ID: 932873861

View in Genome Browser
Species Human (GRCh38)
Location 2:75430669-75430691
Sequence CCCCTTGGGCACGTGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 3, 1: 29, 2: 483, 3: 849, 4: 1281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932873861 Original CRISPR CCCCTTGGGCACGTGTTCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr