ID: 932848921

View in Genome Browser
Species Human (GRCh38)
Location 2:75164744-75164766
Sequence TCCTGGAAGGCTCTGTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932848921 Original CRISPR TCCTGGAAGGCTCTGTCATT TGG Intronic
900705949 1:4080291-4080313 TTCTGGAAGGCACTGTCAGGTGG - Intergenic
900823869 1:4910910-4910932 GCCTGGCAGGCTCTGTCCTGTGG + Intergenic
904596427 1:31648924-31648946 TCCTGGGAGGCTGTGTCTCTAGG - Intergenic
904919759 1:33997891-33997913 TTCTCGAAGCCTCTGTCATCAGG + Intronic
906279376 1:44542969-44542991 TCCTGGAGGGCCCTGTCTCTCGG + Intronic
907518176 1:55006519-55006541 TCCTGCCAGGCTCTGTTAGTTGG - Intronic
908334105 1:63102522-63102544 GCCTGCAAGGCTCTGTGACTTGG + Intergenic
912070759 1:105806630-105806652 TCCTGGCAGCATCTATCATTTGG + Intergenic
912712342 1:111958997-111959019 TCCTATATGGATCTGTCATTGGG - Intronic
915585900 1:156843772-156843794 CCCTGGAAGGATCTGACATCAGG + Intronic
915951955 1:160195457-160195479 TCCTCGAAGGCTTTGTAATCTGG - Exonic
916582683 1:166122851-166122873 TCCTGGAAGCCTCTGTTTTCAGG + Intronic
917220208 1:172720653-172720675 TTCTGGAGGGCTCTGCTATTGGG + Intergenic
917656892 1:177135458-177135480 TCCTCCATGCCTCTGTCATTTGG - Intronic
918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG + Intronic
919740926 1:200981205-200981227 TCCTTAAAGTCTCTGTTATTTGG - Intronic
920813923 1:209313303-209313325 TCCTTTAAAGCTCTTTCATTGGG - Intergenic
924064889 1:240210834-240210856 TCCAGGAAGCCTCAGTCATCAGG - Intronic
1064585245 10:16833470-16833492 TCCTGGAAAGCTCTCCCCTTTGG - Intronic
1067323049 10:45240457-45240479 TCCTGGAAAGCTCTCCCCTTTGG - Intergenic
1070355137 10:75632421-75632443 TCCTTGAAGGCTCTAACCTTTGG + Intronic
1070734280 10:78852689-78852711 TCCTTGAAGGCTGTGTGTTTGGG - Intergenic
1070991562 10:80737682-80737704 TCCTGGAAGACTGTGACATCAGG + Intergenic
1072031352 10:91525378-91525400 TCCTGGAAGGGTGTGACATTAGG + Intergenic
1072559824 10:96561557-96561579 TCATGGATTGCTCTGTCAGTTGG - Intronic
1072825604 10:98603272-98603294 TCCCGGAGGACTCAGTCATTGGG + Intronic
1074276534 10:112007653-112007675 TCCTACAAGGCACTGACATTTGG - Intergenic
1075604849 10:123797196-123797218 TCTTGGAAGCCTGTGTCTTTGGG - Intronic
1075686276 10:124367291-124367313 TCCTGAAATGCTCGGTCATTTGG - Intergenic
1076267023 10:129116784-129116806 GCCTGGAAAGCTCTGTATTTAGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1079020160 11:16903707-16903729 GCCTGGAGGACTCTGTAATTTGG - Intronic
1081873522 11:46393794-46393816 ACCAGAGAGGCTCTGTCATTGGG + Intergenic
1082819894 11:57537708-57537730 TCCTGGGAGGCTCTGGCCCTTGG - Intergenic
1083150900 11:60791142-60791164 GCCTGGGAGGCCCTGGCATTTGG + Intronic
1083237911 11:61363596-61363618 TCCTGGAAAGCTTTATCTTTAGG - Intronic
1083256297 11:61498080-61498102 TCCTGGTGGGCTCTGGCACTGGG + Intergenic
1084712263 11:70851163-70851185 TTCTGCAAGGCTCTGGTATTTGG - Intronic
1084766612 11:71313285-71313307 GCCAGAAAGGCTCTGTGATTTGG + Intergenic
1086970212 11:93073238-93073260 TCCTTGAAGGCTCAGAGATTAGG - Intergenic
1088290644 11:108233265-108233287 TCCTGAAAGTCTCTGTAAGTAGG + Intronic
1089700054 11:120239362-120239384 TCCAGCCAGGCTCTGTCACTAGG + Intronic
1090170797 11:124602394-124602416 TCCTGGATGGCTCACTCATGTGG - Intergenic
1093322503 12:17730843-17730865 TCCTGGGTGGCTTTTTCATTTGG - Intergenic
1093424391 12:19011523-19011545 TCCTAGAAGGCTCACTCATATGG - Intergenic
1094539566 12:31351893-31351915 TCCTTGAGGGCTTTATCATTTGG - Intergenic
1094583587 12:31756997-31757019 TCCTTGAAGGCTCAGAGATTAGG + Intergenic
1101762175 12:107667807-107667829 TCCTTGAAGGGTCTGTCGCTGGG - Intergenic
1102654830 12:114473291-114473313 TCCTGGAAGGGTCTCTTGTTTGG - Intergenic
1102690900 12:114760258-114760280 GCCTGATATGCTCTGTCATTTGG + Intergenic
1103913225 12:124363279-124363301 TCCTGGAAGGTTCTCTCAGCTGG - Intronic
1104212824 12:126706506-126706528 TTCTGTTGGGCTCTGTCATTAGG - Intergenic
1106986752 13:35361915-35361937 TCCTGAAAAGCTCTCTCATGTGG - Intronic
1111689517 13:91544906-91544928 TCCAGGAAGGCTCACTCATGTGG + Intronic
1112369906 13:98785275-98785297 TCCTTGAAGTCTGTGTCAGTTGG - Intergenic
1114348306 14:21821218-21821240 TCCAGGAAGGCTGAGTCATGGGG - Intergenic
1114463047 14:22900401-22900423 TGCTGGAAAGATCTGTCATTAGG + Intergenic
1115739403 14:36372478-36372500 TACTGGAAGGCCCTGTCCCTTGG - Intergenic
1118735824 14:68701298-68701320 GCCTGGAAGGCCCCGTCTTTGGG + Intronic
1118874753 14:69774258-69774280 TCCTGGGAGGCTAAGACATTAGG - Intergenic
1121880719 14:97498244-97498266 TGCAGGAAGGCTCATTCATTTGG + Intergenic
1122781263 14:104144547-104144569 CCCTGGAAGGATCTCTTATTTGG + Intronic
1123034873 14:105467774-105467796 TCCTGGGACGCCCTGCCATTAGG - Intronic
1123151046 14:106182125-106182147 TCCTTCATGGCTCTGTCATCAGG - Intergenic
1123461954 15:20480735-20480757 TCTTGGAAGACACTGTCATATGG + Intergenic
1123656102 15:22519651-22519673 TCTTGGAAGACACTGTCATATGG - Intergenic
1123680491 15:22759556-22759578 TCATGGAAGGCACTGTCATATGG - Intergenic
1124101838 15:26703070-26703092 TTCAGGAAGGCTCTGACATCAGG + Intronic
1124177870 15:27442899-27442921 CATTGGAAGGCTCTGGCATTGGG - Intronic
1124272640 15:28296724-28296746 TCTTGGAAGACACTGTCATATGG + Intronic
1124310012 15:28614823-28614845 TCTTGGAAGACACTGTCATATGG - Intergenic
1124332709 15:28834013-28834035 TCATGGAAGGCACTGTCATATGG - Intergenic
1127207995 15:56740407-56740429 TGCTGGTAGGCTCTGCCAATAGG + Intronic
1128211050 15:65902741-65902763 TCCTGTAATGCCCTGGCATTTGG + Intronic
1136705674 16:32186344-32186366 TCATGGAAGGCCCTATCATATGG + Intergenic
1136762239 16:32743065-32743087 TCATGGAAGGCCCTATCATATGG - Intergenic
1136805860 16:33127321-33127343 TCATGGAAGGCCCTATCATATGG + Intergenic
1138470058 16:57227337-57227359 TCCAGGAAGGCTACGGCATTGGG + Exonic
1138485557 16:57340833-57340855 TCCTGGAAGTCACTGTCACAGGG - Intergenic
1138583956 16:57958582-57958604 TCCTGGCAGGCTCTGCCTTTTGG - Intronic
1140395409 16:74622118-74622140 TCCTGGCTGGCTTTGTCTTTGGG - Exonic
1140826479 16:78711665-78711687 TTATGGAAGGTTCTTTCATTTGG - Intronic
1141759668 16:86019661-86019683 GCCTGGAAGGCGCTGTCCTGGGG - Intergenic
1203064396 16_KI270728v1_random:1003382-1003404 TCATGGAAGGCCCTATCATATGG - Intergenic
1143864678 17:9915446-9915468 TCCTGGTAGGATCTGTCCATGGG - Exonic
1145916985 17:28580038-28580060 CCCAGGAAGGTCCTGTCATTAGG + Exonic
1146001642 17:29133911-29133933 TCCTGGCAGGTTCTGGCCTTTGG - Intronic
1146458865 17:33028102-33028124 TCTGGGAAGACTCTGTTATTTGG - Intronic
1146789952 17:35745527-35745549 TCTTGGATGGCTTTGTCATAAGG + Exonic
1146972773 17:37086133-37086155 TCCTGGAAGCCTCCCTCATCAGG + Exonic
1148682700 17:49483847-49483869 TCCTTGAGGGCTCTGACCTTGGG - Intergenic
1149676356 17:58466329-58466351 TCTTGGAAGAATCTGTCATTTGG + Intronic
1151013104 17:70524733-70524755 TCCTCAATGGATCTGTCATTAGG + Intergenic
1153372117 18:4331004-4331026 TGATGTGAGGCTCTGTCATTAGG + Intronic
1156045083 18:32868993-32869015 TCCTGGTAGATGCTGTCATTTGG - Intergenic
1156312697 18:35939368-35939390 TCCAGTAAGGCTCTGTCAATAGG - Intergenic
1157157320 18:45280655-45280677 TCCTGGAGGCATTTGTCATTGGG + Intronic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460754 18:79036590-79036612 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460806 18:79036886-79036908 TCGTGGAAGGCTCTGAGATATGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460968 18:79037638-79037660 TCCTGGAAGGCTCTGAGATATGG - Intergenic
1163062024 19:14767800-14767822 CACAGGAAGGCTCTGTCCTTTGG - Intronic
1163062552 19:14771001-14771023 CACAGGAAGGCTCTGTCCTTTGG + Intronic
1164725047 19:30460643-30460665 ACATGGAAGGATATGTCATTTGG - Intronic
925792699 2:7508722-7508744 TCCTAAAAGCCTTTGTCATTAGG - Intergenic
930786168 2:55273464-55273486 TCGTAGAAGGCTCTTTAATTGGG - Intergenic
932024193 2:68116896-68116918 TCCTGGAAGGCAGTGTCACGTGG + Intergenic
932771591 2:74503511-74503533 CCCTGGAAGGCCCTGCCATTGGG - Intergenic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
933244440 2:79959550-79959572 TCCTGGAAGGCGCAATCCTTTGG + Intronic
933250386 2:80022857-80022879 TCCTTCAAGGCTTTGTCATTAGG - Intronic
935984533 2:108660023-108660045 GTCTGAAAGGCTCTGTCATAAGG - Intronic
936015822 2:108958443-108958465 TCCTGGAAGGCACTGCCCTGGGG - Intronic
936136969 2:109903671-109903693 GTCTGAAAGGCTCTGTCATAAGG - Intergenic
936207728 2:110467814-110467836 GTCTGAAAGGCTCTGTCATAAGG + Intronic
937111548 2:119370619-119370641 TCCTTCTAGGCTCTGTCATGGGG - Intronic
937471524 2:122177903-122177925 TCCTGGAAGGATCTATCTTTAGG + Intergenic
939036200 2:137134389-137134411 TTCTCGAAGGCTCTGTCAACAGG - Intronic
942869499 2:180717770-180717792 CCCAGGAAGGCTGAGTCATTAGG + Intergenic
943048525 2:182887893-182887915 TCAAGGAACTCTCTGTCATTTGG + Intergenic
943610413 2:190026647-190026669 TTCTGGTAGATTCTGTCATTTGG - Intronic
945175107 2:207036238-207036260 TCCTGGAAGTCTCTGGCAAAAGG - Intergenic
945581755 2:211603309-211603331 TCCTGTAAGTATCTGACATTGGG + Intronic
1169818945 20:9687976-9687998 TCCAGGAAGGCTCTGAGATGTGG + Intronic
1169859905 20:10140595-10140617 TGCTGGAAGGTTCTGGAATTAGG - Intergenic
1171180848 20:23089204-23089226 TCCTGGAAGGCTGTGTCCGCTGG + Intergenic
1172821828 20:37742760-37742782 ACCTGGAGGGGTCTGTCCTTAGG - Intronic
1173120927 20:40288195-40288217 TCATGGAAGGGTCTGTCCTGGGG - Intergenic
1173297428 20:41772033-41772055 ACCTGGGAGGCTCTGTTACTGGG + Intergenic
1175388580 20:58612436-58612458 TCCTGGAACTCTCTGCCCTTGGG - Intergenic
1178051465 21:28752574-28752596 AGCTGGAAGGGTCTGTCTTTAGG - Intergenic
1178475096 21:32931096-32931118 TCCTGGTAGTGTCTGTCATGGGG + Intergenic
1179929183 21:44555879-44555901 TCCTGGAAGCCTGTGACACTCGG + Intronic
1181646097 22:24232469-24232491 TCCTGGGAGGGCCTGTCAGTGGG + Intronic
1182748657 22:32624682-32624704 TGCTGGAAGGCACTGCCATGTGG + Intronic
1182793040 22:32968861-32968883 GTGTGGAGGGCTCTGTCATTAGG + Intronic
1183257322 22:36770893-36770915 TCCTGTTAGGCTCTGCCAATGGG + Intronic
949369675 3:3320797-3320819 TCCTGGACAGCTCTCTCAGTAGG + Intergenic
950152089 3:10695644-10695666 TCCTGGCGGGCTCTCTCACTTGG - Intronic
950719130 3:14870175-14870197 GCCTGGAAGGCTCTGCCCTAGGG - Intronic
951024153 3:17812604-17812626 TCCAAGAAGGCTCATTCATTTGG + Intronic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
953224899 3:41009858-41009880 TCCTGGTAGACTCTGGCACTAGG - Intergenic
953544692 3:43855842-43855864 CCCTGACAGGCTCTGCCATTAGG + Intergenic
955457159 3:59135901-59135923 GCCTGGAGGCCTTTGTCATTAGG - Intergenic
955857450 3:63288451-63288473 TCTTGGAATGCTCTCTGATTAGG + Intronic
958106563 3:89081316-89081338 TCCTGGAAGACTCTTCCCTTAGG + Intergenic
