ID: 932844789

View in Genome Browser
Species Human (GRCh38)
Location 2:75124021-75124043
Sequence CAGTCAATGAAACGTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932844788_932844789 -1 Left 932844788 2:75123999-75124021 CCGTGCTCGTGGGACTCTAAGGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 932844789 2:75124021-75124043 CAGTCAATGAAACGTCTTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932844789 Original CRISPR CAGTCAATGAAACGTCTTTC TGG Intronic
902562524 1:17286714-17286736 CAGTCAATGAACCCTCACTCTGG + Intergenic
905082546 1:35337055-35337077 GAGTCAATTAAACCTCTTTCTGG + Intronic
908763215 1:67531294-67531316 GAGTCAATTAAACCTCTTTCTGG - Intergenic
910662284 1:89686657-89686679 AAGTCATTGAAACCTCTTTAGGG + Intronic
911711658 1:101080432-101080454 CAGTAAAGGCAACTTCTTTCTGG + Intergenic
911898978 1:103476419-103476441 AAGACAATGAAACATCTTTGAGG + Intergenic
913441644 1:118904670-118904692 GAGTCAATGAAAACTCTTTATGG - Intronic
919406491 1:197190704-197190726 AAGTAAATGCAACGTCTTTTGGG - Intronic
924837225 1:247663047-247663069 CAGCAAATGAAACATATTTCAGG - Intergenic
1070324119 10:75376689-75376711 GAGTCAATTAAACCTCTCTCAGG - Intergenic
1073387199 10:103135472-103135494 AAGTCCATTAAACTTCTTTCTGG + Intronic
1078299497 11:10112507-10112529 AAGTCCATTAAACTTCTTTCTGG + Intronic
1081199206 11:40196049-40196071 CACTCAAACAAATGTCTTTCTGG - Intronic
1082681410 11:56176163-56176185 CATTCAATGAAACTCCTTTCTGG - Intergenic
1083978786 11:66147337-66147359 CAGTCAAAAAAACTTCTTTCAGG - Intronic
1088135963 11:106555408-106555430 CAGTCAATGAAAATTTCTTCTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1091525601 12:1297171-1297193 AAGACAATGGAACTTCTTTCAGG + Intronic
1091887414 12:4026770-4026792 CATTCACTGAAGCGTCTCTCTGG + Intergenic
1095506234 12:42902043-42902065 CAGTCAAGGAAACATTTTTCAGG + Intergenic
1098534355 12:71577700-71577722 CAATCAAGGAAACATCGTTCAGG - Intronic
1100144474 12:91660567-91660589 TAGCTAATGAAAAGTCTTTCAGG - Intergenic
1100754552 12:97736086-97736108 CTGTCAATGAAACAGCTTCCAGG + Intergenic
1103860412 12:124008000-124008022 CAGTCAAGGAAATGTGATTCGGG - Intronic
1105925346 13:25002749-25002771 TAGTCAATAAAAAGTGTTTCTGG + Intergenic
1107535222 13:41322836-41322858 CTGTCATTGAAACATCTTTGGGG - Intronic
1111303704 13:86378708-86378730 TAGTCAATGAAATGTCTTAGAGG - Intergenic
1111798416 13:92953356-92953378 CAGTCAATGAAATGTTTCTCAGG - Intergenic
1125925154 15:43557143-43557165 CATTTACTGAAAAGTCTTTCTGG + Intronic
1131308903 15:91269987-91270009 CAGACAATGAAACATCTTGGGGG - Intronic
1131593950 15:93777901-93777923 TAGTCAATCAAATTTCTTTCTGG + Intergenic
1140855416 16:78973736-78973758 AAGTAAATGAAAAGTATTTCTGG + Intronic
1142490265 17:274112-274134 CAGTAAATGAAATGAATTTCTGG + Intronic
