ID: 932851760

View in Genome Browser
Species Human (GRCh38)
Location 2:75194427-75194449
Sequence TTCCCTCACCCCACCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932851760_932851764 22 Left 932851760 2:75194427-75194449 CCCCTCCAGGTGGGGTGAGGGAA 0: 1
1: 0
2: 1
3: 22
4: 248
Right 932851764 2:75194472-75194494 AGATTGCAGTTCAACCAACAAGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932851760 Original CRISPR TTCCCTCACCCCACCTGGAG GGG (reversed) Intronic
900394203 1:2446471-2446493 CTCCCTCCCCCCAGCTGCAGGGG + Intronic
900499540 1:2994713-2994735 CTCCCTCACCTAACATGGAGAGG - Intergenic
900519431 1:3098484-3098506 GTCCCTCTCCCCAGCTGGATGGG - Intronic
900772967 1:4560559-4560581 AGCCCTCACTCCACCTTGAGAGG - Intergenic
901882335 1:12201611-12201633 TTCCTTCACCCCATCTGCACAGG - Intronic
902055450 1:13596815-13596837 TTCCCTCAGTCAACCTGAAGTGG - Intronic
904834178 1:33324338-33324360 TTCTCTCTCTCCACCTGCAGAGG + Exonic
906514973 1:46433572-46433594 GCCCCTCACCCCAGCTGGAAGGG + Intergenic
907425117 1:54374669-54374691 ATCCCCCACCCCACCTGGCAGGG + Intronic
908511621 1:64854233-64854255 AACCCTCACACCACCAGGAGTGG - Intronic
908907937 1:69037946-69037968 TTCCCTCACCTCTCCTGAAGAGG - Intergenic
909026479 1:70487478-70487500 TTCCCTGACTGCAGCTGGAGGGG - Intergenic
909358075 1:74732138-74732160 TTCCCACAGCCCAGCTGTAGGGG - Intronic
909358151 1:74732437-74732459 TTCCCACAGCCCAGCTGTAGGGG - Intronic
910408266 1:86913737-86913759 TTCCCCCCTCCCACCTGGTGTGG + Intronic
912238034 1:107873865-107873887 TTCCCCCACCCCAGGTAGAGTGG + Intronic
912522147 1:110253004-110253026 TTCCCTCACCCCATATTTAGTGG + Intronic
912864674 1:113246626-113246648 TTCCCTCCCCTCTGCTGGAGTGG + Intergenic
915013886 1:152715071-152715093 TTCCCTCTCCCCAAAGGGAGGGG - Intergenic
917276987 1:173341500-173341522 TTACCTCATCCCACTTGGGGAGG - Intergenic
920133427 1:203750632-203750654 TTCTGTCACTCCAGCTGGAGTGG - Intergenic
920726022 1:208435951-208435973 GTCCCTCACCCAAACTGGGGAGG - Intergenic
921487082 1:215727688-215727710 TTCTGTCACCCAAACTGGAGTGG - Intronic
1066649772 10:37643258-37643280 TTCCCTCTCCCCTCCTTAAGTGG + Intergenic
1067032661 10:42888803-42888825 TTCCCTCTCCCCTCCTTAAGTGG + Intergenic
1067564389 10:47326227-47326249 TTCCCACAACCCAGTTGGAGGGG + Exonic
1067676534 10:48384343-48384365 TTACCTCACTGTACCTGGAGAGG - Intronic
1070935750 10:80293661-80293683 TGCCCCAACCCCACCTGGGGAGG + Intergenic
1074273393 10:111977284-111977306 TTGCCTCAGCACACCTGGACAGG - Intergenic
1074699822 10:116083215-116083237 TTACTTCACCCTACTTGGAGGGG + Intronic
1075523379 10:123159856-123159878 CTCCCTCACCCTTCCTGGAAAGG + Intronic
1076590734 10:131580414-131580436 TTCCCTCACACCACTTAGGGTGG - Intergenic
1076762310 10:132611712-132611734 CTCCCTCACCCTCCCTGGACAGG - Intronic
1077197563 11:1288975-1288997 TTCCCTCTCTCCACCAGGATGGG + Intronic
1083299844 11:61734605-61734627 TTCCCTCTCCCCACCTGGCTGGG - Intronic
1083503918 11:63137525-63137547 TTATCTCTCCCCACCTGGAGTGG + Intronic
1084145323 11:67262063-67262085 TTCCCTGACTTCACCTGAAGAGG + Intergenic
1084950143 11:72660487-72660509 TGCTCTCACGCAACCTGGAGAGG + Intronic
1084966870 11:72749591-72749613 TTCCCTCTCCCAGCCGGGAGTGG + Intronic
1085032477 11:73281141-73281163 TCCTCTAATCCCACCTGGAGAGG - Intronic
1085164716 11:74387878-74387900 TTCCCAGACCCCACCTTTAGAGG + Intronic
1087971608 11:104491221-104491243 TGATCTCTCCCCACCTGGAGTGG + Intergenic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1090266530 11:125356725-125356747 TCCCCTGGCCCCACCTGGAGTGG - Intronic
1091393752 12:141320-141342 TTCCCACACCCCACCTGCCCGGG + Intronic
1093101652 12:15036373-15036395 TTGTCTCTCCCCACCTTGAGTGG - Intergenic
1094766815 12:33605977-33605999 TTTCTTCACTCCACCAGGAGAGG - Intergenic
1096484690 12:51971003-51971025 CTCCCACACCCCTCCTGGTGAGG + Intronic
1096796491 12:54081282-54081304 TTCTCTCCCACAACCTGGAGGGG + Intergenic
1099271149 12:80512843-80512865 TTCCCTCACCCCACTTTCATTGG - Intronic
1101329672 12:103747456-103747478 TTCACTCACCTCACCTGAGGTGG + Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103240235 12:119407127-119407149 TACACACACCCCACCTGGATGGG - Intronic
1104400383 12:128471229-128471251 TCCCCCAACTCCACCTGGAGGGG - Intronic
1104991115 12:132624368-132624390 TTCCTGCACCACACCTGGTGGGG - Exonic
1106687869 13:32080713-32080735 TTCCCTCCCTCCACCAGGGGAGG - Intronic
1108673111 13:52711578-52711600 TTGCCTCACCCAGGCTGGAGAGG + Intronic
1108879292 13:55089587-55089609 CTCTGTCACCCAACCTGGAGTGG + Intergenic
1109204619 13:59467340-59467362 TTCCCTTACCCCCCTTGCAGAGG - Intergenic
1111270244 13:85872395-85872417 TTCTCACACCCCACCAGGACTGG + Intergenic
1111358364 13:87141083-87141105 TTACCTTACCCCAGCTGGAATGG - Intergenic
1112808947 13:103195142-103195164 TTCCCTCACCCACCCTGTGGAGG + Intergenic
1112940374 13:104854538-104854560 TTCCCTCACCTCTCCTCAAGTGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113697012 13:112354130-112354152 TTCCAGGACCCCACCTGGATGGG - Intergenic
1114777973 14:25506836-25506858 TTCCTTGACCTCACCTGGTGAGG - Intergenic
1116574620 14:46557323-46557345 TACAGTCACACCACCTGGAGAGG - Intergenic
1118849731 14:69574217-69574239 ATCCATCACCCCTCCCGGAGAGG - Intronic
1119611820 14:76069858-76069880 ATGCCTCACCCCCACTGGAGAGG + Intronic
1121329362 14:93040413-93040435 TTGCCACTCCCCACCTGCAGAGG + Intronic
1121422530 14:93825265-93825287 TTCCACCACCCCCCCGGGAGCGG - Intergenic
1122272025 14:100572569-100572591 TGCCCTTACCCCTCCTGGAGGGG + Intronic
1122345177 14:101054129-101054151 TTCACTCACCTCCCTTGGAGTGG - Intergenic
1122488563 14:102097638-102097660 TTAACCCACCCCACCTCGAGGGG - Intronic
1123667188 15:22617209-22617231 TTCCCTCCCCCATCGTGGAGCGG - Intergenic
1123727847 15:23122765-23122787 CTCTGTCACCCCAACTGGAGTGG + Intergenic
1123788400 15:23695118-23695140 TGCCCTGATCCCACATGGAGAGG - Intergenic
1124956341 15:34362917-34362939 TTCCCACTCCCCACCTGGGTTGG - Intronic
1126376476 15:48001905-48001927 TGCTCTAACTCCACCTGGAGGGG - Intergenic
1128782085 15:70366700-70366722 TTACCTCACCCCAGCTAGAATGG + Intergenic
1128870295 15:71150071-71150093 TTCCCCCACGCCACTTGGAAAGG + Intronic
1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG + Intergenic
1129335187 15:74847841-74847863 TTCCCTCACCTCCCCTGGACAGG - Intronic
1130484003 15:84387413-84387435 TTCCCTCCCACAACATGGAGCGG + Intergenic
1130996620 15:88907826-88907848 TCCCCTCCCCCCACCAGGAAGGG + Intronic
1131959482 15:97773559-97773581 TTCCCTCACCTCAAGTGGAAGGG + Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132228746 15:100165755-100165777 TTCCCTCATATCACCTGGGGAGG - Intronic
1132349908 15:101133203-101133225 TCCCCTCACCCCGCCTCAAGGGG - Intergenic
1132513940 16:357451-357473 TTCTCTCACCCAGACTGGAGTGG - Intergenic
1132677931 16:1128365-1128387 GTCCCTCCCCCCACCTGAATCGG - Intergenic
1132849008 16:2015836-2015858 TTCCTTCTCCCCACCTCCAGGGG - Intronic
1132887880 16:2190400-2190422 TGCCCTCAGGCCGCCTGGAGGGG - Intronic
1134018957 16:10908141-10908163 GCCCCTCACCCCACCTGAAACGG - Exonic
1134263682 16:12674532-12674554 TCCTTTCACTCCACCTGGAGCGG - Intronic
1134749720 16:16616254-16616276 TTCTGTCACCCAAGCTGGAGTGG - Intergenic
1134995750 16:18737370-18737392 TTCTGTCACCCAAGCTGGAGTGG + Intergenic
1136552718 16:30990125-30990147 ACCACTCCCCCCACCTGGAGTGG - Exonic
1137359528 16:47800857-47800879 CTCTATCACCCCAGCTGGAGTGG + Intergenic
1137633554 16:49965938-49965960 TTCTCCCCCTCCACCTGGAGTGG - Intergenic
1138099373 16:54239989-54240011 TCCCCTTACCCCAACTGGAGGGG - Intergenic
1138656571 16:58495055-58495077 GCCCCTCACCCCACCTGGCCAGG + Intronic
1139761365 16:69187122-69187144 TTCCCTCTTCCCGCCCGGAGGGG - Exonic
1139841709 16:69886723-69886745 CTCCGTCACCCAAGCTGGAGTGG - Intronic
1139954022 16:70684951-70684973 ATTCCTCACCCCACCAGGTGGGG - Intronic
1140122649 16:72096854-72096876 TTCGCTCACACCACCCGGATGGG - Exonic
1142670601 17:1485886-1485908 TCCACCAACCCCACCTGGAGGGG - Intronic
1142831440 17:2552067-2552089 GCCCCTCACCCCACCTGGACAGG - Intergenic
1143193206 17:5055723-5055745 TTCCTTCTCCTCACCTAGAGTGG + Intergenic
1143447908 17:7019687-7019709 ATTCCTCACCCCATCTAGAGGGG + Intergenic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1144767351 17:17739969-17739991 CTCCCTCTCCCCACTGGGAGTGG + Intronic
1147418380 17:40309602-40309624 TTCCCCCACCTCACCTAGACTGG + Intronic
1147424426 17:40339260-40339282 GTCCCCAACCCCATCTGGAGGGG - Intronic
1147990741 17:44331355-44331377 ACCCCCCACCCCACCTGGATAGG - Intergenic
1149612235 17:57966001-57966023 CTCCCTCATCCCACCTGGCTAGG + Intergenic
1149658488 17:58322763-58322785 TTCTCCCACTCCACCTGGCGAGG + Exonic
1151155487 17:72121178-72121200 TCGCCTCCCCCCACTTGGAGCGG + Exonic
1151498857 17:74475984-74476006 CTCCCTGATTCCACCTGGAGAGG - Intronic
1151694117 17:75705434-75705456 TTCCCTCACCCCAAGCAGAGGGG + Intronic
1151957166 17:77386228-77386250 TGCCCCCACCCCTCCTGCAGAGG + Intronic
1154038467 18:10830978-10831000 TTATCTCACCCCAGCTGAAGTGG + Intronic
1154389561 18:13924669-13924691 CTCCCTGACCCCACCTTGAGAGG + Intergenic
1155767395 18:29652761-29652783 TTCCCTCTCCTCTCCTGAAGTGG - Intergenic
1156405599 18:36779590-36779612 CTCCCCAACCCCACCTGGAGGGG - Intronic
1156492375 18:37503886-37503908 TTCCCTGACCCCATCTGGAGTGG + Intronic
1159123181 18:64193508-64193530 TTCCTTCAGTCCAACTGGAGCGG + Intergenic
1163414320 19:17176732-17176754 TTCCCCCATCCTGCCTGGAGTGG + Intronic
1163645914 19:18488998-18489020 TTCCGTCATCCCACCTGCAGGGG + Intronic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
1166265644 19:41682624-41682646 TGCCCTGACTCCACCTGGGGTGG - Intronic
1166414882 19:42588252-42588274 TGCCCTGACTCCACCTGGGGTGG - Intronic
1167162649 19:47778298-47778320 GTCCCTCACCTCCCCTGGAGAGG - Intergenic
1168348763 19:55663806-55663828 TCCCTTCAGCCCAGCTGGAGTGG + Intronic
1168615487 19:57833924-57833946 TTCCCTCTCCTCTCCTCGAGTGG + Intronic
1168621298 19:57881523-57881545 TTCCCTCTCCTCTCCTCGAGTGG - Intronic
925639234 2:5971534-5971556 TTCCCTGGCCTCACCTGCAGGGG + Intergenic
925714204 2:6770163-6770185 CTCCCTGACCCCTCCTGCAGGGG - Intergenic
925880838 2:8351008-8351030 TTCTGTGACCACACCTGGAGTGG + Intergenic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
928703742 2:33925642-33925664 TTCTCTCATGCCACCAGGAGGGG + Intergenic
928907024 2:36379337-36379359 TTCTCTCACCCAAACTGAAGTGG + Intronic
932214545 2:69958470-69958492 TTCCCACACACCACACGGAGTGG - Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
933339509 2:81004470-81004492 TTCCCTCTCCTTTCCTGGAGTGG + Intergenic
933522568 2:83391829-83391851 TTCCATCACCCAGGCTGGAGTGG - Intergenic
934035868 2:88088126-88088148 TTCCCTCCTCCCACTTGGGGAGG + Intronic
934746947 2:96765518-96765540 GACCCTCACCCAACCTGGGGTGG - Intronic
935552675 2:104474946-104474968 TTCCAACAGTCCACCTGGAGAGG + Intergenic
936937239 2:117850199-117850221 TCCCCTCACCCCTCCTGATGAGG + Intergenic
937141515 2:119605855-119605877 CTCTGTCACCCCAGCTGGAGTGG + Intronic
937979931 2:127608904-127608926 TTCCCTGTCCCCACCCGGGGCGG - Intronic
940483010 2:154259910-154259932 TTCCATCACCCAGGCTGGAGTGG + Intronic
942664840 2:178306538-178306560 TTTCCTCCCTGCACCTGGAGGGG + Intronic
946171630 2:217899160-217899182 TCTCCACACCCCACCTGGACTGG - Intronic
946320766 2:218953263-218953285 AGCCCTCAGCCCACCTGCAGGGG - Intergenic
947131466 2:226930942-226930964 CTACCTTACCCCAACTGGAGTGG + Intronic
947843478 2:233224837-233224859 GTCCCACACCCCACCTCAAGTGG + Intronic
1169448972 20:5695339-5695361 TACCCTCACCCCACATGGAATGG + Intergenic
1171035227 20:21708374-21708396 TTCCTCCGCCCCACCCGGAGTGG + Intronic
1172772949 20:37392217-37392239 TTGCCTCACTCCATCAGGAGGGG + Intronic
1172948432 20:38706166-38706188 CTCCCCCACCCCACCCTGAGAGG - Intergenic
1175789296 20:61731511-61731533 CTGCTTCACCCCACCTGGGGGGG - Intronic
1175814986 20:61878612-61878634 TTCCCTCCCCAGACATGGAGAGG + Intronic
1180948017 22:19707538-19707560 CTCCCTCACCCCACCTGCCGTGG + Intergenic
1182228480 22:28818528-28818550 TTTCCTCACCCCACTTGGCGTGG + Intergenic
1182382426 22:29903188-29903210 TTCTGTCACCCAAGCTGGAGTGG - Intronic
1182909586 22:33971013-33971035 TTCCCTAACCCCATCATGAGCGG - Intergenic
1183049065 22:35246117-35246139 TTCCCTGACACCACCTGGGATGG + Intergenic
1183331214 22:37222670-37222692 GTGGCTCACCCCACTTGGAGTGG + Intergenic
1184696616 22:46142987-46143009 CTCCCTCATCACACCAGGAGGGG - Intergenic
1184978858 22:48081858-48081880 TTCCCTCTCCCTGCTTGGAGAGG - Intergenic
950531745 3:13556305-13556327 TTCCCACCCCCCACCTTGTGAGG - Intronic
951112223 3:18817727-18817749 TTCCCTCTCCCCTCTTGTAGTGG + Intergenic
951739144 3:25900503-25900525 TTCACCCACACCACATGGAGAGG - Intergenic
954782019 3:53068675-53068697 TCCCTTTGCCCCACCTGGAGAGG - Intronic
955661370 3:61302925-61302947 ATGCCTCACCCCACCTGGGATGG - Intergenic
959974854 3:112447378-112447400 TTCCATCACTGCACCTGGAATGG + Intergenic
961452138 3:127007069-127007091 ATCCCCCACCCCACCTGGGACGG - Intronic
961621753 3:128229846-128229868 CTCCCGCACCCCATTTGGAGGGG - Intronic
961825382 3:129596543-129596565 TTCCCTCCCCCCAGCAGGAGGGG + Intronic
962505470 3:136042333-136042355 TTCCCTCACCCCACCCCAACAGG - Intronic
962708702 3:138068111-138068133 CCCTCTCACCCCACCTGCAGTGG - Intronic
963188874 3:142447470-142447492 TTCCCCCATCCCACCCAGAGCGG - Intronic
965287506 3:166835671-166835693 TTTCCCCACCCAACCTGGAGTGG - Intergenic
965858338 3:173116231-173116253 TTCCCTCTAACCACCTGGTGAGG - Intronic
966201028 3:177359702-177359724 TTCCCTCCCCCACCCTGCAGGGG - Intergenic
966468207 3:180256227-180256249 TTCCCTCTCCTCACCTCAAGTGG - Intergenic
968230340 3:197002063-197002085 CACCTTCACCCCACCGGGAGGGG - Exonic
972532932 4:39977165-39977187 CTCCCTCACCCCCGCGGGAGGGG + Intronic
975094389 4:70440936-70440958 TCCCCTCACCCCACCTGTCCTGG - Intronic
978443762 4:108761817-108761839 GCTCCTCACCCCAACTGGAGGGG - Intronic
979451026 4:120871063-120871085 TTCCCTCTTCCCATGTGGAGAGG - Intronic
980808122 4:137839791-137839813 TTCCCTCACCCCAGATAAAGTGG + Intergenic
981315754 4:143337726-143337748 TTCCCGCAACCCATCTCGAGGGG - Intronic
982281063 4:153684208-153684230 TTCCCGCACCCCAGAAGGAGGGG + Intergenic
984682512 4:182625788-182625810 TTCCCTCAACGCCACTGGAGAGG - Intronic
985138225 4:186811642-186811664 TGCCCTCCCCCCACCTGCACAGG + Intergenic
988813341 5:34806584-34806606 CTTCCTCACCCCACATGTAGTGG - Intronic
989192358 5:38683741-38683763 TCCCACCACCCTACCTGGAGTGG + Intergenic
990789437 5:59460595-59460617 GTCCCCCAGCCCATCTGGAGAGG + Intronic
994178856 5:96742098-96742120 GTGCCTCTCCCCTCCTGGAGTGG + Intronic
995299309 5:110558876-110558898 TTAACTCACCCCACCTCTAGGGG + Intronic
996496735 5:124166046-124166068 TTTCCTCACCCCTCATGCAGAGG + Intergenic
997002988 5:129784484-129784506 TTCCCTCTCCTCTCCTCGAGTGG - Intergenic
997464488 5:134078277-134078299 TTTCCTGACCACAGCTGGAGTGG - Intergenic
998106727 5:139473554-139473576 TTCCCCCATCCCTTCTGGAGAGG - Intergenic
998733003 5:145102564-145102586 TCCCCTCGCCCCACCAAGAGTGG + Intergenic
1001541439 5:172542681-172542703 ATCCCCCACCCCAGCTGGAGAGG + Intergenic
1001573665 5:172747857-172747879 TTCCATTACCCCATCAGGAGTGG + Intergenic
1002098965 5:176848022-176848044 TTCCCACACCAGACCTGGGGGGG + Intronic
1002294758 5:178224158-178224180 ACTCCCCACCCCACCTGGAGTGG + Intronic
1002416592 5:179124028-179124050 TTCCGTGACCCCACTGGGAGGGG + Intronic
1004968538 6:20882183-20882205 TGCCCTCCCTGCACCTGGAGGGG + Intronic
1007104873 6:39276790-39276812 ATCCCTGCCCCCACCTGGAGAGG - Intergenic
1007171136 6:39864528-39864550 TGCCCTGCCCCCACCTGGAAAGG + Intronic
1007308452 6:40925650-40925672 TTACATCACCACACCTGGGGTGG - Intergenic
1007691226 6:43702868-43702890 TTCCCTCACCCCTCATTGGGAGG - Intergenic
1015987554 6:138899799-138899821 TTCCCCCTCCCCACCAGGGGTGG - Intronic
1017578504 6:155833675-155833697 CTCCGTCACCCAAGCTGGAGTGG - Intergenic
1017659747 6:156662141-156662163 TTCCTTCACCCCTCCGGTAGAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018816530 6:167336795-167336817 TTCCGTCACCCTAGCTGTAGTGG - Intronic
1019301621 7:307059-307081 GTCTCCAACCCCACCTGGAGAGG - Intergenic
1019756653 7:2775844-2775866 ATCCCTCACACTACCTGGACAGG + Intronic
1022209455 7:28194632-28194654 TTCTGTCACCCCGTCTGGAGTGG + Intergenic
1022452173 7:30525647-30525669 TTCCCTCCCCCATCATGGAGCGG - Intronic
1023870055 7:44258506-44258528 TGCCCTCATCCCAGCTGGACTGG - Intronic
1025168059 7:56730820-56730842 TTCCCTGATACCACCTGGGGTGG + Intergenic
1025704331 7:63849106-63849128 TTCCCTGATACCACCTGGGGTGG - Intergenic
1029672078 7:102040265-102040287 TTCCGTCATCCTCCCTGGAGAGG - Intronic
1030364107 7:108626722-108626744 TTGCCTGTCCCCACCTGGAGTGG - Intergenic
1032720388 7:134546735-134546757 TTCGGTCACCCCACCCGGAGGGG + Intergenic
1034018627 7:147615236-147615258 CTCCGTCACCCAAGCTGGAGTGG - Intronic
1034540806 7:151756700-151756722 TTCCCTTCTCCCACCTGGGGTGG + Intronic
1037960269 8:23092627-23092649 GTCCCTGTCCCCACATGGAGGGG - Intronic
1038110794 8:24495098-24495120 TTCACTCACGCCAGCTGGGGTGG - Intronic
1038215106 8:25554805-25554827 TTGCCTCTCCCCGCTTGGAGAGG - Intergenic
1038229932 8:25690402-25690424 CTCCCTCACCCAGCCTGGATTGG - Intergenic
1039898160 8:41730960-41730982 TTTCCTTACCCCACGAGGAGGGG + Intronic
1040543952 8:48382311-48382333 TTCCCTCCACCCAGCTGCAGAGG - Intergenic
1040947617 8:52900647-52900669 TTCTCTCTCCCCACCTCTAGTGG + Intergenic
1041406757 8:57507966-57507988 TTCACTCTCCCCAACTGCAGGGG + Intergenic
1042961508 8:74308636-74308658 ATCCCTCACCCCAACTAGATTGG - Intronic
1049179805 8:141216403-141216425 TTCCCTCACCCTTCCTGATGCGG + Intronic
1049912180 9:279821-279843 TTCCCCGTCCCCACCAGGAGTGG + Intronic
1053342620 9:37350601-37350623 TTCCCTAACCCCAGCTGAAAAGG + Intronic
1055073916 9:72194509-72194531 TTCCCTCTCCTCTCCTCGAGTGG + Intronic
1056658277 9:88526493-88526515 TTCCCTCTCCCAACCTGCTGTGG + Intergenic
1057915760 9:99053907-99053929 TTCCCTTTCCCCACCTTGATGGG - Intronic
1060224455 9:121782699-121782721 TGCCCGCACCCCACAGGGAGCGG - Intronic
1061237954 9:129352941-129352963 GTCCCTCTCCCCTCCTGGGGTGG + Intergenic
1061727018 9:132587596-132587618 TTTCCTCACAGCTCCTGGAGGGG + Intronic
1062440786 9:136568426-136568448 AGCCCCCACCCCAGCTGGAGGGG + Intergenic
1203774544 EBV:65438-65460 CTCAGTCACCCTACCTGGAGAGG + Intergenic
1185573438 X:1152219-1152241 TTCCCTCACCCCAGCTCCTGGGG - Intergenic
1187390824 X:18885709-18885731 TTCCCTCTCCCCACCGGCTGGGG + Intergenic
1188378299 X:29460298-29460320 TTATATCTCCCCACCTGGAGTGG + Intronic
1190874299 X:54448954-54448976 TTCCCACAAACCACCTGGGGTGG + Exonic
1192841131 X:74857261-74857283 TTCCCTCTCCTCTCCTGAAGAGG - Intronic
1195520053 X:105820421-105820443 TCCCCTCCCCGCACCTGGGGAGG + Intergenic
1195548573 X:106140225-106140247 TTCCCCCAACCTACCTAGAGAGG + Intergenic
1195687647 X:107600973-107600995 TTCTCTCACCCCTGCTGGGGGGG - Exonic
1197183173 X:123558947-123558969 TTGCCTATCCTCACCTGGAGTGG - Intergenic
1199510063 X:148611764-148611786 TTCCCTGAACCCACCCGTAGTGG + Intronic
1199609407 X:149600173-149600195 TTCTCTCCCCTCTCCTGGAGTGG + Intronic
1199629710 X:149769181-149769203 TTCTCTCCCCTCTCCTGGAGTGG - Intergenic
1200117440 X:153775508-153775530 TTCCTTCCCCCCACCTGCTGGGG - Intronic
1202366430 Y:24168756-24168778 TTCCCTCCCCCATCATGGAGCGG + Intergenic
1202374077 Y:24217883-24217905 TTCCCTCCCCCATCATGGAGTGG - Intergenic
1202496704 Y:25452237-25452259 TTCCCTCCCCCATCATGGAGTGG + Intergenic
1202504352 Y:25501367-25501389 TTCCCTCCCCCATCATGGAGCGG - Intergenic