAATGG + Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072930242 10:99656225-99656247 AGGGGCACTCAGGAGGGGCATGG + Intergenic
1073459709 10:103659626-103659648 GAGGCCTCACAGCAGGGACATGG + Intronic
1074053281 10:109899343-109899365 AAGGGGACAGAGTATGGACAGGG - Intronic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075763235 10:124872483-124872505 ATGGGCACACACTAGGGACTGGG - Intergenic
1075765950 10:124893021-124893043 AAGGACACAAAGAAGACACAGGG - Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1075953782 10:126504972-126504994 AATGGCACACGGTAGGGGCAAGG + Exonic
1077249464 11:1554609-1554631 AACGGCCTGCAGAAGGGACAAGG + Exonic
1077289132 11:1780784-1780806 AAGGGCTCCCAGAAGCGACCGGG + Intergenic
1077527237 11:3074555-3074577 TGGGACACACAGAAGGGAGAAGG + Intergenic
1077652811 11:3989292-3989314 AAGTGCAAACAAAAGGGAAAAGG - Intronic
1077675601 11:4191137-4191159 AAGTGCCCACAGAGGGGAGAGGG - Intergenic
1078240971 11:9530596-9530618 AAGTGCACTCAGAAGGGCCCTGG + Intergenic
1079130931 11:17746546-17746568 AAGGGGACAAGGAGGGGACAGGG - Intronic
1081800063 11:45852360-45852382 AAGGGACCACAGAAGGCCCAAGG + Intronic
1082000042 11:47389266-47389288 AAGGGCACACAGCCGGGAGCAGG + Intergenic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1082997537 11:59265660-59265682 CAGGGGACTCTGAAGGGACAAGG - Intergenic
1083619048 11:64039977-64039999 AAGGGAAAACAGAAGAGCCAGGG - Intronic
1084316695 11:68349795-68349817 AAAGGGACAAAGGAGGGACAAGG - Intronic
1084543451 11:69801492-69801514 AATGGCACACGGAAGGCAGAGGG - Intergenic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085453841 11:76654908-76654930 TAGGGGACACAGAGAGGACAGGG - Intergenic
1085535817 11:77216743-77216765 AAAGGCACACAGAAGGGCCACGG - Exonic
1086836808 11:91634887-91634909 AATAGCACCCAGAAGGGACTAGG + Intergenic
1088681947 11:112251209-112251231 AAGGCCACACAGAAAGTAAATGG - Intronic
1090429552 11:126634658-126634680 AGGTGCACACAGCAGGTACAAGG - Intronic
1090625990 11:128609363-128609385 GAGGGCACAGAAAAGGGAGATGG - Intergenic
1091375594 12:22866-22888 AGGGGCAGAAAGAGGGGACAGGG + Intergenic
1093552545 12:20432135-20432157 AAAGTCACACAGAAGTGGCATGG + Intronic
1093833019 12:23789108-23789130 AAGAGCACACAGAAAAGAAAAGG + Intronic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1096780280 12:53987699-53987721 AAGGGCACAGAGAGGGTACAGGG - Intronic
1096913654 12:55009492-55009514 GAGGGCACACAGTAGGGAGGGGG + Intergenic
1098856781 12:75661836-75661858 AAGGTCACACAGAAAGGAAGTGG - Intergenic
1099591650 12:84599127-84599149 AAGGTCACAGAGATGGTACATGG - Intergenic
1100677710 12:96886327-96886349 AAGGGTACTCAAAAGTGACAGGG - Intergenic
1100780690 12:98023032-98023054 AAGAGCAAACAGAAGAGGCAAGG - Intergenic
1101089417 12:101270036-101270058 AAAGGAAAACAGAGGGGACAGGG - Intergenic
1101450455 12:104772820-104772842 AAGGGCAAAAAGAAGGGGAATGG - Intergenic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101728931 12:107410683-107410705 AAGGAGAAAGAGAAGGGACAAGG + Intronic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102704378 12:114868519-114868541 TAGGGCAGACAGAAGGGAAGAGG + Intergenic
1103256246 12:119543838-119543860 AATGGCACTCACAAGGAACAAGG + Intergenic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103812928 12:123630296-123630318 AAGAGCAAACTGAGGGGACAGGG + Intronic
1103981178 12:124737984-124738006 AAGGGCACACAGCTAGGAAATGG - Intergenic
1104071807 12:125352465-125352487 AAGGGCACACAGCTGGTATATGG - Intronic
1104513051 12:129399058-129399080 AGGAGCACACACATGGGACAAGG + Intronic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105503188 13:20989526-20989548 AAGGGCACATGGGAGGGCCAAGG + Intronic
1106673230 13:31929973-31929995 AAGCGCTCATAGAAGGGAAATGG + Intergenic
1107900012 13:45002454-45002476 AAGGGAACAGAAAAGGGAAAGGG + Intronic
1108573675 13:51772969-51772991 GAAGGCACACAGCAGCGACAAGG + Intronic
1109190168 13:59314020-59314042 AAGTGCACATACAAGGTACAAGG - Intergenic
1109322299 13:60825964-60825986 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1109813710 13:67550426-67550448 GATGGCACACAAAAGGAACAGGG - Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110523023 13:76503347-76503369 TAAGGCACAAAGAAGGGAGATGG + Intergenic
1111770577 13:92590931-92590953 ACAGACACACAGAAAGGACAGGG - Intronic
1111862896 13:93730532-93730554 AATGGCACAGAGCAGGGACTAGG - Intronic
1112339281 13:98538986-98539008 AGGGGGACACAGAAAGGAAAGGG + Intronic
1113421131 13:110172203-110172225 AAGGGGACACAGAAAATACAAGG - Intronic
1113483364 13:110637735-110637757 ATGGGCTCACAGAAGAGAAATGG - Intronic
1113579833 13:111421048-111421070 AAAGGCACACACCAGGGCCAAGG - Intergenic
1115136604 14:30116842-30116864 AAGAGCAAACAGAGGGGACAAGG + Intronic
1117405175 14:55395064-55395086 AAGTGCAAACAAAAGGGAAAAGG - Intronic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119797645 14:77413708-77413730 AAGGGCACAGGGAGGAGACATGG + Intronic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121618437 14:95329864-95329886 AAGGTCACACAGCAGGGTGAGGG + Intergenic
1122257055 14:100486196-100486218 AAGCGCACCCATAAGGGACGTGG - Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1202863456 14_GL000225v1_random:100150-100172 AAGGGCACAGAGAGGCGAGAGGG + Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124119451 15:26876348-26876370 AAGTGCACACAAAAAGGAAAGGG + Intronic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263676 15:28214564-28214586 CAGGGCACAGGGAAGGGAAACGG + Intronic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1127350310 15:58145176-58145198 AAGGGCACACAGAGGAGAAAAGG - Intronic
1127630273 15:60821265-60821287 AACAGCACACAGCAGGGAGACGG - Intronic
1127649358 15:60992182-60992204 AATGGCACAAAGAAGGCCCACGG + Intronic
1127665330 15:61140558-61140580 AATGGCAGACAGAAGTGACGAGG + Intronic
1129061470 15:72863796-72863818 AAGGGCACGCAGAGGGGAGGAGG + Intergenic
1129277856 15:74459165-74459187 AGGGGCATACAGAAGGGAGAGGG - Intronic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130302368 15:82689520-82689542 CCAGGCACAAAGAAGGGACATGG + Intronic
1130688776 15:86062230-86062252 AATGCCATACAAAAGGGACAGGG - Intergenic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1131472970 15:92711953-92711975 AAGCGCAAACAAAAGGGAAAAGG + Intronic
1131604150 15:93882854-93882876 AAGAGGACACAGAAGGTAAAAGG + Intergenic
1131943201 15:97590242-97590264 AAGGGCACAAAGGAGAGACTAGG - Intergenic
1132023210 15:98382653-98382675 CAGAGCACACAGAATGGACTGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132214229 15:100050820-100050842 CAGGGCACATAGAAGGGTCATGG - Intronic
1132268838 15:100504681-100504703 TCGGGGACACAGAAAGGACAGGG + Intronic
1132321315 15:100927470-100927492 AGGGACACACACAAGGGCCAAGG + Intronic
1132400093 15:101499798-101499820 AAGGGCCCACAGAAAAGAGAAGG + Intronic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1132949058 16:2550289-2550311 AGGGGCACACAGAAGATATATGG + Intronic
1132965530 16:2651839-2651861 AGGGGCACACAGAAGATATATGG - Intergenic
1133228839 16:4356787-4356809 AAAGACACAAAGAAGAGACAGGG + Intronic
1133320465 16:4910436-4910458 AAGGTCACCCAGCAAGGACAAGG + Intronic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1135629060 16:24021712-24021734 AAGGTCACAAAGCAAGGACATGG - Intronic
1135737728 16:24945875-24945897 AAGGTCACACAGCAGGGAACTGG - Intronic
1135954806 16:26947672-26947694 AAGGACACAAAGAAGGGAACAGG + Intergenic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137674513 16:50297695-50297717 ATGGGCACAGAGTAGGGACGAGG + Intronic
1137951023 16:52783463-52783485 AAGGGAAGACAGAAGCAACATGG - Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138585962 16:57970707-57970729 AAGTGCAGTCAGCAGGGACACGG - Intronic
1138620089 16:58204213-58204235 AAGAGGACACATCAGGGACAAGG - Intergenic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1141334116 16:83138862-83138884 GAGGGCACAGTGAAGGGCCATGG + Intronic
1141827071 16:86488045-86488067 ATGGGCACAGAGAAAGGGCACGG - Intergenic
1141864508 16:86740919-86740941 AAGGGCCCAGAGAAGAGGCACGG - Intergenic
1141915452 16:87093545-87093567 CAGCCAACACAGAAGGGACATGG + Intronic
1141920374 16:87131810-87131832 GAGGGCCCACAGATGGCACACGG + Intronic
1142153448 16:88522716-88522738 CAGGGCCCAGAGGAGGGACAGGG + Intronic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143303263 17:5926753-5926775 AAGGTCACACAGCCAGGACATGG + Intronic
1143707903 17:8712405-8712427 AAAGTCACACAGATGGGACCAGG - Intergenic
1143965554 17:10754338-10754360 AAGGTCACACAGCAAGGACCTGG - Intergenic
1144848151 17:18230712-18230734 AAGGCCACACAGGAGGGGTAGGG - Intronic
1146809580 17:35892466-35892488 AAGGACAGCCAGAAGGGAGAAGG - Intergenic
1147882679 17:43664236-43664258 AAGGCCACACAGCAGGGAAGCGG + Intergenic
1147970123 17:44214855-44214877 GAGGACACAAAGAAGAGACACGG - Intronic
1148158710 17:45437748-45437770 AAGGGGACACAGCTGTGACACGG + Exonic
1149024051 17:52003706-52003728 AAGTTCACACAAAAGGGAAATGG + Intronic
1149043016 17:52212414-52212436 AGGGTCACACAGAAAGGGCAAGG + Intergenic
1150390126 17:64785146-64785168 AAGGGGACACAGCTGTGACACGG + Intergenic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1150714056 17:67556544-67556566 CAGGGCACACTGATGGGCCAAGG + Intronic
1151146662 17:72047472-72047494 GAGTGCACACAGCAGGGAGAGGG + Intergenic
1151191315 17:72400095-72400117 AAAGGGACAGAGAAGGGGCAGGG - Intergenic
1151363788 17:73604369-73604391 CAGGGCACAGGGAAGGGACCTGG + Intronic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152561687 17:81081865-81081887 AGGGCCACACAGCAGGGACCAGG + Intronic
1152975956 18:218492-218514 AAGGGCAAACAGAAGAACCATGG + Intronic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155197029 18:23485151-23485173 AAGTGCACACAAAAGGGAAAGGG + Intronic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1156032449 18:32728311-32728333 AAGGTCACACAGATGGTAAATGG - Intronic
1156266208 18:35490592-35490614 AAGGACACACTAAAGGGAAAGGG + Intronic
1157228453 18:45890246-45890268 GAGAGCACACAGAAGGGCTACGG - Intronic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1158253542 18:55517880-55517902 AAGGTCAAACAGAAGAGAGATGG - Intronic
1158502804 18:58018924-58018946 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1160017284 18:75154495-75154517 ATGGGGACAGAGAAGAGACAAGG + Intergenic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1160357646 18:78241880-78241902 AAGGACACACAGATGGGAGTGGG + Intergenic
1160575790 18:79853097-79853119 CAGGGCACACACAAGTGACCAGG - Intergenic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1161635920 19:5388760-5388782 AAGGGAAAAGAGAAAGGACAAGG + Intergenic
1161749926 19:6088180-6088202 AATGCCACAGAGAAGGGCCAGGG + Intronic
1162333585 19:10046206-10046228 AAGGGCACAGATAAGGCACTAGG + Intergenic
1162788694 19:13052019-13052041 AAGGAAAGACAGAAGGGAAATGG - Intronic
1163641958 19:18467040-18467062 AAGGCCACACAGCAGGGCCGGGG - Intronic
1163789955 19:19300826-19300848 AAGGACACACAGGAGGGCCGGGG + Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164634963 19:29785431-29785453 AAGAGAACACAGCAGGGAAAGGG + Intergenic
1164728704 19:30484573-30484595 AAGAGCACAGAGAAAGAACAAGG - Intronic
1164834296 19:31347963-31347985 AAGGGCAGAGAGTAGGGTCAGGG - Intronic
1164840299 19:31388065-31388087 AGGGGGACAAAGAGGGGACAGGG + Intergenic
1164883877 19:31760515-31760537 AAAGCCACATGGAAGGGACAGGG - Intergenic
1165223669 19:34338707-34338729 AAGGCCTCACAGCTGGGACAAGG + Intronic
1165306281 19:35004953-35004975 AGGGTCACACAGAAAGGACGCGG + Intronic
1165484671 19:36088525-36088547 CAAGGCACACAGAGAGGACAGGG - Intronic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166049071 19:40247415-40247437 AAGGTCACACAGCAGGGATGTGG + Intronic
1166432689 19:42740579-42740601 AAGGAAAAACAGGAGGGACAAGG - Intronic
1166435797 19:42765776-42765798 AAGGAAAAACAGGAGGGACAAGG - Intronic
1166485095 19:43205731-43205753 AAGGAAAAACAGGAGGGACAAGG - Exonic
1166774618 19:45304819-45304841 AATGGCACATACAAGGGCCAGGG + Intronic
1167072465 19:47228653-47228675 ATGGGCACACAGGAGGGACAGGG + Intronic
1167209243 19:48122756-48122778 AAGGGCTCGCAGCAGGGAGAAGG + Intronic
1167614702 19:50526062-50526084 AAGGGCCCAGGGGAGGGACAGGG - Intronic
1167763976 19:51468219-51468241 GAAGGCATGCAGAAGGGACAGGG + Intergenic
1168322918 19:55521121-55521143 AAGGGCACACGGCAGAGCCAGGG + Intergenic
924978270 2:197447-197469 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978281 2:197499-197521 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978298 2:197603-197625 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978309 2:197655-197677 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978320 2:197707-197729 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978331 2:197759-197781 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978352 2:197863-197885 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978363 2:197915-197937 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978374 2:197967-197989 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978385 2:198019-198041 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978396 2:198071-198093 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978427 2:198227-198249 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978438 2:198279-198301 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978449 2:198331-198353 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978460 2:198383-198405 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978471 2:198435-198457 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978482 2:198487-198509 AAAGGCAGACAGAAGGGAAAAGG - Intergenic
924978493 2:198539-198561 AAAGGAAGACAGAAGGGAAAAGG - Intergenic
925379678 2:3416564-3416586 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379695 2:3416611-3416633 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379703 2:3416634-3416656 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379712 2:3416658-3416680 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379728 2:3416704-3416726 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379737 2:3416728-3416750 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379755 2:3416774-3416796 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379764 2:3416798-3416820 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379782 2:3416844-3416866 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379791 2:3416868-3416890 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379800 2:3416892-3416914 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925384726 2:3454233-3454255 GAGGGCACACAGGTAGGACACGG - Intronic
927502887 2:23593968-23593990 AAGGGCTCACAGAGAAGACATGG - Intronic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
931865043 2:66400216-66400238 AAGGGGACAAGGAAGGGGCAAGG + Intergenic
932117558 2:69067134-69067156 AAGGGCAGAGAGTAGGGAGATGG + Intronic
932696975 2:73964968-73964990 AAGGGCACAAAGACTGGACATGG - Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933307331 2:80618647-80618669 AAGGTCACACAGCAGGGCGATGG + Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
933966724 2:87435983-87436005 AAGGGGACACAGAAGTGACAAGG - Intergenic
934784789 2:96997261-96997283 AGGAGCACACAGAAGTGACATGG + Intronic
935091087 2:99895672-99895694 CAGAGCACACAGCAGGGACTCGG + Intronic
935387549 2:102516006-102516028 AAGGGCTCACATAAGTGAAATGG - Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936719407 2:115232523-115232545 AAGGGAAATCAGAAGGCACAAGG - Intronic
936957072 2:118033294-118033316 AAGGACACAGAGAATGGAAAAGG + Intergenic
936971556 2:118181324-118181346 TAGGGCACTCAGGAGGCACATGG - Intergenic
937691763 2:124763869-124763891 TAGGGCACACTGCAGGGAAAAGG - Intronic
939129172 2:138213651-138213673 AATGGAAGATAGAAGGGACATGG + Intergenic
939583201 2:143976101-143976123 AAGATCACACAGAAGAGACTGGG + Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
942166911 2:173250363-173250385 AAGAGAACACAGCAGGGAGAAGG + Intronic
943173993 2:184444867-184444889 AAGGGCACAAAAAATGGAGAGGG - Intergenic
943465394 2:188222901-188222923 AAAGACACACAGAAGGAAGATGG - Intergenic
944508990 2:200445841-200445863 AAGGACACACAGAAAAGCCAGGG - Intronic
945202720 2:207299276-207299298 AATGGCACAAAGAAGGTAGATGG + Intergenic
945428774 2:209739795-209739817 AAGGGGAGTCAGAAAGGACAAGG + Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946349895 2:219143243-219143265 AACAGGACACAGAAGGGTCATGG - Intronic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948657764 2:239487202-239487224 AAGGGCTGAAAGGAGGGACACGG + Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948855654 2:240729396-240729418 AAGGGCACAGAGAAGGGAGTAGG - Intronic
1168805670 20:671026-671048 AAGGCCACACAGAAGGCTAATGG + Intronic
1168982876 20:2022871-2022893 AAGGTCACACAGCAAGTACATGG - Intergenic
1169217067 20:3800178-3800200 AAGGGCAAAGACAAGGGCCAAGG - Intronic
1169492897 20:6086161-6086183 AAGGACACAAAGAAGTGCCATGG + Intronic
1171027325 20:21642626-21642648 AAGTTCACACAGAAAAGACATGG - Intergenic
1171420587 20:25014782-25014804 AGGGGCACTAGGAAGGGACACGG + Intronic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1172215072 20:33229930-33229952 AAGGTCACACAGTAAGGAAATGG + Intergenic
1173404400 20:42752412-42752434 AAGGTCACAGAGTTGGGACAAGG + Intronic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174355812 20:49997229-49997251 AAAGACACAGAGAAGAGACAAGG - Intergenic
1174358269 20:50012450-50012472 AGGGGCAAAGAGAAGGGCCAAGG - Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176205563 20:63886249-63886271 GAGGGGACACAGAAGGGCCGGGG - Intronic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1179213293 21:39345233-39345255 AAGTGCAAACAAAAGGGAAAAGG - Exonic
1179251625 21:39675477-39675499 TAGAGCACACTGAAGGAACAAGG - Intergenic
1180757307 22:18170966-18170988 AAGGGAAAACAGAAAGGACATGG - Intronic
1180954530 22:19735779-19735801 AGGGGCACACAGCAGGGAGGCGG - Intergenic
1181074472 22:20366499-20366521 AAGGGAAAACAGAAAGGACATGG + Intronic
1181774471 22:25149542-25149564 AAGGGCTCAGAGAAGGGAGGAGG - Intronic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182509737 22:30810362-30810384 AAGTGTACACAGAAGACACAAGG - Intronic
1182732863 22:32509390-32509412 AAGGGCAAAAAGGAGGGAGAGGG - Intergenic
1182779381 22:32855502-32855524 AAGGCCACACAGTTGGGAAATGG - Intronic
1182878338 22:33711611-33711633 AAGAGCACAGAGAAGGGAAAAGG + Intronic
1183003709 22:34882768-34882790 AAGGCCACACAGCTGGGAAAGGG + Intergenic
1183019884 22:35018547-35018569 GAGGGCAGACAGCAGGGATATGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183356889 22:37364447-37364469 GAGGGCACTCAGAGGGGACAGGG + Intergenic
1183680998 22:39329133-39329155 AAGGATACACAGTAGTGACAGGG - Intergenic
1184268653 22:43364717-43364739 AGGGGCATACAGCAGGGTCAGGG + Intergenic
1184467490 22:44677361-44677383 AGGGGCACACAGCAGGGTCTTGG - Intronic
1185148589 22:49152027-49152049 ACGGGCACACAGCGGGGACACGG + Intergenic
950439927 3:13004619-13004641 AAAGGCCCAGAGCAGGGACAGGG + Intronic
950708935 3:14801678-14801700 AGGGACACCCAGAAGGAACAGGG + Intergenic
950956100 3:17054883-17054905 AAAGTCACACAGCAGGGACATGG - Intronic
952458434 3:33497932-33497954 AAGGGATCATAGAAGGGACATGG + Exonic
953351012 3:42216145-42216167 AAGGGGACACAGAAGAGGCTGGG - Intronic
953667897 3:44939181-44939203 AAGGAGACACAAAAGGGACATGG + Intronic
954609129 3:51935021-51935043 AAGGGCACACAGCCCGGACAAGG + Intronic
954690707 3:52394281-52394303 AAGGGCACACAGCCAGGAAAAGG + Intronic
955707686 3:61745598-61745620 AAGAGGTAACAGAAGGGACAGGG - Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
957168954 3:76712258-76712280 AAGAGCACACAGAAATCACAAGG - Intronic
960241788 3:115351376-115351398 AAGGGCAGATAGAAGGCATATGG - Intergenic
961344141 3:126250797-126250819 AAAGGCCCAGAGAAGGGAAAGGG - Intergenic
962875238 3:139530975-139530997 CAGGGCAGGCAGCAGGGACAAGG + Intronic
962967130 3:140365622-140365644 AAGGCCACACAGATGGTAAATGG + Intronic
963419791 3:145047325-145047347 AAGAGCACTCTGAAGAGACAAGG - Intergenic
964223175 3:154368976-154368998 ATGGGCGCACAGCAGGGGCAAGG + Intronic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
964611143 3:158616740-158616762 AAGGGCACACAAAAGAGTGAAGG - Intergenic
964969814 3:162545708-162545730 AAGGGCTTACAGAAGAGAGAGGG - Intergenic
965213760 3:165831555-165831577 AAGGGACCACAGAAAAGACAAGG - Intronic
968627252 4:1631515-1631537 AAGGGCACACAGCAGTCCCAGGG + Intronic
968923229 4:3533213-3533235 TTGGGCTCAGAGAAGGGACAAGG + Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969611210 4:8228653-8228675 GAAGGCACACAGAAGGAACTGGG - Intronic
969648519 4:8448449-8448471 AAGGCCTCTGAGAAGGGACATGG + Intronic
969928708 4:10609950-10609972 AAGGCCAAATAGAAGGGACCCGG - Intronic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
971474953 4:27064176-27064198 AAGGACAGACAGAAAGGAAAAGG + Intergenic
971876052 4:32309834-32309856 AAGAGCACAAAGAAGGAACTGGG - Intergenic
973834230 4:54793049-54793071 GAGGCCACACAGTAGGTACATGG + Intergenic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974391068 4:61269294-61269316 AAGGGCACACACCAGAGAAAAGG - Intronic
974968892 4:68801796-68801818 ATGGGCGCACAGCAGGGGCAAGG + Intergenic
974982656 4:68979261-68979283 AGGGGCACACAGAGGAGACTAGG - Intergenic
975012853 4:69377774-69377796 ATGGGTGCACAGCAGGGACAAGG + Intronic
975690839 4:76961313-76961335 AAGGGCACACCAAAGGGAATTGG + Intronic
977890218 4:102301276-102301298 CAGGTCACACACAAGGGACCTGG - Intronic
979303106 4:119110092-119110114 AAGGTCACACAGCAAGGAGAGGG - Intergenic
979774594 4:124573357-124573379 GAGGGCAGAAAGAAGGGACGTGG + Intergenic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982149272 4:152434653-152434675 AAGGATATACAGAAGGGAGAGGG + Intronic
982519960 4:156403594-156403616 AATAGCACAAAGAAGGGATAGGG + Intergenic
982521463 4:156421860-156421882 AAGGGAACAATGAAGGCACAGGG - Intergenic
983583425 4:169331339-169331361 AAGGAAAAACAGAAGGGATAAGG - Intergenic
984702312 4:182826131-182826153 CAGGGCTCACAGAAGGGCCCTGG - Intergenic
985107317 4:186511623-186511645 CAGGGCACACTGAAGGGCAACGG - Intronic
985180571 4:187257032-187257054 AAGGTCACACAGAAGGGCGGCGG + Intergenic
985388376 4:189468491-189468513 AAAGGCACGAAGAAGGGAGAAGG - Intergenic
985532437 5:442181-442203 AGGGGCACACAGGAAGGAGATGG - Exonic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
986577670 5:9229424-9229446 AAGAGAACACAGGAGGGCCAGGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
990499549 5:56381932-56381954 AAGTGCAAACAAAAGGGAAAAGG + Intergenic
990740243 5:58905120-58905142 AATGGTACACAGGAGGGAGAAGG - Intergenic
992357860 5:76004030-76004052 AATGGAGCACAGGAGGGACAAGG + Intergenic
992845545 5:80743326-80743348 GAGAGCACAGAGAAGGTACAAGG - Intronic
993486597 5:88494987-88495009 AAGAACACAGAGAAAGGACATGG + Intergenic
994132900 5:96250877-96250899 AAAGGTACAGAGAAGGTACAGGG + Intergenic
994252672 5:97555351-97555373 AAGGTCACACAGGAGGGAAGTGG + Intergenic
994633412 5:102314004-102314026 AAGGGAACTCAGAGGGGAGAGGG + Intergenic
995424578 5:112005883-112005905 AAAGGCACTCAGAAGAGAAATGG + Intergenic
995576355 5:113539746-113539768 AAGGGCATACAGAATAAACAAGG - Intronic
995734873 5:115289162-115289184 AAGTGCAAACCGAAGGGAAAAGG - Intronic
995907970 5:117149401-117149423 AAGGAGGCACAGAAAGGACAAGG - Intergenic
996430577 5:123371644-123371666 AAGGGCTCTCTGATGGGACATGG + Intronic
997349101 5:133217450-133217472 AAAGGCACAGAGGAGGGTCAGGG - Intronic
997382613 5:133448521-133448543 GAGGGCACACAGAAGTTAAAGGG + Intronic
997600657 5:135136175-135136197 AAGGGGAGCCAGAAGGGACTTGG + Intronic
997786415 5:136717931-136717953 TAGGGCCCAAAGAAGGAACAGGG + Intergenic
997865650 5:137460427-137460449 TAGGGAACACAGAAGAGCCAAGG + Intronic
997932643 5:138084765-138084787 AAGGCCACACAGCAAGGAAATGG - Intronic
998061401 5:139121453-139121475 AAGGGAACACATTAGGGACAGGG + Intronic
998177551 5:139911219-139911241 AAGGGCACACAGCAGGCCCCGGG - Intronic
998272419 5:140718758-140718780 AGGGACACACAGCAGTGACAAGG - Intergenic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1001251067 5:170147336-170147358 AAGGGGACACAGAGGGGAGCCGG - Intergenic
1001668586 5:173454521-173454543 AAGGTCACACGCAAGGGAAACGG - Intergenic
1002039892 5:176505257-176505279 GAGGCCACAGAGCAGGGACAGGG + Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002616191 5:180458013-180458035 TAGGACACACAGGAAGGACAGGG + Intergenic
1002836635 6:870097-870119 GAGGGCACACCCCAGGGACAAGG - Intergenic
1002968954 6:1994763-1994785 AAGGGCACACAGGGGATACATGG + Intronic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004088365 6:12473904-12473926 AACAGGACACAGTAGGGACAGGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004469971 6:15920430-15920452 GAGACCACACAGAAGGGAAAGGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005369087 6:25111527-25111549 AAGGTCAGACAGAAGGGTCGGGG + Intergenic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006440907 6:34053208-34053230 AAGGTCACACAGCAGGGAGGAGG + Intronic
1006914310 6:37584824-37584846 AGGAGCACAGAGAAGGGAGAAGG - Intergenic
1007263186 6:40577990-40578012 CAGGGGGCACAGAAGGGACGGGG - Intronic
1007724719 6:43908256-43908278 AAGGCCACACAGCAGAGCCAGGG - Intergenic
1007914413 6:45547561-45547583 AAAGGAACAAAGAAGGGAAAAGG + Exonic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008085484 6:47239774-47239796 AAAGGAACACAGAAGTGACCTGG - Intronic
1008132673 6:47736807-47736829 AAGGGCACACAGCAGGGAAATGG - Intergenic
1008447386 6:51609196-51609218 AAGGGGAAAGAGAAGGGACTGGG - Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010897239 6:81379397-81379419 AAGGGCACAGAGGAAGGACATGG + Intergenic
1011181153 6:84622404-84622426 AAGGGCACAGAGCAGGGATGGGG - Intergenic
1012623888 6:101382890-101382912 AATTGCACTCAGAAGGGCCAAGG - Intergenic
1013547690 6:111175166-111175188 AAGGATTCAGAGAAGGGACATGG - Intronic
1014689961 6:124551206-124551228 AAGGGAACACACAGGGGAAATGG + Intronic
1015435892 6:133187782-133187804 AAGGGCACTCATGAGGAACAGGG - Intergenic
1015706597 6:136094511-136094533 AAGGCCACACTGAGGTGACATGG - Intronic
1015866765 6:137734997-137735019 AACGGGAGACAGAAAGGACAGGG + Intergenic
1015920998 6:138266349-138266371 AAGGGAAAACGGAAGGGAAAAGG + Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1017273119 6:152532670-152532692 AAGGGTGCACAGAATGCACATGG - Intronic
1017996594 6:159536902-159536924 AAGGGCAAACAGAGAGGAGAAGG + Intergenic
1018068178 6:160138163-160138185 AAGGTCACACAGCCAGGACATGG - Intronic
1018973792 6:168548200-168548222 AAGGGCATTCAGAAGGTCCAGGG - Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1019877697 7:3829346-3829368 AAGGGCATACAGAGAGGAGAAGG + Intronic
1019960184 7:4452476-4452498 AAGGGAACTCAGAATTGACAGGG - Intergenic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020350134 7:7210461-7210483 TAGGCCAGACAGAAGGGAGAAGG + Intronic
1021814250 7:24432119-24432141 AAGGGCACCGAGAAGGGAAGGGG + Intergenic
1022287922 7:28973333-28973355 GAGGGAGCACAGAAGGGACAAGG - Intergenic
1022528643 7:31053477-31053499 TAGGGGGCTCAGAAGGGACAGGG + Intronic
1022628227 7:32060296-32060318 AAGGGCACAGAGTGGGGAGAGGG - Intronic
1023888508 7:44376910-44376932 AGGGACACTCAGATGGGACAGGG - Intergenic
1024156865 7:46634790-46634812 AAGTGCAAACAAAAGGGAAACGG + Intergenic
1026450716 7:70526778-70526800 AAAGGCACACATAAGGCAGATGG - Intronic
1031830735 7:126622237-126622259 AAGACCAGACAGCAGGGACAAGG - Intronic
1032216806 7:129963794-129963816 AAGGTCACACAGACGGTAAATGG + Intergenic
1032942158 7:136806824-136806846 AAGGGCTCAAAGATGGGAAAAGG - Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1034225433 7:149477505-149477527 CAGGGATCACAGGAGGGACAGGG - Intronic
1035312074 7:157975792-157975814 CAGGGCACACAGTAGGTACCTGG - Intronic
1035352949 7:158259262-158259284 CAGGCCACAGAGAAGGGCCATGG + Intronic
1035576002 8:705713-705735 AAGGGCATCCAGACTGGACAGGG + Intronic
1036157609 8:6357147-6357169 AATGGCATGTAGAAGGGACAGGG - Intergenic
1036477084 8:9103161-9103183 AAGGGCTCACAGGATGGAAATGG - Intronic
1036631193 8:10516826-10516848 AAGGTCACATAGCAGGTACATGG + Intergenic
1036949662 8:13129036-13129058 AAGGTCCCACAGAAGGAAAAGGG + Intronic
1037816332 8:22114668-22114690 AAGGGCAGACAGGCGGGGCAAGG + Exonic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1038753406 8:30317520-30317542 AAGGGCACACAGCAAGGAGGTGG + Intergenic
1038992066 8:32878779-32878801 GAGGGCACCCAGAGGGGAGATGG - Intergenic
1040356512 8:46623808-46623830 AGAGACACACAGAAGGGAAACGG + Intergenic
1040539815 8:48342430-48342452 ATGAGCAGAGAGAAGGGACAGGG + Intergenic
