ID: 932843882

View in Genome Browser
Species Human (GRCh38)
Location 2:75114918-75114940
Sequence TTGTAAACACAGACAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932843878_932843882 27 Left 932843878 2:75114868-75114890 CCCATTTTCATGAATGTTATAAT 0: 1
1: 0
2: 3
3: 68
4: 594
Right 932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG 0: 1
1: 0
2: 1
3: 25
4: 374
932843879_932843882 26 Left 932843879 2:75114869-75114891 CCATTTTCATGAATGTTATAATG 0: 1
1: 0
2: 4
3: 36
4: 425
Right 932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG 0: 1
1: 0
2: 1
3: 25
4: 374
932843877_932843882 28 Left 932843877 2:75114867-75114889 CCCCATTTTCATGAATGTTATAA 0: 1
1: 0
2: 4
3: 41
4: 544
Right 932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG 0: 1
1: 0
2: 1
3: 25
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932843882 Original CRISPR TTGTAAACACAGACAGGGAA TGG Intronic
900113028 1:1016964-1016986 CTATAAATACAGACAGGGCACGG - Intergenic
901069926 1:6511972-6511994 CTGTAAGGACAGCCAGGGAAAGG - Intronic
901289836 1:8115509-8115531 TGGGAAACAGAGACAGTGAATGG + Intergenic
901583696 1:10268188-10268210 TCGTAAACACAGCGTGGGAACGG - Exonic
903594819 1:24485947-24485969 TTATAAACACTTACAAGGAAGGG - Intergenic
903911723 1:26731626-26731648 CTGTAGTCACACACAGGGAAGGG - Intronic
905590281 1:39157332-39157354 TTGTAAAAACAGAGAGAAAAGGG - Intronic
907146497 1:52238182-52238204 TTGTAATCGCAGACATGGAGGGG - Exonic
907776747 1:57523180-57523202 TTCTGATAACAGACAGGGAAGGG - Intronic
909230851 1:73087768-73087790 TGGTTATCAGAGACAGGGAAGGG - Intergenic
911788600 1:101982389-101982411 AGGTAAACACAGACAGAGATAGG + Intronic
911922297 1:103780730-103780752 ATGTAAACAAAAACAGTGAAAGG + Intergenic
912030298 1:105233074-105233096 TTGAAAACACATACAAAGAAAGG - Intergenic
912273605 1:108234062-108234084 TTGGAAGCACAGACAGGGGTGGG - Intronic
912294615 1:108460260-108460282 TTGGAAGCACAGACAGGGGTGGG + Intronic
913149799 1:116029758-116029780 TTGAAAACACAGAGAGGCTAAGG + Intronic
915182708 1:154076963-154076985 TCATAAAAACAGAAAGGGAAGGG + Intronic
917633721 1:176915684-176915706 ATGAAAACACAGGCAGGAAAGGG + Intronic
918108012 1:181429758-181429780 TTTTAAAAGCAGACTGGGAATGG - Intronic
919449315 1:197751818-197751840 TGGGAAACAGAGACAGGGGAGGG + Intronic
920108397 1:203570373-203570395 TTCAACACCCAGACAGGGAATGG + Intergenic
920642521 1:207766914-207766936 GTGTGAACAGAGACAAGGAATGG - Intronic
920786662 1:209049108-209049130 TTATAGACACACACAGAGAATGG + Intergenic
920850436 1:209624611-209624633 TTGGAAACACAGGCATGGAGGGG - Intronic
921441990 1:215198409-215198431 ATGTGAAGAAAGACAGGGAAAGG + Intronic
921811544 1:219520095-219520117 TGATAAACACAGAAAGGGAACGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923417878 1:233782227-233782249 ATCTAAACACAGACATGGTACGG + Intergenic
924672528 1:246144048-246144070 TTATAAGTACAGTCAGGGAATGG - Intronic
1064102026 10:12472227-12472249 ATGAAAACACAGACAGGCAAGGG - Intronic
1064805578 10:19126947-19126969 TTGAACACAGACACAGGGAAGGG - Intronic
1068260413 10:54573746-54573768 ATTTAAACACAGAGAGGGTAGGG - Intronic
1068296869 10:55081640-55081662 TTGTAAACTCACATAGCGAAAGG - Intronic
1068473720 10:57498140-57498162 TTGTCAATACATACAGGGCAAGG - Intergenic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1068923692 10:62512791-62512813 TTGGAACCATTGACAGGGAAAGG + Intronic
1069119294 10:64548837-64548859 TTGTAAACATACTCAGGGCAGGG + Intergenic
1069614147 10:69796057-69796079 TCATACACACACACAGGGAATGG + Intergenic
1070645035 10:78195863-78195885 TTGTAAACACACAAATGGGATGG - Intergenic
1071887465 10:89966627-89966649 TGGTATACCCAGAGAGGGAAAGG + Intergenic
1072453709 10:95559202-95559224 TTGTAAACAATGAAAGGGCAGGG - Intronic
1073053938 10:100687159-100687181 ATGGAAACAGAGACAGGGACGGG + Intergenic
1073724072 10:106209681-106209703 TTGAAAACACAGATATGGAAGGG - Intergenic
1073786973 10:106900281-106900303 TTGTTACCAGACACAGGGAAAGG - Intronic
1075056329 10:119221385-119221407 CTATAAACACAGATATGGAAAGG - Intronic
1075645813 10:124095303-124095325 GTTTAAACAAACACAGGGAAGGG + Intergenic
1076431851 10:130409574-130409596 TTGTAAAGACAAACAAGGCATGG + Intergenic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1078801697 11:14651270-14651292 TTGGAAACAAAGACAGGTACAGG - Intronic
1079295178 11:19226565-19226587 TTATAAAAACAGGCAGGGAGTGG - Intronic
1079640495 11:22799034-22799056 TTGTAAAAACACACAGTGAATGG + Intronic
1080077913 11:28173993-28174015 CTGTAAACACAGCCAGGTAATGG - Intronic
1080316203 11:30952010-30952032 ATATAAACACAGAAAGGAAAGGG + Intronic
1080995369 11:37593853-37593875 TTGTAGACACAAACATGGATTGG - Intergenic
1083058155 11:59842951-59842973 TTTTAAACCCAGAAAGGAAAAGG - Intronic
1083127634 11:60587560-60587582 TTGGAGACACTGAGAGGGAAAGG - Intergenic
1083722637 11:64611046-64611068 TTGTACTCACTGCCAGGGAAGGG + Intronic
1085754033 11:79189114-79189136 ATGTAAACACAGATATGGTATGG + Intronic
1085820102 11:79783285-79783307 TTGCAAACAAGGACAGGGAGGGG + Intergenic
1086162433 11:83737571-83737593 TTATAAACACAGATTGGAAAAGG + Intronic
1086362530 11:86073701-86073723 GTGTAAACACAGAAAGGTGAGGG - Intergenic
1087363478 11:97189997-97190019 TTGTTTACACAGACAAGTAAAGG + Intergenic
1088021565 11:105125723-105125745 TTTTACACAGAGTCAGGGAAGGG + Intergenic
1088093796 11:106075627-106075649 TTGTAAAACCACACAGGGAAGGG + Intronic
1088298127 11:108323378-108323400 TAGTAACCAGAGGCAGGGAAGGG + Intronic
1089695931 11:120216343-120216365 GTGCTAACACAGACAGGGTAGGG - Intronic
1089767862 11:120781645-120781667 GTGAAGACACAGACAGGGCAGGG - Intronic
1090233914 11:125132303-125132325 ATGTAAACAAAGACAAGAAAAGG - Intergenic
1090316153 11:125790680-125790702 TTGTCAGGACAGACACGGAAGGG - Exonic
1090587933 11:128234379-128234401 CTGTAAACTCAGACAGTGATGGG + Intergenic
1093710885 12:22328690-22328712 TTCTAAGCACAGCCTGGGAAGGG + Intronic
1094106902 12:26822627-26822649 ATGGAAACAAATACAGGGAAAGG + Intronic
1095376175 12:41531353-41531375 TTGTAAGCACCGACAGGCACTGG - Intronic
1096230037 12:49891707-49891729 TTGTAAACTCAGCAAGGGTAGGG + Intronic
1096303483 12:50452801-50452823 TTGTAAAAACAGACATGAAAAGG - Intronic
1096613988 12:52821463-52821485 ATTGAGACACAGACAGGGAAGGG + Exonic
1096880633 12:54666200-54666222 CTGTAAACACAAAAAGGGGAGGG - Intergenic
1097104469 12:56613221-56613243 TTGTAAACAGAGCCAGTGAGTGG - Exonic
1099076539 12:78116040-78116062 TAGTAACCACAGTCTGGGAAAGG + Intronic
1099661878 12:85574478-85574500 AAGCAAACACAGACAGGGCAGGG - Intergenic
1100192157 12:92204153-92204175 TTGTCAGCACAGGCTGGGAAAGG + Intergenic
1100523299 12:95397297-95397319 TCATAAAAACAGCCAGGGAAGGG + Intergenic
1100757448 12:97767055-97767077 TTGTCAACAAAGAAGGGGAAGGG + Intergenic
1101506403 12:105350485-105350507 TTCTATAAACAGAAAGGGAAAGG - Intronic
1101604952 12:106241217-106241239 CTGTTAAAACAAACAGGGAAAGG + Intronic
1101766313 12:107703015-107703037 CTGTACACACAGACAAGGTATGG + Exonic
1102195410 12:111021823-111021845 TTGGGCACACAGAGAGGGAAGGG + Intergenic
1102941592 12:116947333-116947355 TTGTTAACACTGTCAGGAAATGG - Intronic
1103205971 12:119129182-119129204 TTGAAGACATAGACAGGGCAAGG - Intronic
1103423566 12:120811139-120811161 TTGTAAACATATACAGAGATGGG - Intronic
1103730232 12:123022534-123022556 TTGTAAACTGAGACAGGGTCAGG - Intronic
1104355273 12:128079692-128079714 TTGAAAGCATAGACAGGGACAGG + Intergenic
1105266057 13:18816578-18816600 GTGTTAACACAGAAAGGAAATGG - Intergenic
1106226670 13:27791660-27791682 TTACGAACAGAGACAGGGAATGG - Intergenic
1106513538 13:30432538-30432560 TTTTAAAGACAGGCAGGCAAGGG + Intergenic
1107240198 13:38223705-38223727 TTGGGAACACAGAGAGGTAATGG + Intergenic
1107561288 13:41559527-41559549 TTGAAAACACCTAGAGGGAAGGG + Intergenic
1107723365 13:43273097-43273119 TTGTAAACACAGGAAGTGAAGGG - Intronic
1108139508 13:47404884-47404906 GTGTAAACACAGAGAGGAAATGG - Intergenic
1108150557 13:47529264-47529286 ATGTAAGAACAGACAGGCAATGG + Intergenic
1108254505 13:48597486-48597508 TTGCTAAAACAGAGAGGGAAGGG - Intergenic
1108995009 13:56719112-56719134 TTGTGAACGGAGAAAGGGAAGGG + Intergenic
1109041848 13:57348450-57348472 TTCTAGATCCAGACAGGGAAGGG - Intergenic
1109111367 13:58323584-58323606 TTTTAAACACAGAAAGTGTAGGG + Intergenic
1110203567 13:72883321-72883343 TGGTAACCAGAGACTGGGAAGGG + Intronic
1110321359 13:74163558-74163580 TAGTTAACAGAGACTGGGAAGGG + Intergenic
1110359076 13:74605182-74605204 TTTTAAACCCATTCAGGGAATGG - Intergenic
1110498545 13:76198529-76198551 TTGTATGGTCAGACAGGGAAAGG - Intergenic
1111915055 13:94352068-94352090 TCGTTAACACAGACAGAGAGAGG - Intronic
1112094848 13:96121180-96121202 TTTTAAAACCAGAAAGGGAAAGG - Intronic
1112709876 13:102115279-102115301 TTGTAAGCACAGAGAGGGTGGGG - Intronic
1114654380 14:24307426-24307448 TTGTGATCACAGACACGGAAAGG + Exonic
1115847093 14:37550634-37550656 TTTTAAACAAATACATGGAATGG + Exonic
1116469579 14:45271427-45271449 TTGTCCACACAGAAAGAGAAAGG - Intergenic
1117228353 14:53687441-53687463 TTGCACACACAGACCTGGAAGGG + Intergenic
1117485891 14:56196330-56196352 TAGTAAACACAGACTTAGAAGGG - Intronic
1120329883 14:83078714-83078736 TTGGAAACACAAATAGGAAAAGG + Intergenic
1121458339 14:94053940-94053962 GTGTACACACAGACGGGTAATGG - Intronic
1121686195 14:95837063-95837085 TTGTAAAGCCAAACAGGTAAAGG - Intergenic
1122498758 14:102179571-102179593 TTATAAATACAGACAGGGTGTGG - Intronic
1202832452 14_GL000009v2_random:51519-51541 GTGTTAACACAGAAAGGAAATGG + Intergenic
1124531224 15:30509202-30509224 TTTTAAAAAAAGACAGGAAAAGG + Intergenic
1124767431 15:32498494-32498516 TTTTAAAAAAAGACAGGAAAAGG - Intergenic
1125715471 15:41817507-41817529 TTGTAACCTTAGGCAGGGAATGG - Intronic
1125811179 15:42542640-42542662 TTATAAATACAAAAAGGGAAAGG + Exonic
1125811296 15:42543661-42543683 GTGTTAACACAGAGATGGAATGG + Exonic
1126669363 15:51102134-51102156 TTGGAAACTGAGACATGGAAAGG + Intronic
1126865827 15:52935661-52935683 TTGTAAAAAGAGGCAGGAAAGGG + Intergenic
1127728901 15:61780042-61780064 TTGTTCTCACAGACAGGGAGAGG - Intergenic
1129518283 15:76170310-76170332 TTGTGCACACAGACAAGGCAAGG + Intronic
1130348284 15:83068061-83068083 TTGTAAATACTGCCTGGGAAGGG - Intergenic
1132104334 15:99051775-99051797 AGGTAAACTCAGACAGGGGATGG - Intergenic
1132325127 15:100962623-100962645 TTCTAAACAGAGACAGGGAGAGG + Intronic
1133595997 16:7293410-7293432 TTAAAAACACAGACAAGGATCGG - Intronic
1134251608 16:12578132-12578154 TTGTGAAGACAGGCAGGGACTGG + Intergenic
1136104166 16:28017232-28017254 ATGTAATGACACACAGGGAAAGG + Intronic
1138532283 16:57640931-57640953 GTGGGAACACAGATAGGGAAGGG + Intronic
1138778871 16:59758364-59758386 TTGTAATCACAGAGAGAGAGGGG - Intergenic
1139307547 16:66000127-66000149 ATGGAAGCACAGAGAGGGAAAGG - Intergenic
1141008832 16:80377837-80377859 ATGGAAACACAGAAAGGGAAGGG + Intergenic
1141898186 16:86971984-86972006 ATAGAAACACAGAGAGGGAATGG - Intergenic
1143923945 17:10352755-10352777 TTGTAAGCACAGAAAGGGCCAGG - Intronic
1145266458 17:21381880-21381902 CAGTAAACACAGAGAGTGAATGG + Intronic
1146699450 17:34943566-34943588 TTTTAACAACAGACAAGGAAGGG + Intronic
1148142021 17:45335752-45335774 TTGAAGACAGAGAAAGGGAATGG - Intergenic
1148523386 17:48304248-48304270 TTTTAAATACAGATAAGGAAAGG + Intronic
1148807738 17:50272696-50272718 TGGGAAATAGAGACAGGGAAAGG + Intronic
1149388459 17:56165955-56165977 TGGAAAACAGAGGCAGGGAAGGG - Intronic
1149478298 17:56982005-56982027 ATGCAAACACACTCAGGGAAAGG - Intronic
1151214423 17:72567976-72567998 TTATAATGACAGACAGAGAAGGG - Intergenic
1153795239 18:8615827-8615849 TTGTAAGTGCAGACAGTGAAAGG - Intronic
1154367916 18:13727760-13727782 TGGTTACCACAGACTGGGAAGGG - Intronic
1154422348 18:14244908-14244930 GTGTTAACACAGAAAGGAAATGG + Intergenic
1155326852 18:24673044-24673066 GTGTAAACAGTTACAGGGAAAGG + Intergenic
1156797984 18:41071527-41071549 TTGCACAGACAGACAGGAAAGGG + Intergenic
1158185999 18:54772292-54772314 ATGTAAGCACAGAGAGGAAATGG - Intronic
1158620337 18:59027441-59027463 TTGTAAAAAGAAAGAGGGAAGGG - Intergenic
1159379848 18:67643205-67643227 TTTTAAACACTGAAAGGTAAGGG + Intergenic
1159666437 18:71167113-71167135 TTTTAAACACATACATGGCATGG - Intergenic
1160469323 18:79114317-79114339 TAGGAAACACAGAGAGTGAAAGG + Intronic
1160889011 19:1367079-1367101 TCTTAATCAGAGACAGGGAAAGG + Intronic
1161865006 19:6827114-6827136 GTGGAAACACAGACAGGGCAGGG + Intronic
1161887630 19:7009262-7009284 TTCTAACCACAGGAAGGGAATGG + Intergenic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162529845 19:11229464-11229486 GTGTTCACACAGACAGGGATGGG + Intronic
1165359741 19:35328971-35328993 TTGCAAACCCATACACGGAAAGG + Intronic
1202640233 1_KI270706v1_random:76215-76237 GTGTTAACACAGAAAGGAAATGG - Intergenic
924982898 2:239338-239360 TTCCAAACACAGAAAGGGATTGG - Intronic
925285226 2:2711414-2711436 CTGAAAACAGAGACATGGAATGG - Intergenic
925644982 2:6026657-6026679 TGGCAAACACAGACAGAGGAGGG - Intergenic
925801287 2:7604532-7604554 TTTTAAACACAGAGAAAGAAGGG + Intergenic
925853188 2:8104180-8104202 CTGAAAACACAAACAGGCAACGG + Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926435883 2:12837377-12837399 TTGTATACAAAGGCAGAGAAGGG + Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
927079032 2:19609688-19609710 TGGAAAACACAAACAGGTAAAGG - Intergenic
927372161 2:22368803-22368825 ATGTAAACAAAGAGAGAGAATGG + Intergenic
927901191 2:26819941-26819963 TTGCAATCACAGACAATGAAAGG + Intergenic
928207987 2:29300768-29300790 TTGTAAGCATAGACACAGAAAGG - Intronic
928592583 2:32832948-32832970 AAGTAAAGACAGACAGGGGAGGG - Intergenic
928905872 2:36366946-36366968 TTATAAACACACACACAGAAAGG - Intronic
929594703 2:43168851-43168873 TTGTCAACACAGCCAGGGCCTGG - Intergenic
929957421 2:46469193-46469215 TTGTATAAAGACACAGGGAAAGG + Intronic
930554948 2:52883854-52883876 TTGTGAAAACAGGCAGGGTAGGG + Intergenic
930555226 2:52886826-52886848 TTGTGAAAACAGGCAGGGTAGGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
932795118 2:74687784-74687806 TTCGGAACACAGACAGGGAGAGG - Intergenic
932843882 2:75114918-75114940 TTGTAAACACAGACAGGGAATGG + Intronic
933005820 2:76993090-76993112 TTATATACACAGAAAGGTAAGGG - Intronic
933397137 2:81747483-81747505 AAGTAAAAAAAGACAGGGAAGGG - Intergenic
934967563 2:98735980-98736002 TTGTATAATCAGACAGGGCACGG + Intergenic
935590289 2:104842063-104842085 TGGAAATCACAGACTGGGAAAGG + Intergenic
936297803 2:111280048-111280070 TGGTCCACACCGACAGGGAAAGG - Intergenic
938735658 2:134184344-134184366 ATGTAAAGACAGGCAGGGAGAGG - Intronic
941775702 2:169391067-169391089 TAGAAAACACAGTAAGGGAAAGG + Intergenic
942007628 2:171721336-171721358 GTGTAAAAAAAGAAAGGGAATGG + Intronic
943085136 2:183301596-183301618 TGGTAAACAGAGGCTGGGAAAGG - Intergenic
944046292 2:195415123-195415145 TGGTTACCACAGACTGGGAATGG + Intergenic
944085431 2:195842016-195842038 TCATAAAAACAGACAAGGAAAGG + Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944745876 2:202655593-202655615 TTCTAAAAACAGATAAGGAAGGG - Intronic
945262908 2:207861314-207861336 TTGTACACACAGGAAAGGAAAGG + Intronic
947053312 2:226071714-226071736 GTGAAATAACAGACAGGGAAAGG - Intergenic
948456492 2:238106865-238106887 CTGGAAACAGAGACAGGGACAGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1168871195 20:1130124-1130146 TTGTAGAGACAGACAGTGGATGG + Intronic
1168896435 20:1326926-1326948 CTGCAAACACAGACAGGCATGGG - Intronic
1169270136 20:4192713-4192735 TTGGACACACAGGCAGGGACAGG + Intergenic
1169474548 20:5919092-5919114 TAGTAAACAAAGAAAGGGAAAGG - Intronic
1169696756 20:8397540-8397562 TTGTAAACAGAAACATGGTAAGG - Intronic
1171149310 20:22812975-22812997 TTTTAAACACAGAAAGCGAATGG + Intergenic
1171449441 20:25225475-25225497 TTGAAAAGACAGAGAGGGAGAGG - Intronic
1171887110 20:30662874-30662896 GTGTTAACACAGAAAGGAAATGG - Intergenic
1171922012 20:31106661-31106683 TTGTAAAGACACAAATGGAATGG + Intergenic
1171930510 20:31224802-31224824 TTGTAAAGACACAAATGGAATGG + Intergenic
1173010485 20:39177214-39177236 TTGTCAAGACATACATGGAAGGG + Intergenic
1174100018 20:48120044-48120066 CTGGACACACAGACAGGGAGGGG - Intergenic
1174152967 20:48498922-48498944 CTGGACACACAGACAGGGAGGGG - Intergenic
1174480256 20:50826251-50826273 TTGTTACCAGTGACAGGGAAAGG - Intronic
1174691342 20:52509557-52509579 TGGTTACCACAGACTGGGAAGGG + Intergenic
1175211964 20:57364408-57364430 TTGAAAACACAGCAAAGGAAAGG - Intronic
1175524320 20:59623076-59623098 TTGGAAATATAGGCAGGGAAGGG + Intronic
1175688044 20:61045612-61045634 CTGTGAACCCAGAAAGGGAAAGG - Intergenic
1176648559 21:9373801-9373823 GTGTTAACACAGAAAGGAAATGG - Intergenic
1176851125 21:13915041-13915063 GTGTTAACACAGAAAGGAAATGG - Intergenic
1177091394 21:16773406-16773428 TTGCAAACACAAAAATGGAAGGG + Intergenic
1177761599 21:25407945-25407967 TGGTAAACACACACATGAAAAGG + Intergenic
1178308162 21:31508059-31508081 TGGAAGACACAGACAGGGACAGG + Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179639409 21:42737247-42737269 ATATAAACACAAACAGAGAAAGG + Intronic
1179935342 21:44600455-44600477 TTTTAAACACAAACAAGGAAGGG + Intronic
1180361710 22:11905681-11905703 GTGTTAACACAGAAAGGAAATGG + Intergenic
1184373831 22:44099254-44099276 CTCTGAACACACACAGGGAAGGG - Intronic
1184817649 22:46884379-46884401 TGGGAAACACAGTGAGGGAACGG - Intronic
1184940198 22:47759278-47759300 TTGTTATTACAGACAGGGATTGG + Intergenic
949514711 3:4796541-4796563 ATGAAAACACAGACAAGGTAAGG - Intronic
949939441 3:9143621-9143643 TTTCAAACACAGACAATGAAAGG - Intronic
950986883 3:17381751-17381773 TTGTAATCTCAGACTAGGAAAGG - Intronic
951317814 3:21207808-21207830 TTCTGAACCCACACAGGGAAGGG - Intergenic
952531755 3:34269821-34269843 TTGTAATCTCAGACTAGGAAAGG - Intergenic
952729758 3:36626416-36626438 TTTTAAACACAGACATCCAATGG - Intergenic
953190982 3:40687968-40687990 TGGGAAAGAAAGACAGGGAAGGG + Intergenic
953662847 3:44903729-44903751 TTGTCAACACTGGCAAGGAAGGG - Intronic
955310653 3:57883455-57883477 TTATAATCAGAGAAAGGGAAAGG + Intronic
955800477 3:62681061-62681083 GTGTCAGCAAAGACAGGGAAGGG - Intronic
956605590 3:71070107-71070129 TTTTAAAGCCAGACAGAGAAAGG + Intronic
957809979 3:85209020-85209042 TTGTAAACACAGACAAGAAATGG + Intronic
957889720 3:86340732-86340754 TTGTTACCACAGGCTGGGAAGGG - Intergenic
958017284 3:87954013-87954035 TAGTTACCAGAGACAGGGAATGG + Intergenic
959655742 3:108802477-108802499 TTCTATACACTGACAGTGAACGG + Intergenic
959895634 3:111603018-111603040 TAGAAAACTCAGACAGGGCATGG + Intronic
959899851 3:111648409-111648431 CTGTAACCACATACAGGGAGTGG + Intronic
959950835 3:112178149-112178171 TTGTAAACAGAGACAGAGTCTGG + Intronic
962026034 3:131548553-131548575 ATGTTAACACAGTCAGAGAATGG + Intronic
962626407 3:137229889-137229911 TTGTTAACACCACCAGGGAATGG - Intergenic
962728681 3:138259325-138259347 ATGTGATCACAGACAGGAAAAGG - Intronic
962988694 3:140559266-140559288 TTGCAATTACAGAAAGGGAAGGG - Intronic
963712795 3:148766793-148766815 TGGCAAACACAAAGAGGGAAAGG + Intergenic
964692749 3:159470339-159470361 CTGTATACACAGACAGTCAAAGG + Intronic
967108988 3:186276564-186276586 GTGAAAAGACAGACAGAGAAAGG + Intronic
1202738322 3_GL000221v1_random:31185-31207 GTGTTAACACAGAAAGGAAATGG + Intergenic
968862845 4:3186219-3186241 TTGTATACACATACATGGGATGG - Intronic
969098198 4:4750208-4750230 CTGAAACCACAGAAAGGGAAAGG + Intergenic
969693072 4:8717094-8717116 TTGTAAAAACAGAAATTGAAAGG + Intergenic
969966631 4:11003280-11003302 TAGCAAACATATACAGGGAATGG - Intergenic
970508993 4:16761769-16761791 TGGTAGACAGAGGCAGGGAAAGG - Intronic
971497376 4:27281253-27281275 TGGTAAAAACAGAGAGGAAATGG + Intergenic
973156689 4:46963681-46963703 TTGTAAACAGATATAGGTAAAGG + Intronic
973370468 4:49242563-49242585 GTGTTAACACAGAAAGGAAATGG - Intergenic
973390556 4:49552853-49552875 GTGTTAACACAGAAAGGAAATGG + Intergenic
974067204 4:57089717-57089739 TTGTCAAAAGAGACAGAGAAGGG - Intronic
974405280 4:61460518-61460540 TAATTAACAGAGACAGGGAAGGG + Intronic
974500646 4:62697095-62697117 TTGTATACACAGGCAGAGAAAGG - Intergenic
975337084 4:73190593-73190615 GTGTAAACACATACAGAAAAAGG + Intronic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
979387594 4:120087640-120087662 TTGGAAACACAGACTAGGATTGG - Intergenic
979791353 4:124785191-124785213 TTGTAAGGACAGAAAGAGAATGG - Intergenic
979907701 4:126317383-126317405 TTGCAAACACAGACATCCAAGGG - Intergenic
980424763 4:132613670-132613692 TTAGAAACACAGAGGGGGAAAGG + Intergenic
981159672 4:141482874-141482896 TTGTAATCACAGTCAGAAAAAGG - Intergenic
983687088 4:170423088-170423110 TAATAAATACAGACAGGGCACGG - Intergenic
984205393 4:176781730-176781752 TTGTAAACAAAGACAAGGGAAGG + Intronic
1202767594 4_GL000008v2_random:162073-162095 GTGTTAACACAGAAAGGAAATGG - Intergenic
986446627 5:7826819-7826841 TTGTAAACACAGAAATGTCAAGG + Exonic
986468298 5:8049327-8049349 GAGTAACCACAGCCAGGGAAGGG - Intergenic
986603597 5:9499043-9499065 ATGTAAACATAGGCAGCGAAAGG + Intronic
986899905 5:12418593-12418615 TTGTAGAGCCAGAAAGGGAAGGG - Intergenic
987596252 5:20003425-20003447 TTGTAAACACAGACTTCAAATGG + Intronic
988547212 5:32169675-32169697 GAATAAACACACACAGGGAAAGG + Intronic
989114431 5:37938735-37938757 TTATAAACTCAGACATGGAGGGG - Intergenic
989559209 5:42831820-42831842 TTGGAAACACAAGCAGGGACAGG - Intronic
990586698 5:57218491-57218513 TAGTACACCCAGACAGGGCATGG - Intronic
990915472 5:60898793-60898815 TTGAAAAAAAAAACAGGGAAAGG + Intronic
991564378 5:67989640-67989662 GCATAAACACAGACAGGGAAAGG + Intergenic
993026171 5:82649475-82649497 TTGTAGACTGAGACATGGAAGGG + Intergenic
993306967 5:86286026-86286048 TTGGAAGCACAGACAGGGGTGGG + Intergenic
995268967 5:110199397-110199419 AGGAAAACACAGAGAGGGAATGG + Intergenic
995349952 5:111163731-111163753 GTATTAACACAGAGAGGGAAGGG + Intergenic
996173485 5:120325324-120325346 TGGTTACCACAGACTGGGAAGGG + Intergenic
