ID: 932870223 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:75390943-75390965 |
Sequence | CAATTTGACTGAGGGGCATA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
932870217_932870223 | 21 | Left | 932870217 | 2:75390899-75390921 | CCTTTGGAACTGCAGCAACCTCA | No data | ||
Right | 932870223 | 2:75390943-75390965 | CAATTTGACTGAGGGGCATAAGG | No data | ||||
932870218_932870223 | 3 | Left | 932870218 | 2:75390917-75390939 | CCTCAATTCTTGTTCCTCAGAAG | No data | ||
Right | 932870223 | 2:75390943-75390965 | CAATTTGACTGAGGGGCATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
932870223 | Original CRISPR | CAATTTGACTGAGGGGCATA AGG | Intergenic | ||
No off target data available for this crispr |