ID: 932870706

View in Genome Browser
Species Human (GRCh38)
Location 2:75395074-75395096
Sequence GACAGCTCCTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932870706_932870709 11 Left 932870706 2:75395074-75395096 CCAGTAACAGGCCAGGAGCTGTC No data
Right 932870709 2:75395108-75395130 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932870706 Original CRISPR GACAGCTCCTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr