ID: 932870223

View in Genome Browser
Species Human (GRCh38)
Location 2:75390943-75390965
Sequence CAATTTGACTGAGGGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932870217_932870223 21 Left 932870217 2:75390899-75390921 CCTTTGGAACTGCAGCAACCTCA No data
Right 932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG No data
932870218_932870223 3 Left 932870218 2:75390917-75390939 CCTCAATTCTTGTTCCTCAGAAG No data
Right 932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932870223 Original CRISPR CAATTTGACTGAGGGGCATA AGG Intergenic
No off target data available for this crispr