997047584 5:130337410-130337432 TTGGAAAGGCAGACTGGGAAAGG + Intergenic
997084119 5:130776308-130776330 TGGTAAAGAGAGACAGGAAATGG + Intergenic
999549008 5:152663125-152663147 ATCTAAACACAGACAAGGTATGG - Intergenic
1000652607 5:163835493-163835515 TGGTTCACACAGCCAGGGAAGGG - Intergenic
1001447473 5:171796995-171797017 TAGGACACACAGACAGGAAAGGG - Intergenic
1001570345 5:172726748-172726770 TTATACACACAGTGAGGGAAGGG - Intergenic
1001888742 5:175320625-175320647 TGGTAAACACATGCAAGGAAAGG + Intergenic
1003417682 6:5927294-5927316 TAGTAAAAACTGACATGGAATGG - Intergenic
1003524499 6:6886502-6886524 GTGTAGACACAGACAGAGATGGG - Intergenic
1004420171 6:15462289-15462311 TTGTAAAGTCAGACCAGGAATGG + Intronic
1005103303 6:22197357-22197379 TAGTAAAGAAAGACAAGGAATGG + Intergenic
1005183885 6:23140210-23140232 TTGTAATCACAGGCAGGAGAGGG + Intergenic
1005607318 6:27487876-27487898 GTGAAAACACAGCCAAGGAATGG + Intergenic
1006800607 6:36757324-36757346 GTGGGAACAAAGACAGGGAAAGG - Intronic
1007776612 6:44227558-44227580 GTGGAAACACAGACAGGCCAGGG - Intronic
1007917917 6:45578224-45578246 TTGTATACAGAGTCAGGAAATGG - Intronic
1009039964 6:58164393-58164415 TTGTAAACACTCATGGGGAATGG - Intergenic
1009215857 6:60919242-60919264 TTGTAAACACTCATGGGGAATGG - Intergenic
1009244476 6:61219055-61219077 TTGTAGACAGATACAGGGTAAGG + Intergenic
1010919124 6:81659440-81659462 TTGTTAACATAGACTGGGAGAGG + Intronic
1011025566 6:82865663-82865685 CTGAGAACACAGACAGGGAGGGG - Intergenic
1012450313 6:99348100-99348122 TTATAAACAAAGACAGTGATAGG - Intronic
1012907539 6:105085493-105085515 TTATAGACACAGACAGGGGTAGG - Intergenic
1013576963 6:111493448-111493470 TGGCAAAAAGAGACAGGGAAAGG - Intergenic
1015199152 6:130559624-130559646 TTTTAAACAAATACAAGGAAGGG + Intergenic
1015622027 6:135141397-135141419 TTGTAACAACAGAAAGGGAAGGG + Intergenic
1016143050 6:140637121-140637143 CTGTAAATTCAGAGAGGGAAAGG - Intergenic
1018665101 6:166127977-166127999 TCGGAAACACAGACAGGGCCTGG + Intergenic
1018877573 6:167838407-167838429 TTGTAAGCACAGACCAGGGAAGG - Intronic
1019093239 6:169557480-169557502 TTGTAACCCCAGACAAAGAAAGG + Intronic
1019888117 7:3923416-3923438 TTATTAAAACAAACAGGGAAAGG - Intronic
1022559430 7:31333866-31333888 TTTAAAACACAGACAGCGAGAGG + Intergenic
1023116119 7:36864371-36864393 TGATAAACACAGGCAGGAAATGG + Intronic
1023637817 7:42230058-42230080 AAGGCAACACAGACAGGGAAGGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024811600 7:53218955-53218977 TTGTAAGTACAGAGCGGGAAGGG - Intergenic
1025234122 7:57222382-57222404 CTGGACACACAGACAGGGAGGGG + Intergenic
1026584780 7:71647381-71647403 TTTTAAACAACGACAGGGATGGG + Intronic
1028505953 7:91570351-91570373 TTGTCAACACAGAGAGGGCAAGG - Intergenic
1029540436 7:101179532-101179554 TTGGAAACAGAGACGGGGAGAGG + Intronic
1030019325 7:105257615-105257637 TTGTAAACACAGAGAGCATATGG + Intronic
1030323593 7:108195660-108195682 TTCAAAAAACAAACAGGGAAAGG - Intronic
1030813304 7:114003403-114003425 TTGAAAACAGACACAAGGAAAGG + Intronic
1030853477 7:114520444-114520466 TTGCAAACTCAGACAGAGTAGGG + Intronic
1033406742 7:141076643-141076665 CTGGAAACAGAGACAGGGAAAGG + Intronic
1034978333 7:155460645-155460667 TTGGAAACCCAGACAGAGATGGG + Intronic
1035528406 8:332755-332777 TTGTGAAGACAGACAGAGATGGG + Intergenic
1036422488 8:8611438-8611460 TTCTAAACTCAGACTGGAAAGGG - Intergenic
1036504108 8:9339621-9339643 TTGTAAACACACACAGAAGATGG + Intergenic
1038336839 8:26652392-26652414 TTGTAAACAAAATCAGGGAAGGG - Exonic
1038717579 8:30005613-30005635 TTGTAGTAAGAGACAGGGAATGG + Intergenic
