ID: 932845749

View in Genome Browser
Species Human (GRCh38)
Location 2:75134405-75134427
Sequence TCTGAAGGAGTGGCTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932845741_932845749 19 Left 932845741 2:75134363-75134385 CCCCCTTTCTATATGTCAGAGAA 0: 1
1: 0
2: 2
3: 20
4: 211
Right 932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 179
932845743_932845749 17 Left 932845743 2:75134365-75134387 CCCTTTCTATATGTCAGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 219
Right 932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 179
932845742_932845749 18 Left 932845742 2:75134364-75134386 CCCCTTTCTATATGTCAGAGAAG 0: 1
1: 0
2: 2
3: 9
4: 279
Right 932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 179
932845740_932845749 29 Left 932845740 2:75134353-75134375 CCTTATTTAACCCCCTTTCTATA 0: 1
1: 0
2: 2
3: 18
4: 212
Right 932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 179
932845745_932845749 16 Left 932845745 2:75134366-75134388 CCTTTCTATATGTCAGAGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932845749 Original CRISPR TCTGAAGGAGTGGCTGTCTC TGG Intronic
900253967 1:1687219-1687241 TGTGCAGGTGTGACTGTCTCTGG - Intronic
900489641 1:2941134-2941156 ACTGAGGCAGTGGCTGTCTTGGG + Intergenic
901038122 1:6348574-6348596 TTGGTAGGAGTGGCTCTCTCAGG - Intronic
901665258 1:10822628-10822650 TCTGAAGGCCTGGTTTTCTCAGG - Intergenic
904869489 1:33607755-33607777 GCTGAGGGAGTGGCTGTGCCTGG + Intronic
907732033 1:57076077-57076099 TCTCAGGAATTGGCTGTCTCTGG + Intronic
907754086 1:57293042-57293064 AATGAATGAGTGGTTGTCTCAGG + Intronic
908065661 1:60401382-60401404 ACTGAAGGAATAGCTGTCTTAGG - Intergenic
908173477 1:61530731-61530753 TCTGAAGAAGGGGCTGTCAAGGG - Intergenic
908539212 1:65106620-65106642 TGTGAAGGAATGGCAGACTCAGG + Intergenic
908770755 1:67593519-67593541 TCTGCAGGAAGGGATGTCTCAGG - Intergenic
912171640 1:107107672-107107694 TCTGAAAGAGTGGCATTCCCGGG - Intergenic
917415210 1:174802219-174802241 TCTGAAGTAGTGCATCTCTCAGG + Intronic
919122019 1:193353285-193353307 TCTGAAGAAGTCACAGTCTCAGG - Intergenic
920448838 1:206041639-206041661 CCTGAAGGAGTGACAGTCTAGGG + Intronic
921048298 1:211492625-211492647 TCAGAAGGAGGGGCTGTCCAGGG + Exonic
921163470 1:212489137-212489159 GATGAAGGAGTGGCTGGCTCAGG - Intergenic
922565765 1:226600731-226600753 TGTGCAGGAGTGGGGGTCTCGGG - Intronic
922814740 1:228440427-228440449 TCTGAAGTAGAGGCAGCCTCGGG + Intergenic
923038550 1:230302522-230302544 TCTAGAGGAGGGGCTGTCTCAGG - Intergenic
924708085 1:246514006-246514028 TCTGAAGAAGAGGCTTCCTCAGG + Intergenic
1062834636 10:627584-627606 GGTGAAGGAGTGGGTGACTCTGG - Intronic
1064298105 10:14096705-14096727 TCTGCAGGAGTTGATGACTCAGG + Intronic
1066658803 10:37720173-37720195 TTTAAGGGAGTGGCTGCCTCTGG + Intergenic
1067196813 10:44127027-44127049 TCTGAAATATTGGCTTTCTCTGG - Intergenic
1067243607 10:44517485-44517507 TTTGAAGGAGTGGCTGCCGGAGG - Intergenic
