ID: 932850689

View in Genome Browser
Species Human (GRCh38)
Location 2:75181984-75182006
Sequence AGAGCTAGTCAGTTTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932850689 Original CRISPR AGAGCTAGTCAGTTTAGAGC TGG Intronic
901292669 1:8136415-8136437 AAAGCTCATCAGTTCAGAGCTGG - Intergenic
901748840 1:11393429-11393451 AGATCTAGGCAGTTCAGGGCTGG - Intergenic
904605191 1:31694374-31694396 AAAGCCAGGCAGTTTAGAGGAGG - Intronic
905515067 1:38556602-38556624 AGAGGTTGTCAGTTTGGAGTTGG + Intergenic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
911654195 1:100424341-100424363 AGAGCTGGACACTTTAGAGTTGG + Intronic
913572218 1:120131962-120131984 TGAGATAGTCAGTTTTCAGCTGG + Intergenic
914293138 1:146293606-146293628 TGAGATAGTCAGTTTTCAGCTGG + Intergenic
914554182 1:148744389-148744411 TGAGATAGTCAGTTTTCAGCTGG + Intergenic
914922733 1:151858651-151858673 AGTGCGAGTGAGTTTAGATCTGG - Intergenic
915475437 1:156150223-156150245 AGAGCTAGTCAGACTGGAGGAGG + Intronic
916744709 1:167676186-167676208 AGAACTAGTAAATGTAGAGCTGG + Intronic
917314987 1:173715084-173715106 TGAGCCAGTCACCTTAGAGCAGG + Intronic
923158297 1:231297176-231297198 AAAGCTAGGCAGTTTAGGCCAGG - Intergenic
1065215617 10:23445543-23445565 AGAGCAAGTCATTTTGGAGAAGG - Intergenic
1067847401 10:49735222-49735244 AGGGCAAGACATTTTAGAGCTGG - Exonic
1070089239 10:73268641-73268663 AGAGCTAGTTAGGGGAGAGCTGG + Intronic
1070646087 10:78203405-78203427 AGAGCTGGTCAGGGTAGAGCAGG - Intergenic
1073431993 10:103493148-103493170 AGAACCACTCAGTTCAGAGCTGG + Intergenic
1075610599 10:123851813-123851835 AGATGCAGTCAGCTTAGAGCAGG + Intronic
1077715638 11:4577390-4577412 GGAGCTACACAGTTTACAGCTGG + Intronic
1078021034 11:7656044-7656066 AGAGCTAGTGAAGTCAGAGCAGG - Intronic
1090347194 11:126081035-126081057 ACAGCGAGGCAGTTGAGAGCAGG - Intergenic
1092883569 12:12906679-12906701 ACAGGTAGCCAATTTAGAGCTGG + Intronic
1097983115 12:65754677-65754699 AGAACTGGTTAGTTTTGAGCGGG + Intergenic
1100853876 12:98741042-98741064 AGAGATAGGCAGTACAGAGCTGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103166165 12:118772554-118772576 AGGGCTTGTAAGTTTAGAGGAGG + Intergenic
1106008448 13:25794120-25794142 GGAGTTTGTGAGTTTAGAGCTGG + Intronic
1106293856 13:28391864-28391886 AGAGCGGGTCAGTTCAGGGCCGG - Intronic
1106589536 13:31087607-31087629 AGAGGTAATCAGTTAAGAGAAGG - Intergenic
1107783265 13:43927577-43927599 AGAGTAAGTCAGTTTATAGAAGG - Intergenic
1109062819 13:57640592-57640614 AGAGCTAGTGACCCTAGAGCGGG + Intronic
1109599517 13:64606406-64606428 AGAACTAGACAGTGGAGAGCTGG + Intergenic
1110946425 13:81426215-81426237 AGAGTTAGTTATTTTAGTGCAGG + Intergenic
1113513281 13:110872504-110872526 AGAGCTGGTCAGTGCAGAACTGG - Intergenic
1114480935 14:23034199-23034221 AGAGCTAGTTATTGCAGAGCTGG + Intronic
1115885774 14:37970161-37970183 AGAGCTAGTAAGATTAGAGAAGG - Intronic
1119360762 14:74047362-74047384 AGTGCAAGGCAGTTAAGAGCAGG - Intronic
1119389454 14:74281131-74281153 AGAGCAAGTCAGCTGAGAGGGGG - Intergenic
1119601554 14:75980340-75980362 AGAGCCATTCTGTTAAGAGCCGG - Intronic
1122028910 14:98898440-98898462 AGAGCCAGGCAGTGTGGAGCTGG - Intergenic
1122542974 14:102508155-102508177 AGAGCAAGTCAGTTTCAAGGAGG - Intronic
1125787081 15:42328785-42328807 AGAACTGTTCAGTTTAGAGTGGG - Intronic
1125991605 15:44114437-44114459 AGATCTTGTCAGTTTAGGTCTGG - Intronic