959532151 3:107445699-107445721 TCCAAGATGGCTCTGTCATGCGG - Intergenic
959798995 3:110467453-110467475 CCCTGGAAGACTCGGTCTTTTGG - Intergenic
961192696 3:124975418-124975440 TCCTGGAAGCCACTGAGATTGGG - Intronic
964379321 3:156081997-156082019 TTCTGCTAGACTCTGTCATTAGG + Intronic
964518330 3:157537025-157537047 TTTGGGTAGGCTCTGTCATTTGG + Intergenic
966510627 3:180758244-180758266 TCCTGTTAGGCTCTGCCAGTAGG - Intronic
969088976 4:4678627-4678649 CCTTAGAAGGCGCTGTCATTAGG - Intergenic
972339152 4:38136030-38136052 TCCTGGAGTGCTCTGTGACTTGG - Intronic
976953116 4:90858344-90858366 ACCTGGTACGCTCTGTCATGTGG - Intronic
977450377 4:97188686-97188708 CCCTTGAAGGCTTTGTCCTTTGG - Intronic
978052815 4:104223403-104223425 ACCTGCAAGGCCCTGTAATTTGG + Intergenic
981751381 4:148095488-148095510 TCCTGGCAGGCTCTCTGAGTGGG + Intronic
983460438 4:168019618-168019640 TCCTTGAGGGCTCTGTTTTTAGG - Intergenic
983797198 4:171879299-171879321 TTCTTAAAAGCTCTGTCATTTGG - Intronic
984214520 4:176893218-176893240 TCCTGTCAGGCTCTATTATTTGG - Intergenic
984339433 4:178436610-178436632 ACCTGCAAGGGTCTGTCATCAGG + Intergenic
985429544 4:189865889-189865911 TCCTAGTAGGCTTTGTAATTAGG - Intergenic
986359240 5:6960000-6960022 TCTTGGTTGGATCTGTCATTTGG + Intergenic
986391489 5:7291525-7291547 TCATGGAAGGCACTGTCATATGG - Intergenic
987871879 5:23629771-23629793 TTCTGGAAGGCTCTGCTTTTGGG + Intergenic
991223281 5:64240734-64240756 GCCTGGAAGGCTCTGCCCTGAGG + Intronic
991399023 5:66234539-66234561 TCATGGAAGGCTTTGTGCTTGGG + Intergenic
993412800 5:87593518-87593540 TCGTGTAGGGCTCTGGCATTGGG - Intergenic
995109267 5:108410703-108410725 TTCTGGGAGGCTCTGTTTTTAGG - Intergenic
996584830 5:125074689-125074711 TCCTGGAAGGTAGTGTCATGTGG + Intergenic
997023664 5:130032532-130032554 TCCTTGAAGACTCTCTCACTAGG - Intronic
998696920 5:144651510-144651532 TCCTGGAGGACTCTGTCTCTGGG - Intergenic
1000222151 5:159224469-159224491 ACCTGGAAGGCTCTGAAACTGGG - Intergenic
1002910420 6:1487126-1487148 ACTTGGAAAGCTCTGTCCTTAGG + Intergenic
1005519382 6:26585443-26585465 GCCTGGAAAGTTCAGTCATTAGG - Intergenic
1007070383 6:39032998-39033020 TCCTAGAAGGCTTTGGTATTTGG - Intergenic
1008819060 6:55609107-55609129 ATCTGCAAGGCTCTGTGATTGGG - Intergenic
1010720206 6:79274756-79274778 CCCAGGAAGGCTCTGTCACTAGG - Intergenic
1011411275 6:87069201-87069223 TCCTGGAAGGCAGTGTCACATGG - Intergenic
1013668247 6:112370080-112370102 TTCTGAATGGCTCTGTCTTTGGG - Intergenic
1015465965 6:133549048-133549070 TCTAGGAAGGCTCTGCCACTAGG + Intergenic
1016665161 6:146630883-146630905 TCCTGGATGGCTTATTCATTTGG + Intronic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1018596158 6:165482954-165482976 CCCTGGAAGGCTCTCCCACTGGG + Intronic