1142663151 17:1445208-1445230 AAGCCAATGAAAAGTCCTTCCGG + Intronic
1144002679 17:11070438-11070460 GAGTCAATGAAAGGCTTTTCTGG + Intergenic
1144370035 17:14581501-14581523 CAGTGACTGAAACGTCGTTATGG - Intergenic
1145852218 17:28111473-28111495 CAGTCAATAAAAACTGTTTCTGG - Intronic
1150535366 17:66033544-66033566 CAGTAAATGAAAAGGCTTTGAGG - Intronic
1152179430 17:78809391-78809413 CAGCCAGTGAAACGGCTTTGCGG - Intronic
1155943187 18:31820355-31820377 TATTCAATGAAACGTATTTTGGG + Intergenic
1156446665 18:37242046-37242068 CAGTCAATGACCCTTGTTTCTGG + Intergenic
1156474868 18:37399005-37399027 CAGTCTAGGAAACCCCTTTCAGG + Intronic
1157344412 18:46811574-46811596 CATTGAATGAAATGTCTTTGGGG - Exonic
1158971549 18:62672836-62672858 CATTCAAGGAAACCTCTGTCAGG - Intergenic
1161413325 19:4129625-4129647 CAGTAAATGAATCATCCTTCTGG + Intergenic
925713318 2:6762592-6762614 CAGTCAATGACACACCTATCTGG - Intergenic
925749249 2:7072843-7072865 CAGTCAAGGAAATGCCTTTCTGG - Intergenic
928974637 2:37072429-37072451 CAGGCAATGAAGCATCTTTGAGG + Intronic
930193062 2:48480257-48480279 AAGTCAGTGTAACGTATTTCTGG - Intronic
931802462 2:65771924-65771946 CAGCCACTGAAACGAGTTTCTGG + Intergenic
932844789 2:75124021-75124043 CAGTCAATGAAACGTCTTTCTGG + Intronic
934333378 2:92096616-92096638 CATTCACAGAAACGTCTTTGGGG + Intergenic
939027129 2:137027269-137027291 CAGTCTAGGGAAGGTCTTTCTGG + Intronic
941429654 2:165398751-165398773 GAGTCAATTAAACCTCTTTCTGG - Intergenic
943111547 2:183612295-183612317 CACTTAATGTAATGTCTTTCAGG + Intergenic
944500747 2:200357265-200357287 CTGACAATGAAAGGACTTTCAGG - Intronic
1171285357 20:23932984-23933006 CAGTCAATGTAACTTCCTCCAGG + Intergenic
1171934351 20:31259670-31259692 GAGTCAATGAAATGGCTATCGGG + Intergenic
1173622626 20:44448372-44448394 CTGTAAATGAAATGTCTCTCTGG - Intergenic
1177245033 21:18512056-18512078 CAGTGAATGAATACTCTTTCAGG - Intergenic
1177671283 21:24232450-24232472 CATTCAATGGAAGGTTTTTCAGG - Intergenic
1182478710 22:30592131-30592153 CAGTCAATGAATCGTCATCAGGG - Intronic
1202727798 2_KI270716v1_random:23224-23246 CATTCACAGAAACGTCTTTGGGG + Intergenic
951788033 3:26445062-26445084 CACTGAATGAAACTTCTTTTTGG + Intergenic
952506919 3:34015857-34015879 CAGTCAATGAAGCCTCTTTGGGG - Intergenic
955127183 3:56124478-56124500 CAATCAATGCAACATCTTCCTGG + Intronic
957354767 3:79067792-79067814 CAGTCAACTAAACCACTTTCAGG - Intronic
962322554 3:134403987-134404009 CAGTCAATGCAAAGTCTCTGGGG + Intergenic
964551979 3:157895203-157895225 CAGTCAGTAAAAAGTCATTCTGG + Intergenic
966100391 3:176262117-176262139 CACTTAATGTAACGTCTTCCAGG + Intergenic
969144229 4:5106784-5106806 TAGTAAATGAAACATTTTTCAGG - Intronic
973093194 4:46164179-46164201 CAGTGAATGAAACAACTTACCGG + Intergenic
980021171 4:127711895-127711917 CATTCAATGAAACTTCATCCTGG - Intronic
981638491 4:146908882-146908904 CAGTCAATTAAACGTCTTTATGG - Intronic
986498428 5:8371933-8371955 GAGTCAATTAAACCTCTTTAAGG + Intergenic
987592342 5:19946248-19946270 TATTCAATGAAACATCCTTCCGG + Intronic
990972667 5:61525990-61526012 AAGTCATGGAAATGTCTTTCCGG - Intronic
993233518 5:85270794-85270816 CACTGAATGAAACCTCTTCCAGG - Intergenic
995460541 5:112398866-112398888 CAGTGAAAGAAAGGTCTTTAAGG - Intronic
996769351 5:127069553-127069575 CAATGAATGAAACATCTTTTAGG - Intronic
1000880999 5:166697473-166697495 CTGTCAGTGAAACTTCTTTCTGG + Intergenic
1002830471 6:815882-815904 CAGTTAGTGAGACGTCTTTGTGG + Intergenic
1004441237 6:15656847-15656869 AAGTAAATGAAACGTCATGCAGG - Intronic
1006388190 6:33743809-33743831 CAGTCATAGAAACTTATTTCGGG + Intronic
1006745032 6:36335671-36335693 ATGTCAATGAAACGGCTCTCTGG - Intronic
1007729831 6:43939103-43939125 CAGTCAATTAAGCCCCTTTCAGG + Intergenic
1008589511 6:52979381-52979403 CAGTAAGTGAATCCTCTTTCTGG + Intronic
1010855074 6:80827945-80827967 CAGTCAATGAAACATCCCTGAGG - Intergenic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1012150723 6:95747867-95747889 CAGTCATTTAAACATATTTCTGG + Intergenic
1013167920 6:107610323-107610345 CTGGCCATGAAACGTCTTACAGG - Intronic
1018103038 6:160458104-160458126 CATTTAATGAAATGTCTTTTGGG - Intergenic
1022655219 7:32312934-32312956 CAGTAAAAGAAACTTCTATCAGG + Intergenic
1027194434 7:76019990-76020012 AGGTCAATGAAAAGTCTTTGGGG - Intronic
1031988375 7:128178654-128178676 CACTCAATGAACCTTCTTCCTGG + Intergenic
1043058059 8:75465525-75465547 TAGTCTCTGAAACTTCTTTCTGG - Intronic
1044489969 8:92801776-92801798 TAGTGAATGAAAGGACTTTCTGG + Intergenic
1046281260 8:112035317-112035339 CAGTTAACATAACGTCTTTCGGG - Intergenic
1046491834 8:114963174-114963196 CATTCAATGAAAAGTGTTTAGGG + Intergenic
1052607255 9:30721540-30721562 GAGTAGATGAAAGGTCTTTCTGG + Intergenic
1054958360 9:70939332-70939354 CAGTCCCTGAAACTTCTCTCAGG + Intronic
1056329705 9:85511266-85511288 CTGTCAGTGAAACGTGTCTCTGG + Intergenic
1059662696 9:116417652-116417674 CAGTCAACGAACAGCCTTTCTGG - Intergenic
1060392094 9:123286340-123286362 CAATCAAAGAAACATCTTTCTGG + Intergenic
1060671725 9:125475666-125475688 CATTCAAAGACAAGTCTTTCTGG - Intronic
1203412651 Un_KI270589v1:4467-4489 CATTCAAAGAAACTTCTTTGTGG + Intergenic
1203685702 Un_KI270757v1:55100-55122 CATTCAAAGAAACTTCTTTGTGG - Intergenic
1185700382 X:2227048-2227070 AACTCCATGAAATGTCTTTCCGG + Intronic
1187401625 X:18965561-18965583 GAGTCCATGAATCGCCTTTCTGG + Intronic
1187420372 X:19128724-19128746 CAGTCATTGCAAGCTCTTTCAGG + Intergenic
1198800337 X:140441074-140441096 CTGCTAATGAAACGGCTTTCTGG + Intergenic
1201334267 Y:12863052-12863074 CCTTCAATGAAACTTCTTTTGGG + Intergenic