1128428825 15:67571762-67571784 ACAGCTAGTCAATAGAGAGCTGG + Intronic
1130300988 15:82679943-82679965 AGAGCTAGTCAGATCTGAGATGG - Intronic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1134399475 16:13896055-13896077 AGAGGCAGGCAGTCTAGAGCTGG - Intergenic
1134399554 16:13896835-13896857 AGAGGCAGGCAGTCTAGAGCTGG - Intergenic
1135465139 16:22678400-22678422 AGAGGTATGCAGTTTAGAGCTGG + Intergenic
1137310339 16:47250771-47250793 AGAGCTAATTAGTGTTGAGCAGG + Intronic
1139269401 16:65667738-65667760 AGAGATGGTCAGTGTAGAGAGGG - Intergenic
1142676784 17:1518393-1518415 AGTGCTAGTCAGTTTGGAGGTGG + Exonic
1143004139 17:3816445-3816467 AGAACCAGTCTCTTTAGAGCAGG - Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1149569170 17:57660350-57660372 AGAGCCATTCGGTTTAGAGGGGG - Intronic
1152118829 17:78405709-78405731 GGAGCTAGTCTGTCTAGAGAAGG + Intronic
1153396571 18:4628505-4628527 AGACCTTATCAGTTTACAGCAGG + Intergenic
1153658215 18:7304192-7304214 AGAGCTACACAGTTCAGAACTGG - Intergenic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1165785630 19:38460151-38460173 AGAGCCAGGGAGTTGAGAGCGGG - Intronic
925896250 2:8474479-8474501 AGAGCTAATCACTGTATAGCAGG - Intergenic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929002159 2:37357947-37357969 AGATCTAGACAGTTTAGATCTGG - Intronic
929655279 2:43724953-43724975 AGACAGAGTGAGTTTAGAGCAGG + Intronic
930677432 2:54218667-54218689 AGAGGTAGTCAGTCTAGGGGTGG + Intronic
931170358 2:59796915-59796937 ATAGCTACTCAGCCTAGAGCAGG - Intergenic
932133026 2:69204630-69204652 AGAGCCAGGCAGTGTCGAGCTGG - Intronic
932850689 2:75181984-75182006 AGAGCTAGTCAGTTTAGAGCTGG + Intronic
935658183 2:105442872-105442894 AGAGTGAGTCAGTGTGGAGCAGG - Intergenic
936856218 2:116960635-116960657 AGAGCTAGACTGGTTATAGCTGG + Intergenic
939469237 2:142598617-142598639 AGAAGTAGTCAGTCTAGAGTAGG + Intergenic
944787067 2:203082727-203082749 AGGGTTAGGCAGTTTTGAGCTGG + Intronic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
1169776192 20:9256216-9256238 AGAGGTAGGCAGTCCAGAGCTGG + Intronic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173293199 20:41732542-41732564 AGAGGTTGTCAGGTTAGTGCAGG + Intergenic
1181257899 22:21575930-21575952 AGAGCTATTCAATTTTAAGCTGG - Intronic
1184715273 22:46278427-46278449 AGAGGTAATAAGTTTAGAGGAGG - Intronic
951053811 3:18124355-18124377 TGAGCAAGCCAGTTTAGATCTGG - Intronic
951100200 3:18678601-18678623 AGAGCTAGTAAGTGTGGAACTGG + Intergenic
952792512 3:37211551-37211573 AGATCTGGGCAGTTTAGACCTGG + Intergenic
955544872 3:60017680-60017702 AGAGATAGTCAGTTCTGGGCTGG - Intronic
955639974 3:61072079-61072101 AGAGCTAGAAAGTAAAGAGCTGG - Intronic
957290665 3:78273762-78273784 TGGGCTAGTGAGTTTAGAGAAGG - Intergenic
957426190 3:80043148-80043170 ACAGGGAGTCAGTTTACAGCAGG - Intergenic
959107168 3:102077656-102077678 ACAGCAAGTCATTTTAAAGCAGG - Intergenic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
962010287 3:131384878-131384900 TGAGATGGTCAGTTTAGAGTAGG + Intronic
968135904 3:196219379-196219401 AGAGGTAGTCAGTATGCAGCAGG - Intronic
979740984 4:124150825-124150847 AGAGCTGGCCACTTCAGAGCTGG - Intergenic
981714115 4:147735737-147735759 AGAGCCAGTCATTTTAGTGGTGG + Intronic
983815637 4:172122902-172122924 GGATCTAGTCAGTTTATAGTAGG + Intronic
986977747 5:13412160-13412182 ATAGCTAGTCAGGTATGAGCAGG + Intergenic
988616835 5:32782778-32782800 AGAGGCAGCCAGTTTAGATCAGG + Intronic
988637120 5:32996396-32996418 AGCCCTCGTGAGTTTAGAGCTGG - Intergenic
988724267 5:33910131-33910153 AGAGGTATTCAGTTTAGAGAAGG + Intergenic
989191021 5:38669807-38669829 AGAGCTAGTGAGTTTTGGTCAGG + Intergenic
989749910 5:44881025-44881047 AGAACTTGTAAGTATAGAGCTGG + Intergenic
990161508 5:52944871-52944893 AGAGCTAGTCATGTTTGAGTAGG - Intronic
990967855 5:61469063-61469085 AAAGCTAGTCAAATTAGAGATGG + Intronic
991684663 5:69170614-69170636 AGAGTGAGTCAGTTTAAAGTTGG - Intronic
992793972 5:80239016-80239038 ACAGCTAGTCAGCTCACAGCAGG - Intronic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
997845942 5:137286040-137286062 AGATGTAGTCTGTTTAGAGCAGG - Intronic
1001159734 5:169302030-169302052 AGACCTAGCCAATTTAAAGCGGG - Intergenic
1001434390 5:171687881-171687903 AGAGCTAGAGAATTTGGAGCTGG - Intergenic
1007211391 6:40195774-40195796 GGAGCTAGTCAGGTAAGGGCTGG + Intergenic
1007888793 6:45264622-45264644 AGGGCTAGACAGTTTAGGGTTGG - Intronic
1010710334 6:79166794-79166816 AGAGCTAGTCAGTTTAGAAGAGG + Intergenic
1010850736 6:80773565-80773587 AAAAATACTCAGTTTAGAGCTGG + Intergenic
1010863659 6:80945106-80945128 AGAGCTAGTCAGTTTGGCTTTGG + Intergenic
1011963192 6:93117314-93117336 AGAGCTAGTCTTTTTTGAGGGGG - Intergenic
1013912367 6:115292230-115292252 AGAGCTAATTAGTGTAGAGTTGG + Intergenic
1016327795 6:142922712-142922734 AGAGGCAGTCAGTATAGAGTGGG - Intronic
1018031358 6:159844557-159844579 AGAGCCAGTGAGTCTGGAGCCGG + Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1020962485 7:14822740-14822762 AGAGCTAGTGAGTTGATAGAAGG + Intronic
1022502156 7:30888438-30888460 ACAGCCAGCCAGTTTATAGCCGG - Intronic
1023102644 7:36734759-36734781 AGAGCTGGACACTTCAGAGCTGG + Intergenic
1025865212 7:65374630-65374652 AGAGATTGTCAGTTTATAGTTGG + Intronic
1032991482 7:137399504-137399526 AGACCTAGTCTATATAGAGCTGG - Intronic
1034472537 7:151263127-151263149 AGAGCTAGTAGGGGTAGAGCTGG + Intronic
1037468174 8:19181538-19181560 AGAGCTCTTCCGTTTTGAGCAGG + Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042838719 8:73102123-73102145 AGTGCTAGACAGTTCAGAGGAGG - Intronic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044920316 8:97163133-97163155 TGAGGTAGTCAGTCCAGAGCTGG - Intergenic
1045261677 8:100580730-100580752 AGAGGTAGGCAGTCTAGGGCTGG - Intronic
1046663574 8:116975278-116975300 AGAGCTAAGCAGTCTAAAGCTGG - Intronic
1048174775 8:132141596-132141618 TGAGCTAGGCAATTTATAGCGGG - Intronic
1051369467 9:16345934-16345956 AGAGCTACTCAGTACACAGCTGG - Intergenic
1054830355 9:69618148-69618170 CGAGCTAGTCATTTTAGTACAGG + Intronic
1055111236 9:72561702-72561724 AGAGGTAGTGAGTTCAGAACTGG + Intronic
1056225197 9:84488407-84488429 ATAGCTAGTGAATGTAGAGCTGG - Intergenic
1057714457 9:97479980-97480002 AGAGGAGGTCACTTTAGAGCAGG - Intronic
1059591715 9:115669448-115669470 AGAGCTAGTCAGGTATGAGTAGG - Intergenic
1188624658 X:32268869-32268891 ATAGCTAGTCAGATATGAGCAGG + Intronic
1192198624 X:69049133-69049155 AAAGTTACTCAGTTTAGAGTTGG + Intergenic
1193146003 X:78076269-78076291 AGAGTGAGTCAGGGTAGAGCAGG + Intronic
1196198387 X:112858776-112858798 GGAGCTACTCATTTTATAGCAGG + Intergenic
1197093534 X:122567576-122567598 AGAGGTAGTCATTACAGAGCAGG + Intergenic