1041861717 8:62521442-62521464 TTGAAAACACAGCCATAGAAAGG - Intronic
1043159481 8:76827809-76827831 GGGTAAAAACAGACAGGGCAGGG + Intronic
1044786631 8:95800720-95800742 TTGAAAGCACAGACAGACAAAGG - Intergenic
1045396247 8:101763435-101763457 TGGTAACCAATGACAGGGAAAGG + Intronic
1045539421 8:103068437-103068459 TAGGAAACACAGACAGTGAGTGG - Intronic
1045638408 8:104220404-104220426 TTATTAACACAGACAAGGCAGGG + Intronic
1046334421 8:112766028-112766050 TTGGAAACTCAGTGAGGGAAAGG - Intronic
1047455359 8:125003938-125003960 TTGGAAAAAAAGACAGGGGAGGG - Intronic
1048126992 8:131646876-131646898 TTGTAATGACAGACTGGTAACGG + Intergenic
1048184251 8:132224976-132224998 TTGTAAGCACAGGGAAGGAAGGG - Intronic
1048245523 8:132793164-132793186 TTGTATACAAAGGAAGGGAAGGG + Intronic
1049064942 8:140305699-140305721 AAGTAAAAACTGACAGGGAATGG + Intronic
1050099497 9:2103325-2103347 TTGTAAAAACAGACAGCAGACGG + Intronic
1050830679 9:10008308-10008330 TTGAAAACACAAAAAGGGAGGGG - Intronic
1051784427 9:20726486-20726508 TTGTGCTCTCAGACAGGGAAGGG + Intronic
1052330245 9:27260299-27260321 GTGTAAAGACAGCAAGGGAAAGG + Intergenic
1052876311 9:33569017-33569039 GTGTTAACACAGAAAGGAAATGG + Intronic
1053499704 9:38575333-38575355 GTGTTAACACAGAAAGGAAATGG - Intronic
1053661415 9:40284734-40284756 GTGTTAACACAGAAAGGAAATGG + Intronic
1053911792 9:42914077-42914099 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054373537 9:64430952-64430974 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054523194 9:66091550-66091572 GTGTTAACACAGAAAGGAAATGG - Intergenic
1055134651 9:72814184-72814206 TTTTAAACAGAGACAGAGAAAGG + Intronic
1056678056 9:88693179-88693201 TTGGACACTCACACAGGGAAAGG - Intergenic
1057300476 9:93876930-93876952 TTGTTAAAAGAGACAGAGAAGGG + Intergenic
1057498149 9:95576177-95576199 TTATGCACACAGAGAGGGAAGGG - Intergenic
1057679130 9:97160036-97160058 TTGTTAACACAGAAAGGAAATGG - Intergenic
1059615666 9:115948309-115948331 TTGAAACCACGGACAGGGAGGGG - Intergenic
1060123841 9:121023244-121023266 TGGTGGACACAGACAGGGATGGG - Intronic
1061922536 9:133789898-133789920 GTGTCCACACAGACAGGAAAAGG + Intronic
1203692007 Un_GL000214v1:51026-51048 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203707052 Un_KI270742v1:61630-61652 GTGTTAACACAGAAAGGAAATGG + Intergenic
1203548350 Un_KI270743v1:146945-146967 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203644288 Un_KI270751v1:53165-53187 GTGTTAACACAGAAAGGAAATGG + Intergenic
1186355524 X:8785281-8785303 TTCTGAACACAGATAGGGATGGG + Intergenic
1187351016 X:18517141-18517163 TAGTAAACAGAGTAAGGGAATGG + Intronic
1187623049 X:21079909-21079931 TTGTAAAAACAGAGAGGAAGAGG - Intergenic
1188311122 X:28617707-28617729 TTCTAAACAAAGCCAAGGAAAGG - Intronic
1189214276 X:39310023-39310045 TTGGAAACACTGGAAGGGAAGGG - Intergenic
1189247065 X:39571516-39571538 TGGGAAAGCCAGACAGGGAAGGG - Intergenic
1192173684 X:68873002-68873024 TTGGAAACTCTGCCAGGGAAAGG + Intergenic
1192353391 X:70376669-70376691 TTGTAGACACATTCAAGGAATGG + Intronic
1195811724 X:108840626-108840648 GTGGAAACACAAACAGGAAAAGG + Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1197170975 X:123433912-123433934 TTTTAAGCACAGGCAGCGAAAGG + Intronic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199885127 X:152012925-152012947 TAGAAAACAGAGACTGGGAAGGG + Intergenic
1201408437 Y:13673072-13673094 TTGTCAAGAAAGTCAGGGAAAGG - Intergenic
1202263843 Y:22997570-22997592 CTGTAAGCAGAGACAAGGAAAGG - Intronic
1202416834 Y:24631312-24631334 CTGTAAGCAGAGACAAGGAAAGG - Intronic
1202453953 Y:25038774-25038796 CTGTAAGCAGAGACAAGGAAAGG + Intronic