ID: 932871152

View in Genome Browser
Species Human (GRCh38)
Location 2:75399686-75399708
Sequence TTGTTGATGGGCACTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932871152_932871157 16 Left 932871152 2:75399686-75399708 CCAACCTCAGTGCCCATCAACAA No data
Right 932871157 2:75399725-75399747 AATGTGGCATATATACCCCATGG 0: 4
1: 838
2: 22330
3: 14054
4: 10989
932871152_932871156 0 Left 932871152 2:75399686-75399708 CCAACCTCAGTGCCCATCAACAA No data
Right 932871156 2:75399709-75399731 ACAAGTGAAAGAAGAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932871152 Original CRISPR TTGTTGATGGGCACTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr