ID: 932842607

View in Genome Browser
Species Human (GRCh38)
Location 2:75097625-75097647
Sequence CCTTCCTATTCTCAGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932842602_932842607 -9 Left 932842602 2:75097611-75097633 CCAGTCTCAGGCACCCTTCCTAT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 932842607 2:75097625-75097647 CCTTCCTATTCTCAGTCTTGGGG 0: 1
1: 1
2: 3
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932842607 Original CRISPR CCTTCCTATTCTCAGTCTTG GGG Intronic
903008101 1:20311669-20311691 CCTTCCTATCCGCAGTGATGGGG + Intronic
904298806 1:29541075-29541097 CTTTACGATTCTCAGTCGTGTGG + Intergenic
904343134 1:29851008-29851030 CCTTCCTATTCTCTAATTTGGGG + Intergenic
904480402 1:30789678-30789700 CCACCCTCTTCTCAGTCCTGGGG - Intergenic
905907588 1:41629217-41629239 CCATCCTATTCACAGTCCTGGGG - Intronic
910317154 1:85899240-85899262 CATTCCTTTTCACAGTCTTTTGG - Intronic
911197925 1:95014480-95014502 CCTTCTTAGCCTCAGACTTGGGG + Intronic
912385783 1:109270606-109270628 CCCACCCATTCCCAGTCTTGGGG + Intronic
912404656 1:109426681-109426703 CTTTCCAATTGCCAGTCTTGGGG - Intergenic
912802620 1:112730000-112730022 CCTTCCTGGACACAGTCTTGAGG - Intergenic
913382789 1:118229115-118229137 CCTTCCAATGCTCAGACTTCAGG - Intergenic
914434227 1:147646097-147646119 CCTTCCCATCCTCAGTCTGCTGG - Exonic
914869446 1:151460429-151460451 ACTGCCTATTTTCAGTCTGGTGG - Intergenic
915281892 1:154828465-154828487 GCTTCCTATTTTTAGTCATGGGG + Intronic
915455116 1:156035437-156035459 CCGTCATATTCTCAGCCATGGGG + Exonic
915560188 1:156682517-156682539 CCTTCCCATTCTCTGTCCTGGGG + Intergenic
915873416 1:159586638-159586660 CCTTCCTATTCTCATCCCTGGGG - Intergenic
917888498 1:179412847-179412869 TATTCCTGTTCTCAGTCTTATGG + Intronic
918008088 1:180560996-180561018 CCTTTCTATTTTCAGTCCTACGG + Intergenic
919481660 1:198097591-198097613 CCTTCCACTTCTCAATGTTGTGG - Intergenic
920837647 1:209526471-209526493 CCTTCCTTTGCTGTGTCTTGGGG - Intergenic
921094806 1:211877203-211877225 TCCTCTTATTCTCAGTTTTGTGG - Intergenic
921124811 1:212167941-212167963 ACTTCCTATTCACAGTTTTTGGG - Intergenic
922363138 1:224841126-224841148 CCTTACCATCCTCAGTCTTCAGG - Intergenic
1063336334 10:5218703-5218725 CCTTTCTCTTTTCAGTCTTATGG + Exonic
1064767048 10:18685630-18685652 CCTTTTTATTCTCAGTTTTATGG - Intergenic
1066323154 10:34325744-34325766 TCTTCTAATTCTCAGTCCTGTGG - Intronic
1069917678 10:71797465-71797487 CCTTCCTACTCTCAGCCTGGGGG - Intronic
1070658351 10:78286494-78286516 CTCTCCTCTTCTCAGTCTTTGGG - Intergenic
1072225660 10:93366419-93366441 CCTTCCCATTCCCAGCCTTTTGG + Exonic
1075442342 10:122489926-122489948 CCTTCCCATTCCCAATCCTGTGG + Intronic
1078301711 11:10137461-10137483 CTTTCTTATTCTCAATCTTAGGG + Intronic
1079063572 11:17270828-17270850 CCTTCCCATGCACACTCTTGAGG + Intronic
1080555697 11:33415352-33415374 CCATCCCATTGTCAGTCTTAGGG + Intergenic
1081335073 11:41855421-41855443 CCTTCCTTTTGTAAGCCTTGAGG + Intergenic
1081907790 11:46680337-46680359 CCTGCCCCTTCTCTGTCTTGGGG + Intronic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1085136337 11:74092437-74092459 CTTTCCTGTTCTCAATCCTGGGG + Exonic
1085719602 11:78901540-78901562 ACTTCCTATTCTGAGTCTCCAGG - Intronic
1085970804 11:81588258-81588280 CCCTTCCATTCTCAGTCATGTGG + Intergenic
1086589223 11:88492606-88492628 CCTTCCCATTCTTAGTCCTCTGG + Intergenic
1086818894 11:91410352-91410374 CTTGCCTTTTCTCAGTCTTAAGG - Intergenic
1087672663 11:101127241-101127263 CCCTCCTCTCCTCACTCTTGGGG - Intronic
1088055460 11:105571153-105571175 CCTTCCGATTATGAGTCTTAAGG - Intergenic
1088068999 11:105757730-105757752 CCTTCCCATTGTCAGTATTCAGG + Intronic
1088596588 11:111445520-111445542 CTTTCCTAGGCTCAGTCCTGTGG - Intronic
1089831908 11:121336339-121336361 GCTGACTATTCTCAGGCTTGTGG + Intergenic
1093345431 12:18034848-18034870 CCTTCCAATTCCCAGACTTCAGG - Intergenic
1096215364 12:49795321-49795343 CCTTCCCTTTGTCAGGCTTGGGG + Exonic
1097309349 12:58101712-58101734 CATTCCTCTTCACACTCTTGGGG - Intergenic
1098930582 12:76407880-76407902 ACTTACTATTTTGAGTCTTGGGG + Intronic
1099705403 12:86146462-86146484 ACTTCCAATTCTCAGTCCAGGGG - Intronic
1099840869 12:87964831-87964853 CCATCATATTCACAGTCCTGGGG + Intergenic
1100371694 12:93974643-93974665 CCTTCCCATGCTCCTTCTTGGGG + Intergenic
1101000688 12:100354690-100354712 CCTTCCTGTTCTCAGTCTTGAGG + Intergenic
1101305077 12:103520107-103520129 ACCACCTATTCTGAGTCTTGTGG - Intergenic
1107297513 13:38926545-38926567 CTTTCTTATTCTCAAACTTGTGG - Intergenic
1107803825 13:44135367-44135389 CCTTCCTGTTCTTTGGCTTGAGG - Intergenic
1108093756 13:46879160-46879182 CCTGCCTATGCTCTGTATTGGGG + Intronic
1108525611 13:51283549-51283571 CCTTCCTGTTCTGAGCCCTGTGG - Intronic
1109343954 13:61093215-61093237 CCTTACAGTTCTCAGTCTTCAGG + Intergenic
1110685106 13:78363275-78363297 CCATCATATTCACGGTCTTGGGG - Intergenic
1111977090 13:94977750-94977772 CCTTCCTAAAATCAATCTTGGGG + Intergenic
1112375411 13:98835660-98835682 CCTTCCCATTCTGAGACTGGAGG + Intronic
1115317858 14:32045232-32045254 CCTTTCTATTCTGAATTTTGGGG - Intergenic
1115897482 14:38105927-38105949 CCTTCCTCTGCTCAGACTTCAGG - Intergenic
1117957550 14:61134442-61134464 CCTTACAGTTCTCAGTCTTCAGG - Intergenic
1118255975 14:64206093-64206115 CCTTTTTATTCTCATTCTTCTGG + Intronic
1118381928 14:65224628-65224650 CCTTCCTATTCTCAGTCCCAGGG - Intergenic
1120706441 14:87750840-87750862 CTTACCTGTCCTCAGTCTTGGGG - Intergenic
1123206272 14:106716247-106716269 CCTTCATATTCTCACTATTCAGG + Intergenic
1123206285 14:106716349-106716371 CCTTCATATTCTCACTATTCAGG + Intergenic
1123211353 14:106763656-106763678 CCTTCATATTCTCACTATTCAGG + Intergenic
1123211366 14:106763758-106763780 CCTTCATATTCTCACTATTCAGG + Intergenic
1124126152 15:26939510-26939532 CCTTCCTGTTTCCAGTCTAGAGG - Intronic
1125714107 15:41809582-41809604 CTTTCCTATTCGCAGTCTCCAGG + Intronic
1126101787 15:45122296-45122318 CCTTCCTGTTTCCAGACTTGGGG + Intronic
1127016636 15:54696039-54696061 CTTACCTTTTCTCAGGCTTGTGG + Intergenic
1127218499 15:56850711-56850733 CCTTCCTATTTTTAGTTTTCTGG - Intronic
1132335032 15:101042779-101042801 CCTTCAAATTCTCACTTTTGAGG + Intronic
1133357224 16:5145439-5145461 CCATCGTATTCTCAGCCTTCAGG + Intergenic
1134308674 16:13056700-13056722 CCTTCCGCTTCACAGTGTTGTGG + Intronic
1137291707 16:47055914-47055936 CCATCCTATCCTCAGCCTAGAGG + Intergenic
1138131306 16:54482389-54482411 CCTTCCAATTCTGTCTCTTGAGG - Intergenic
1138501576 16:57448245-57448267 CCTTCCTTTTCAAAGTTTTGCGG + Intronic
1139408326 16:66737617-66737639 CCTTATTATCCTCACTCTTGTGG + Intronic
1139693468 16:68656322-68656344 CCTCCCGATTCTCAGACTGGAGG + Intronic
1139752711 16:69119302-69119324 TCTGCCTTTTCTCAGTCTTCTGG - Exonic
1139823283 16:69737660-69737682 CCTTCCTTTTCTCTGTGCTGCGG + Intergenic
1141402896 16:83766202-83766224 CCTTCCTAATCTAACCCTTGGGG - Intronic
1145724556 17:27106581-27106603 CCTTCCTATTGTCAATGGTGAGG - Intergenic
1146637396 17:34516685-34516707 CCTTCTTATTCCCTGTCTTTGGG - Intergenic
1146976390 17:37116520-37116542 CTTTCCTACTCACAGTCTTGGGG - Intronic
1146998317 17:37340716-37340738 CCTTCCTCTTCTCAGTTGTAGGG - Intronic
1147420561 17:40320304-40320326 CCTTCCTACTCCCAACCTTGAGG + Intronic
1149334852 17:55625161-55625183 CCATCCTGTTTTCAGTCTTATGG + Intergenic
1150764478 17:67992833-67992855 CCTTGCTGTTCTCACCCTTGAGG + Intronic
1151140574 17:71987861-71987883 GCATCCTGTTCTCAGACTTGGGG + Intergenic
1152317037 17:79587184-79587206 CCTTCCTATTCTCAGGGTTGCGG - Intergenic
1155228340 18:23749888-23749910 CCTTCCTCTCCTCACTCTTACGG - Intronic
1157106398 18:44778268-44778290 CCCTCTTATTCTCAGCCTAGGGG + Intronic
1159598532 18:70406558-70406580 CCTTCATATGCTCAGCCTGGAGG + Intergenic
1159852005 18:73535459-73535481 CCGTCCTATTCTCAGTGGTGTGG + Intergenic
1161170328 19:2809414-2809436 GCGTCCTTTTCTCAGTCTAGTGG - Intronic
1162368102 19:10261724-10261746 TCTTCCTCTTGCCAGTCTTGTGG + Intergenic
1165446646 19:35860431-35860453 CCTTCCCAAGCTCACTCTTGGGG - Intronic
1166754461 19:45181738-45181760 CCTCCCCATTCTCCATCTTGGGG - Exonic
1168480047 19:56712293-56712315 ACTTCTTATGCTCTGTCTTGTGG + Intergenic
928164809 2:28962848-28962870 CCTTCCTTTTCTCTGTCTCCAGG + Intronic
930364101 2:50417218-50417240 TCTTCCTTTTCTCAATCTTGTGG - Intronic
932789468 2:74641318-74641340 ACTTCCTAATCTGAGTCCTGGGG - Intronic
932842607 2:75097625-75097647 CCTTCCTATTCTCAGTCTTGGGG + Intronic
933019236 2:77170198-77170220 CCTTCCTCTTCCCACTCTTAAGG - Intronic
936440548 2:112548275-112548297 TCTTCCGCTTATCAGTCTTGTGG + Intronic
936815747 2:116458240-116458262 CAATCTAATTCTCAGTCTTGTGG + Intergenic
937052505 2:118903949-118903971 CCTTCCTCTTCTAACTCTTGAGG - Intergenic
940056670 2:149520382-149520404 ACTTCCTAGTCTCATTCTTGAGG - Intergenic
940336738 2:152536788-152536810 CCTTCATATTCTGAGGCTTAAGG - Intronic
942812438 2:180014676-180014698 CCTTCCGATGTTCAGACTTGTGG - Intergenic
945273053 2:207961050-207961072 CCAGCCTTTTCACAGTCTTGTGG - Intronic
947320782 2:228915951-228915973 CCTTGGTATGCTCAGTCTAGAGG + Intronic
947456275 2:230256933-230256955 CCTTCCCTATCTAAGTCTTGAGG - Intronic
1168744306 20:224079-224101 CCTTGCTATTCACAGTGTGGTGG - Intergenic
1170165353 20:13356370-13356392 CCTTTCTATACTCAGTTTTAGGG + Intergenic
1173675490 20:44831349-44831371 CCTTCCGATACTCATTGTTGAGG + Intergenic
1176712019 21:10158591-10158613 CCTTCCCAATCTCAGCCTTTCGG - Intergenic
1177246828 21:18536552-18536574 CCTTCTTACTCTCAGTCTATAGG + Intergenic
1180705203 22:17805245-17805267 CGTTCCTCTTCTTAGTCTTGTGG - Intronic
1180728569 22:17964087-17964109 GCTTCCTAATCTCAGTCTCCAGG + Intronic
1181111357 22:20604834-20604856 CCTGCCTCTGCTCAGCCTTGTGG + Intergenic
1184848419 22:47103196-47103218 CATTCCTACTCTTAGTCTTGGGG + Intronic
1185093857 22:48795068-48795090 CTTCCCTATGCCCAGTCTTGGGG + Intronic
950579697 3:13854131-13854153 CCTCCCTCTTCTCAGGCTTCTGG - Intronic
951266996 3:20578943-20578965 TCTTCCTTTTCTCTTTCTTGAGG - Intergenic
951538660 3:23762125-23762147 CCTACCCAATCTCAGTCCTGTGG + Intergenic
952853280 3:37746717-37746739 CCTTCCTTTTCTATGTCTTCAGG + Intronic
953349875 3:42207412-42207434 CCTTCTTGTTCTCAGACCTGTGG + Intronic
957776080 3:84758751-84758773 GCCTCCTATTCTCCATCTTGGGG - Intergenic
959912750 3:111782262-111782284 ACTTCCTATTCTCAGTCCAATGG + Intronic
961162001 3:124735400-124735422 CCTTCCTTTTTTTAGACTTGGGG + Intronic
962444767 3:135454602-135454624 CCCTCCTATTCCCAGCCATGTGG - Intergenic
963572271 3:147013349-147013371 CCATCACATTCACAGTCTTGGGG + Intergenic
963732027 3:148984320-148984342 CCGTCATATTCTCAGCCATGGGG + Intergenic
965917314 3:173865950-173865972 CCTTCCACTTCTCAGTCTCCAGG - Intronic
967115050 3:186329645-186329667 TCTTTCTCTTCTCAGACTTGTGG + Intronic
969003459 4:4001281-4001303 CCTTACAGTTCTCAGTCTTCAGG - Intergenic
969180673 4:5438192-5438214 TGTTCCTCTTCTCAGTCCTGAGG - Intronic
969653696 4:8483644-8483666 CCTTACAGTTCTCAGTCTTCAGG - Intronic
969903306 4:10370134-10370156 CTTTACTACTCTAAGTCTTGTGG + Intergenic
970087905 4:12368456-12368478 CCTTACAGTTCTCAGTCTTCAGG + Intergenic
970180226 4:13384116-13384138 CCTTCCTAGTTTCACTCTTGCGG - Intronic
974630650 4:64483299-64483321 CCTTCCTTTTCTCCGACTTCTGG - Intergenic
974670899 4:65028572-65028594 CCTTCCTATGCTAAATCTTCAGG - Intergenic
974904232 4:68036004-68036026 CCTTACCGTTCTCAATCTTGAGG + Intergenic
974909369 4:68097873-68097895 CCTTCCTACCCTCATTATTGGGG - Intronic
977166600 4:93706883-93706905 TCTTTCTATACTCAGTTTTGTGG + Intronic
980255774 4:130379379-130379401 CCTTGCTATACTCAGAGTTGAGG - Intergenic
983189021 4:164734796-164734818 CCATCCTATTCTCAGTCCCAGGG + Intergenic
983501994 4:168510102-168510124 CACTCCTAGACTCAGTCTTGTGG + Intronic
985835008 5:2264032-2264054 CCTGGCTGTTCTCAGTCTTCTGG + Intergenic
986300502 5:6474924-6474946 GCTTCCGTTTCTCCGTCTTGAGG + Intronic
988452147 5:31354049-31354071 CTTTCCTATTCTCAGGCACGTGG + Intergenic
988573410 5:32395032-32395054 ACTTCCAATTTTCACTCTTGAGG - Intronic
989496339 5:42114427-42114449 CCTTCCAATTCCCAGACTTCAGG - Intergenic
992847701 5:80769608-80769630 CAGTCCTATTCTGGGTCTTGAGG + Intronic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
999234478 5:150082202-150082224 CCTTCCTCTTCCCAGTGATGGGG + Intronic
1003592856 6:7450219-7450241 CCATCCTGTCCGCAGTCTTGGGG - Intergenic
1005712527 6:28515656-28515678 CCTTCCTATTTTGAGGCTTTAGG + Exonic
1009465964 6:63969892-63969914 CATTCATTTTCTCAGTCATGAGG + Intronic
1009942640 6:70306591-70306613 CCTTCTTATTCTCTGAATTGTGG - Intergenic
1010897026 6:81377489-81377511 CCTTCATATTCTCACTATTAAGG + Intergenic
1011514974 6:88144296-88144318 CCTTCCCATCCTCAGACGTGTGG + Exonic
1014161898 6:118179299-118179321 TCTTCCTGTTCTCAGGCTTCTGG - Intronic
1015064817 6:129011625-129011647 CATTTCTTTGCTCAGTCTTGAGG - Intronic
1015854986 6:137614390-137614412 TCTTCCTATTCTCCTTCCTGAGG - Intergenic
1019018788 6:168900568-168900590 CCCTCCTCTTCTCACCCTTGCGG - Intergenic
1020042556 7:5015248-5015270 CCTTCCACTCCTCATTCTTGAGG + Intronic
1020289289 7:6710505-6710527 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1021620475 7:22546001-22546023 ATTTCTTATTCTCAGTCCTGTGG - Intronic
1022447819 7:30484254-30484276 CCTTACCATTCTCAATCTTCAGG + Intergenic
1023021601 7:36016439-36016461 CCTTGCTATGCTCACTCTTATGG + Intergenic
1023037200 7:36142366-36142388 CCTTTCTATGCTCAGTTTTCTGG + Intergenic
1026090218 7:67293410-67293432 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1026746224 7:73015451-73015473 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026749875 7:73043594-73043616 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026753523 7:73071704-73071726 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1026757174 7:73099740-73099762 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027032327 7:74900009-74900031 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027090230 7:75293746-75293768 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027093875 7:75321674-75321696 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027097518 7:75349641-75349663 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027119812 7:75508725-75508747 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1027272016 7:76526882-76526904 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027321829 7:77018031-77018053 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027325463 7:77045951-77045973 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1027791269 7:82640655-82640677 CCTTCCAATGCTCAGACTTCAGG - Intergenic
1028722736 7:94051834-94051856 CCATCCTCTTCTCAGTCTGAAGG - Intergenic
1029317670 7:99729137-99729159 CCTCCCTATTCTTAGTCCTCTGG + Intronic
1029398622 7:100326631-100326653 CCTTCCACTCCTCATTCTTGAGG - Intergenic
1029717687 7:102341298-102341320 CCTTCCACTCCTCATTCTTGAGG + Intergenic
1029846261 7:103415058-103415080 CCTTTTTATTCTCAGCTTTGGGG + Intronic
1030643286 7:112030234-112030256 CAGCCCTTTTCTCAGTCTTGAGG - Intronic
1033532058 7:142274186-142274208 CCTTCATATTCTCATTGGTGAGG - Intergenic
1035584578 8:761889-761911 CGTTCACTTTCTCAGTCTTGAGG - Intergenic
1035905383 8:3503918-3503940 CCTCCATATTCTCACTCATGTGG - Intronic
1041585868 8:59518207-59518229 CCTTTTTATTTTCAGTCTTTTGG - Intergenic
1043476919 8:80614239-80614261 CTTTCCAATTCTCATTTTTGTGG - Intergenic
1043599300 8:81918695-81918717 CCTTACTGTCCTCAGTCTTCAGG + Intergenic
1043615622 8:82121317-82121339 TCATCATATTCACAGTCTTGGGG + Intergenic
1043717509 8:83505895-83505917 CCTTACAATCCTCAGTCTTCAGG - Intergenic
1044488858 8:92788393-92788415 ACTTTCTTTTCTCAGTCTTCAGG + Intergenic
1044622579 8:94204776-94204798 CCTTCCCTTGCTCTGTCTTGGGG - Intronic
1044948250 8:97411419-97411441 CTTTTCTATTTTCAGTCATGTGG + Intergenic
1045223446 8:100221376-100221398 CCTTCCCATTCTCACGCTGGGGG - Intronic
1046031519 8:108787840-108787862 CTTTCCTTTTCACAGTCTTGTGG - Intergenic
1047332833 8:123907588-123907610 CCTTCCTATGCTCAGTATCGAGG + Intronic
1047332864 8:123907776-123907798 CCTTCCTATGCTCAGTATTGAGG - Intronic
1048788781 8:138080989-138081011 CCTTCCTATTAACACTCTTAAGG + Intergenic
1049610439 8:143552683-143552705 CCTGCCTCTCCTCACTCTTGGGG + Intergenic
1049711718 8:144067231-144067253 CCATCTTATTCACAGTCCTGGGG - Intergenic
1049819020 8:144622916-144622938 CCCTCCCAGTCTCAGCCTTGGGG - Intergenic
1050466793 9:5935009-5935031 CCTGCATATTCACAGTTTTGGGG + Intronic
1051112968 9:13661068-13661090 TCTTCCTACTCTTAGTGTTGGGG + Intergenic
1051956822 9:22705518-22705540 GCTTCCTATTTTCAGTCTGAAGG - Intergenic
1053363210 9:37504221-37504243 CCTTCCGATTCCCAGTCCTCTGG - Intergenic
1055784344 9:79856416-79856438 CTGTCTTATTCTCAGTCTTAAGG + Intergenic
1058910889 9:109518886-109518908 TTTTCTTATTCTCAGTCTTCTGG - Intergenic
1060583883 9:124773924-124773946 CCTTGTTTTTCTCAGTCTTGTGG - Intergenic
1061814758 9:133188065-133188087 CCTTCAAATTCTCAGTCTCAGGG - Intergenic
1202796773 9_KI270719v1_random:127581-127603 CCTTCCCAATCTCAGCCTTTCGG - Intergenic
1203369719 Un_KI270442v1:291349-291371 CCCTCATATTCTCCATCTTGAGG + Intergenic
1188152063 X:26689087-26689109 TCTTACTTTTCACAGTCTTGTGG + Intergenic
1188677920 X:32965586-32965608 ACTTCCTATTCTCTGTTTTGAGG - Intronic
1190193044 X:48293569-48293591 CCTTCCTTGTATCTGTCTTGTGG + Intergenic
1190659551 X:52642182-52642204 CCTTCCTTGTATCTGTCTTGTGG + Intergenic
1190677178 X:52792162-52792184 CCTTCCTTGTATCTGTCTTGTGG - Intergenic
1192300211 X:69893139-69893161 CCTTGCTATTCTTTGGCTTGTGG + Intronic
1192731099 X:73803433-73803455 CCTTACCATTCTCAATCTTCAGG - Intergenic
1192786572 X:74341997-74342019 CCTTATTATTCCCAGTCTTATGG + Intergenic
1193067680 X:77276454-77276476 CCTTGCTATTCTCAGACTAGGGG + Intergenic
1193891633 X:87052807-87052829 CCATACTGTTCTCATTCTTGTGG + Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1195016660 X:100787950-100787972 CCTTCCCATCCTCAATCTTCAGG - Intergenic
1195752319 X:108171324-108171346 CCTTCTAATCCTCAGTTTTGTGG + Intronic
1196173206 X:112612526-112612548 CCTTCCTGTTCTCAGTAGGGAGG - Intergenic
1197083257 X:122443349-122443371 CCTTCATATTTTCTGGCTTGAGG - Intergenic
1198540171 X:137629691-137629713 CTTTCATATTCCCAGTCTTAGGG + Intergenic
1199939786 X:152613691-152613713 CTTTCCTTTTCTCACTCTTCTGG - Intergenic
1201233848 Y:11891601-11891623 CCTTACCATCCTCAGTCTTCAGG - Intergenic
1201631388 Y:16074826-16074848 CCTTCCAATGCTCAGACTTCAGG - Intergenic