ID: 932865178

View in Genome Browser
Species Human (GRCh38)
Location 2:75334188-75334210
Sequence TCTCCCCATGGCTGAAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932865171_932865178 2 Left 932865171 2:75334163-75334185 CCATTAAGCCTACCCCTCAGCAA No data
Right 932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG No data
932865173_932865178 -10 Left 932865173 2:75334175-75334197 CCCCTCAGCAAAATCTCCCCATG No data
Right 932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG No data
932865172_932865178 -6 Left 932865172 2:75334171-75334193 CCTACCCCTCAGCAAAATCTCCC No data
Right 932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG No data
932865170_932865178 5 Left 932865170 2:75334160-75334182 CCACCATTAAGCCTACCCCTCAG No data
Right 932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932865178 Original CRISPR TCTCCCCATGGCTGAAGGCC AGG Intergenic
No off target data available for this crispr