1067297981 10:44985692-44985714 TCTGAAGGAGCAGGTGTCCCAGG + Intronic
1067702080 10:48580978-48581000 CTTGAAGGACTGGCTGTTTCAGG - Intronic
1069608157 10:69753245-69753267 TCAGGAGGAGTGACTGTTTCAGG - Intergenic
1069746789 10:70720159-70720181 TCTTAAAGGGTGACTGTCTCTGG - Intronic
1069816214 10:71196218-71196240 TCTTATGGAGGGGCTGCCTCAGG - Intergenic
1071510688 10:86260774-86260796 TCTGAATGAAGGGGTGTCTCTGG - Intronic
1073780006 10:106826846-106826868 TATGAGGGAATGGCTTTCTCTGG - Intronic
1074158776 10:110820322-110820344 TTTGGAGGAGTGGCTGTGCCTGG + Intronic
1076301750 10:129433600-129433622 GCTGCAGGACTGGCTGGCTCTGG - Intergenic
1076445212 10:130509626-130509648 TCTCAAGGACTCTCTGTCTCCGG + Intergenic
1078910952 11:15731305-15731327 TCTGAAGCAGAGGCTGGCTTTGG - Intergenic
1080322266 11:31024627-31024649 ACTGTTGGAGTGGCTGCCTCTGG - Intronic
1083971773 11:66081602-66081624 TCTGAAGCAGTGGCTGGGTCGGG + Intronic
1088720880 11:112590749-112590771 TCTGAGGGAGGGGCTGTCTGAGG + Intergenic
1090950435 11:131468200-131468222 TCTGATTGACTGGCTGGCTCAGG + Intronic
1091657088 12:2353721-2353743 TTTGAAGGGGAGGCTGTCTGGGG + Intronic
1100550398 12:95641583-95641605 TCTGAAGGCCTGTCTGCCTCAGG + Intergenic
1100695370 12:97086958-97086980 TTAGAAGGAGTGGCTCTCGCAGG + Intergenic
1103460036 12:121096322-121096344 TGTGCAGGTGGGGCTGTCTCTGG - Intergenic
1104407877 12:128533520-128533542 TCTGAGGGACTGTCTGTCCCAGG + Intronic
1104471643 12:129034372-129034394 TCTGAAGCAGAGGCTGCCTTGGG + Intergenic
1105882081 13:24614125-24614147 TAGGAAGGAGTGGGCGTCTCAGG + Intergenic
1109024634 13:57142521-57142543 TCTGCAGGAGGGGGTGACTCTGG - Exonic
1109025621 13:57149091-57149113 TCTGCAGGAGGGGGTGACTCTGG - Exonic
1109026611 13:57155664-57155686 TCTGCAGGAGGGGGTGACTCTGG - Exonic
1109027603 13:57162235-57162257 TCTGCAGGAGGGGGTGACTCTGG - Exonic
1109028589 13:57168800-57168822 TCTGCAGGAGGGGGTGACTCTGG - Exonic
1109855378 13:68120027-68120049 GCTGAGGGACTGTCTGTCTCAGG - Intergenic
1110704119 13:78585917-78585939 TCTGATTGAGTGACTGACTCGGG + Intergenic
1110947986 13:81447747-81447769 TCTGAAGGAGTGATTTTCTGAGG - Intergenic
1113431161 13:110251384-110251406 TGTGAAGGAGTGCCTGGCACAGG - Intronic
1115932814 14:38516594-38516616 TCTGGAGAAGTTGCTGCCTCTGG + Intergenic
1117911857 14:60644223-60644245 TCTGCAGGAGGGGCTCTCACAGG - Exonic
1121011021 14:90520447-90520469 TCTGTTGCAGTGGCTCTCTCTGG + Intergenic
1121249799 14:92490881-92490903 CCTGAAGGAGAGTCTGTCCCAGG + Intronic
1122094426 14:99361007-99361029 TCTGGAACAGTGGCTGTCTCGGG - Intergenic
1124876702 15:33601505-33601527 TCTGCAGGAGTAGGTTTCTCCGG - Exonic
1125646180 15:41274688-41274710 TCTGAAGAAGCTGCTGTCTGAGG + Intronic
1125958211 15:43805965-43805987 TCAGAATGAGACGCTGTCTCAGG - Intronic
1126016533 15:44356743-44356765 TCTGTAGTAGTGTCTTTCTCTGG - Intronic
1126050705 15:44682540-44682562 TCTGAAGAAGTCTCTCTCTCAGG - Intronic
1127956425 15:63857748-63857770 TCTGCTGGAGTGTCTGTGTCTGG - Intergenic
1128267053 15:66276063-66276085 ACTGAATGAGTGGTGGTCTCAGG + Intergenic
1128528748 15:68430517-68430539 TGGGAAGGAGTGGCTGCCTTAGG - Intronic
1129913625 15:79248310-79248332 TATGAAGGAGATGCTCTCTCTGG + Intergenic
1132233919 15:100205160-100205182 TCAGGAGGAGATGCTGTCTCTGG + Intronic
1132799674 16:1745832-1745854 TCTGAGTGAGTGGCCGTGTCCGG + Intronic
1134367446 16:13592422-13592444 TCTGAAGTAGGGGCAGTTTCTGG + Intergenic
1137711165 16:50567840-50567862 TGTTAAGGAGGGCCTGTCTCGGG + Intronic
1138121479 16:54403959-54403981 CCTGAAGGATGAGCTGTCTCAGG - Intergenic
1138629798 16:58284458-58284480 TTGGGATGAGTGGCTGTCTCTGG - Intronic
1140353129 16:74281518-74281540 GCTGTGGGAGTGGCTTTCTCTGG - Intergenic
1141035011 16:80619033-80619055 TCTGACGGAGAAGCTGTGTCAGG + Intronic
1143205071 17:5135680-5135702 TCTGAAGAAGAGGCTTCCTCAGG - Intronic
1147348428 17:39821177-39821199 TCTGAAGTAGGGGCGGTCTGTGG + Intronic
1147721023 17:42539435-42539457 CCTGAAGGAGGGGAGGTCTCAGG - Intronic
1148189153 17:45666781-45666803 TCTGGAGGAGGGGCTGCCACAGG - Intergenic
1149324441 17:55515701-55515723 TCTGAGGGAGGGTCTGTCCCAGG - Intergenic
1149779983 17:59389666-59389688 TCTAAAGGGGTGTGTGTCTCAGG - Intronic
1150968583 17:70000584-70000606 TCTCAAGTAGTGCCTGACTCAGG - Intergenic
1151821123 17:76497439-76497461 TCTGTAGGAGTGGCTGTGTCTGG - Intronic
1152111865 17:78361028-78361050 TCTGCGGGAATGGCTGTCTCCGG + Intergenic
1155434829 18:25801497-25801519 CATGGAGGAGGGGCTGTCTCAGG + Intergenic
1157409631 18:47452933-47452955 TCTGAAGTAGGGGCAGTCTTTGG + Intergenic
1158859071 18:61574425-61574447 TCTGAAGTGGTAACTGTCTCTGG - Intergenic
1159101540 18:63964144-63964166 TTTGAAGGTGTGGCTGCCACAGG - Intronic
1160177920 18:76611205-76611227 GCTGACGGAGTGGGTTTCTCTGG + Intergenic
1161115247 19:2493118-2493140 TCTGAGGAGGTGGGTGTCTCCGG - Intergenic
1163974656 19:20839470-20839492 TCTGAAGGAGTGTCATTGTCTGG - Intronic
1163984631 19:20934062-20934084 TCTGAAGGAGTGGCAATGCCTGG + Exonic
1164021477 19:21310567-21310589 TCTGGAGGAGTGGCAGTGCCTGG - Exonic
1164044953 19:21529696-21529718 TCTGGAGGAGTGGCAGTGCCTGG + Exonic
1164214620 19:23134118-23134140 TCTGGAGGAGTGGCAATGTCTGG + Exonic
1164253461 19:23505921-23505943 TCTGGAGGAGTGGCAGTACCTGG - Intergenic
1164296922 19:23919411-23919433 TCTGGAGGAGTGGCAGTGCCTGG + Exonic
1164715229 19:30385916-30385938 TCTGAAGGAGTGGCAGTGCCTGG + Intronic
1165551380 19:36589279-36589301 TCTGAAGGGATGGCAGTCTTGGG + Intronic
1166291725 19:41867921-41867943 TATGAAGGGCTGGCTGTATCTGG + Intronic
924994203 2:341837-341859 TCTGAAGGACTGAATGTATCTGG + Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
925738795 2:6987046-6987068 TCAGAACGCGTGGCTGTGTCTGG + Intronic
927574619 2:24190834-24190856 TCGGAAGGACAGGATGTCTCCGG - Exonic
928411899 2:31060770-31060792 TCTGCAGAATTGGCTGTCTTCGG - Intronic
931858007 2:66323991-66324013 GCAGAAGGAGTGGCTGCCACAGG + Intergenic
932705502 2:74021235-74021257 TCTGGAGGAGCTGCTTTCTCAGG + Intronic
932845749 2:75134405-75134427 TCTGAAGGAGTGGCTGTCTCTGG + Intronic
934283055 2:91628310-91628332 TCTGCAGGAGCTGCTCTCTCTGG + Intergenic
938179313 2:129165323-129165345 TCTGCATGAGTGGTTCTCTCTGG - Intergenic
944929121 2:204498366-204498388 TTTGAAGAAGTGGCTTTCTTTGG - Intergenic
945853045 2:215033054-215033076 TCTGGCAGAGTGGCTGTCTCAGG + Intronic
947412826 2:229859506-229859528 TCTGAAGTATTGGCTCTGTCTGG + Exonic
948928608 2:241116061-241116083 GCTGGAGGACTGGGTGTCTCTGG - Intronic
1169690898 20:8330613-8330635 TCTGAAGAAGTTGTTGGCTCAGG + Intronic
1170146526 20:13181127-13181149 TAGGCAGGAGTGGATGTCTCAGG + Intergenic
1170679799 20:18516146-18516168 TAAGAAGGAGTGGCTGGCCCAGG - Intronic
1171519294 20:25763865-25763887 TCTTCAGGTGGGGCTGTCTCAGG + Intronic
1175033360 20:55976606-55976628 TGGGAAAGAGTGGCTGTCTGAGG - Intergenic
1176653435 21:9570146-9570168 TCTTCAGGTGGGGCTGTCTCGGG + Intergenic
1179032146 21:37730044-37730066 CCTGAAGCAGTGGCTGCTTCAGG + Intronic
1179568544 21:42264272-42264294 TCTGAAGGAGGGGATAACTCAGG + Intronic
1181240560 22:21474680-21474702 CCTGGAGGAGAGGCTGTGTCAGG + Intergenic
1181520660 22:23447773-23447795 GCTGGAGCAGTGCCTGTCTCCGG - Intergenic
1183662733 22:39230969-39230991 TCTAGAGTAGAGGCTGTCTCAGG - Intronic
1184542040 22:45132562-45132584 TCTGAGAGAGTGGCAGACTCGGG + Intergenic
1184899070 22:47432928-47432950 TCTGGAGAAGTGGGTATCTCAGG + Intergenic
949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG + Intronic
950488263 3:13285498-13285520 ACTAAAGGAGTGGCTGGCTGAGG - Intergenic
957223987 3:77419052-77419074 TCTGAGGGAGTAACTGTCCCAGG + Intronic
960211726 3:114976333-114976355 TCTGAAGGACTGGCTGGGTGAGG + Intronic
961522783 3:127476876-127476898 TCTGCTCGAGGGGCTGTCTCCGG - Intergenic
961812040 3:129527624-129527646 TCTGAAGGGGAGGCTGGCCCTGG - Intergenic
961948224 3:130716395-130716417 TCTGAAGAAGTTGCTCTCACAGG - Exonic
962402950 3:135077272-135077294 TCTGCAGGAGTGGCAGTCTTGGG + Intronic
962619495 3:137163235-137163257 TCTTAAGGAGTTGCTTTCTAGGG + Intergenic
965135444 3:164760425-164760447 TCTGTAAGAGTGCCTGTCTTTGG - Intergenic
966819788 3:183915353-183915375 ACTGAAGGAGGGGCAGACTCAGG + Intergenic
968079519 3:195836328-195836350 TCTGAGGGGCTGGCTGTGTCTGG - Intergenic
968518058 4:1023139-1023161 AGTGAAGGAGCGGCTGTCACAGG + Intronic
968651982 4:1763792-1763814 CCTTCAGGAATGGCTGTCTCTGG + Intergenic
969689792 4:8698183-8698205 TCTGGAGCAGAGGCTGTCTGAGG - Intergenic
970200770 4:13602269-13602291 TCTGAAGAAGTGGTTGTGGCAGG + Exonic
972115443 4:35627394-35627416 TATGAAGGTGTTGCTGTCACTGG + Intergenic
973550673 4:52032820-52032842 TCTGAAGTTGTGACTGTCTGGGG - Intronic
982362686 4:154537971-154537993 TCTGATGGAGTGCTTGTATCTGG - Exonic
984609448 4:181821057-181821079 TGGGCAGGAGTGGCTCTCTCTGG - Intergenic