1043099800 8:76028950-76028972 AAGTTCACAAAGAAGGGAAATGG - Intergenic
1043379796 8:79690340-79690362 AAGGACACATAGAAGGCATAAGG - Intergenic
1044014380 8:87032602-87032624 AAGGGGAGGCAGAAGAGACAGGG + Intronic
1044064636 8:87684482-87684504 AAGGACACACATGAGGGGCATGG + Intergenic
1045331099 8:101156327-101156349 AAGGTCACACAGAAGGCACATGG - Intergenic
1047177604 8:122556231-122556253 AAGGTCACACAGAAGGGAAGTGG - Intergenic
1047761946 8:127961035-127961057 ATAGGCACACAGAAGGGCCCAGG + Intergenic
1048203177 8:132393965-132393987 AAGGGCACACAGTAGGTAGCTGG - Intronic
1048338247 8:133519044-133519066 AAGGGTAAGCAGAAGAGACATGG + Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048780148 8:137990929-137990951 ATGGGCACACGGCAGGGGCAAGG + Intergenic
1048789567 8:138086991-138087013 AACGGCACACCCAAGGGAGAGGG - Intergenic
1049231181 8:141483015-141483037 AAGGGCACACAGGTGAAACAAGG - Intergenic
1050165017 9:2756401-2756423 AAGGGAAAAAAGAGGGGACAGGG + Intronic
1050456110 9:5836112-5836134 ATGGCAAGACAGAAGGGACATGG - Intergenic
1050480680 9:6084288-6084310 AAGAGAACACAGAAGGGAAATGG + Intergenic
1051086194 9:13351397-13351419 AAGGTCAGAGAGAAGGGACTTGG + Intergenic
1052997603 9:34559551-34559573 AAAGGCACACAGGATGAACATGG - Intronic
1053002705 9:34586059-34586081 GAGCCCACACAGTAGGGACATGG - Intronic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1054850531 9:69842679-69842701 AAGGCCACACAGCTGGGACCTGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056337115 9:85582999-85583021 AAGGGCTCTCATAAGGGAAAGGG + Intronic
1056685988 9:88759776-88759798 AAGAGCACACAGTAGGGCCATGG - Intergenic
1057800685 9:98189668-98189690 AAGGTCACACAGTAGGGAAGAGG + Intronic
1058066374 9:100553062-100553084 AAGAGTACACAGAAGCTACAAGG + Intronic
1058504183 9:105652286-105652308 AAGGACTCAGAGAAAGGACAAGG - Intergenic
1058894667 9:109388805-109388827 AAGGGCAGACAGACAAGACAGGG + Intronic
1059006231 9:110406241-110406263 AAGGGCTCACAGACTGGATAAGG + Exonic
1059458120 9:114412516-114412538 AAGGTCACACAGCAAGGACAGGG + Intronic
1059466719 9:114473401-114473423 CAGGGGACACTGAAGGGACCAGG + Intronic
1060275763 9:122181243-122181265 AGGGTCACACAGAAGGGAGTGGG - Intronic
1060432413 9:123561774-123561796 GATGGCACACAGAGGGGAAAGGG - Intronic
1060777740 9:126388748-126388770 AAGGGCAAACAGAAAGCACAAGG - Intronic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061414388 9:130438463-130438485 AAGGTCACACAGAAAGCCCAAGG + Intergenic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061644868 9:131992995-131993017 AAAGGCACACATATGGGGCATGG + Intronic
1061827978 9:133273871-133273893 AAGACCACAAAGGAGGGACAGGG + Intronic
1062059502 9:134487379-134487401 TAGGGCACATAGCAGGGAGAAGG - Intergenic
1062298413 9:135847973-135847995 AAGGGAAGCCAGAAAGGACAGGG + Intronic
1062562861 9:137149504-137149526 AAAGGCCCACAGCAGGGAGAGGG + Intronic
1062683732 9:137799219-137799241 AAGGGGACAGGGAGGGGACAAGG - Intronic
1203740875 Un_GL000216v2:175862-175884 AAGGGCACAGAGAGGCGAGAGGG - Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1187831707 X:23389069-23389091 AATGGGACAGAGAATGGACATGG - Intronic
1190735510 X:53253375-53253397 AAGGCCACACAGTTGGGAAATGG + Intronic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1195110106 X:101639786-101639808 AAGGGCAGAGAGCAGGGAGATGG + Intergenic
1195152092 X:102082398-102082420 AGGGGCACAAAGAAGCCACATGG - Intergenic
1195988927 X:110663484-110663506 AAAGTCACACAGCAAGGACAGGG + Intergenic
1196424934 X:115560987-115561009 ATGGGCACCCAGGAGGGATAGGG - Intergenic
1197777096 X:130125581-130125603 AAGGACGTACAGAAGGGATATGG + Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198008307 X:132522409-132522431 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1198301553 X:135338829-135338851 AAGGGCACATGAGAGGGACAGGG - Intronic
1199215874 X:145259865-145259887 AAGGGGACAGAGAAAGAACATGG - Intergenic
1200285364 X:154817234-154817256 AAGTGCAAACAAAAGGGAAAAGG - Intronic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202601898 Y:26602025-26602047 AAGGGCTGACAGAAGGCACCTGG + Intergenic