1019807645 7:3140011-3140033 TCCGGGAGGGCTCTGCCGTTCGG - Intergenic
1022137056 7:27458431-27458453 TCCCTGAAGCCTCTGTCATCTGG + Intergenic
1022441675 7:30438096-30438118 TCCTGGAAGACTGTGTCTTCAGG - Intronic
1023149566 7:37188836-37188858 TCATGGAAGGCTCAGTCATGGGG - Intronic
1023274515 7:38503386-38503408 TCCTGGAAATCTCTGGCATGTGG + Intronic
1024019510 7:45353140-45353162 TCCTGGAAGCCTGAGTCTTTTGG + Intergenic
1024518471 7:50282307-50282329 TTCTGGAAGGCCCTATCCTTGGG - Intergenic
1024883018 7:54111119-54111141 TCCAGGAGGGCTCTGTGAGTGGG + Intergenic
1030089309 7:105843412-105843434 TCCTAGATGGATCTGTCATGTGG - Intronic
1031196948 7:118627503-118627525 TCCTTGAAGGCTCAGACTTTGGG + Intergenic
1032262389 7:130347699-130347721 CCCTGGAAGGCTGTGTCACTTGG - Intronic
1032903905 7:136342636-136342658 TCCTGGAAGTATCTGCCATGGGG - Intergenic
1033479703 7:141727617-141727639 GGCTGGGAGGCTCTGTGATTAGG + Intronic
1035380522 7:158437593-158437615 TCTTGGAAGGCTCAGTCACCTGG + Intronic
1036171526 8:6490084-6490106 TCCTGGAGGTCTCAGTCATAAGG - Intronic
1036478349 8:9115305-9115327 TACTGGGAAGCTCTGTTATTTGG - Intronic
1036992205 8:13611042-13611064 TCCTGGAAAGCCCTCTCTTTAGG + Intergenic
1040037657 8:42886256-42886278 TGCTGCAGGGCTCTGTCCTTGGG - Intronic
1040106963 8:43546811-43546833 GCCAGGAAGGCTCTGGCCTTTGG + Intergenic
1041328132 8:56691473-56691495 TACTAGAAGGCTTTATCATTAGG + Intergenic
1041527194 8:58820427-58820449 ACCTGGAAGGATATGGCATTTGG - Intronic
1049966517 9:785031-785053 TCCTGGAATGCAGTGTCCTTAGG - Intergenic
1051348300 9:16172369-16172391 TCCTGGCAGACTCTGGCATGGGG - Intergenic
1053719791 9:40933969-40933991 GCCTGGAATGCTTTCTCATTAGG - Intergenic
1055989940 9:82094665-82094687 TCTTGAAAGGATGTGTCATTTGG + Intergenic
1057250062 9:93493877-93493899 TCCTGGAGCGCTCTCTCAGTGGG + Intronic
1061734805 9:132646956-132646978 TCCTGGACCGCTTTGTCCTTTGG + Exonic
1186645906 X:11507053-11507075 TCCTACAAGGCTCTGTGCTTAGG - Intronic
1187961723 X:24572338-24572360 TGCTGGAAGGTTCTGTGAATAGG + Intronic
1188187856 X:27137773-27137795 AATTGGAGGGCTCTGTCATTGGG + Intergenic
1189498152 X:41528749-41528771 TCCAGGGAGGCTCTCTCCTTAGG - Intronic
1189705402 X:43754643-43754665 TCGTGGTGGGGTCTGTCATTTGG - Intergenic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1195632950 X:107078674-107078696 TCATTGAAAGCTCTTTCATTTGG + Intronic
1199687384 X:150276459-150276481 TCCTAGAATTCTCTGACATTTGG - Intergenic
1200707726 Y:6457051-6457073 TTGTGGAGGGCTCTTTCATTGGG - Intergenic
1201026386 Y:9707657-9707679 TTGTGGAGGGCTCTTTCATTGGG + Intergenic