985426083 4:189831998-189832020 TCTGAAGCTGTGGTTGTCTGGGG + Intergenic
985917111 5:2930562-2930584 TCTGAAGGAGGGGCTCACTAGGG - Intergenic
988490442 5:31700986-31701008 GCTGAAGGACAGGCTGCCTCTGG + Intronic
991664998 5:68990735-68990757 TCTGAAGGTGTGGGTTTCTGAGG - Intergenic
993144981 5:84082498-84082520 ACAGAAGGAGTGGCTGCCTTTGG + Intronic
998060642 5:139116088-139116110 TCTGAAGGAGCACCTGACTCTGG - Intronic
998213637 5:140220620-140220642 TCTGCAGGGTTGGCTGTGTCAGG + Intronic
998784693 5:145696274-145696296 TGTCAAGCAGTGCCTGTCTCAGG - Intronic
998811825 5:145974209-145974231 TTTGAAGAAGTGGCTGTGTTAGG - Intronic
1001334120 5:170783713-170783735 TCAGATGGAGTGGCTCTCTGGGG - Exonic
1001874213 5:175185383-175185405 TCAGAAGGAGTGGCAAACTCAGG + Intergenic
1004637360 6:17481981-17482003 ACTGAGTGAGTGGCTTTCTCTGG + Intronic
1005245328 6:23877694-23877716 TTTAAAGGAGTGTGTGTCTCAGG + Intergenic
1006307786 6:33235055-33235077 TCTCAAGGAGGGGCTCTTTCAGG + Intergenic
1006972149 6:38057167-38057189 TCAGATGCAGTGGCTGTTTCTGG + Intronic
1011544045 6:88465270-88465292 ACGGAAGGAATGGATGTCTCTGG - Intergenic
1014827713 6:126065364-126065386 CCTGAAGGCGTGGCTCTCTGTGG - Intergenic
1018259421 6:161954804-161954826 TGTGAAGGAGAGGCTGAGTCTGG - Intronic
1018830972 6:167443336-167443358 TTTGAAACAGAGGCTGTCTCGGG - Intergenic
1021018017 7:15559801-15559823 TCAGAAAGAATAGCTGTCTCGGG - Intronic
1024042021 7:45563328-45563350 CCTGAAGTAGTGGCAGTCTATGG + Intergenic
1033468962 7:141626108-141626130 TGTGAAGGATTGGCTTTCGCAGG + Intronic
1035614067 8:989328-989350 CCTGAGGGAGGGGCTGTCTTCGG + Intergenic
1035933597 8:3811593-3811615 TCTGAAGGAGTGTGTGCCTGTGG - Intronic
1039618153 8:38973625-38973647 TATGAAGGACTGGCTGCCGCAGG - Exonic
1043859991 8:85304969-85304991 ACTGTGGGGGTGGCTGTCTCTGG - Intergenic
1049122421 8:140751059-140751081 TTTGAGGCAGTGTCTGTCTCGGG - Intronic
1049344150 8:142129476-142129498 TCTGCAGTAGTGACTGCCTCCGG + Intergenic
1049850887 8:144829516-144829538 TCGGGAGGAGTGGCAGTGTCTGG + Exonic
1053077722 9:35149121-35149143 TCTGGAGGAGTGGCATTGTCTGG - Intergenic
1055505397 9:76943067-76943089 TTTGAGGGACTGGCTGTGTCTGG + Intergenic
1057437649 9:95057130-95057152 TCTGAAGGAGCTGCTTTCTTAGG + Intronic
1058977598 9:110138848-110138870 TCTGAAGGAGAGGCTGTTTGTGG + Intronic
1059573903 9:115469637-115469659 TCTGTAGAAGTAGCTGTCTCAGG + Intergenic
1062123195 9:134845303-134845325 TCTGAAGGTGTGGTTCCCTCGGG + Intergenic
1203631155 Un_KI270750v1:73593-73615 TCTTCAGGTGGGGCTGTCTCGGG + Intergenic
1185863614 X:3603076-3603098 TCTTAACAAGAGGCTGTCTCGGG - Intergenic
1190424890 X:50325710-50325732 CCTGAAGGATTGGCTGTTTCTGG + Intronic
1191875134 X:65788087-65788109 TCTGGAGCAGAGGCTGGCTCCGG + Intergenic
1194125060 X:90007180-90007202 TCTGATGGTGTGGAGGTCTCAGG + Intergenic
1200064900 X:153499649-153499671 TCTGTGGGAGTGGCTGCCTGAGG - Intronic
1201678469 Y:16615580-16615602 CATGAATGAGTGGCTGACTCTGG + Intergenic