ID: 932878067

View in Genome Browser
Species Human (GRCh38)
Location 2:75474017-75474039
Sequence AAGCCTTAATGTCATTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932878063_932878067 18 Left 932878063 2:75473976-75473998 CCAGGCAGACAGTAAAATGCCAG 0: 1
1: 0
2: 0
3: 14
4: 237
Right 932878067 2:75474017-75474039 AAGCCTTAATGTCATTAATGAGG 0: 1
1: 0
2: 2
3: 22
4: 302
932878065_932878067 -1 Left 932878065 2:75473995-75474017 CCAGGTGAAGCCTCTTTTATAAA 0: 1
1: 0
2: 5
3: 30
4: 201
Right 932878067 2:75474017-75474039 AAGCCTTAATGTCATTAATGAGG 0: 1
1: 0
2: 2
3: 22
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932878067 Original CRISPR AAGCCTTAATGTCATTAATG AGG Intronic
902523387 1:17036193-17036215 AAGACTTAATGTTGTTAAGGAGG - Intronic
902778699 1:18690853-18690875 AACCCTTCATGTCACAAATGGGG + Intronic
903611305 1:24615527-24615549 AAGACTTAATGTTATTAAAACGG - Intergenic
904585791 1:31579828-31579850 AAGCCTTAATAGAAATAATGGGG + Intronic
904776273 1:32909001-32909023 AAGACTTAATATCATTAAGATGG + Intergenic
907096784 1:51789283-51789305 AAGCCCTGATATCAGTAATGGGG + Exonic
908029453 1:59984483-59984505 AAGCCTGATTGACATCAATGAGG + Intergenic
908669206 1:66527396-66527418 AGGCCTTAATCTCATTCACGAGG - Intergenic
909129902 1:71721838-71721860 AGACCTTAATGTCATCAAAGAGG + Intronic
909912326 1:81276295-81276317 CAGCCTGATTGTCATTTATGTGG + Intergenic
909932929 1:81518696-81518718 AAGCCTAAATGCCATTATTATGG - Intronic
910138988 1:84005539-84005561 AGGCATTAATTTCATTCATGAGG - Intergenic
910491082 1:87771951-87771973 AAGCACTAATCTCATTCATGAGG + Intergenic
911080321 1:93922583-93922605 CTGGCTTAATGTTATTAATGTGG + Intergenic
912835001 1:112988320-112988342 AAGCATTAATTCCATTCATGAGG + Intergenic
913204119 1:116520075-116520097 CAACCTTAAAGTCATTAATTGGG - Intronic
913526508 1:119698722-119698744 AAGCCTTCATGTCCTCAAAGAGG - Intronic
916504191 1:165413138-165413160 AAGTCTTCCTGTCATAAATGAGG + Intronic
916910834 1:169344011-169344033 AAGACTTAATGTGGTTAAGGTGG - Intronic
920028408 1:203018888-203018910 AGGCCTTAATCCCATTCATGAGG + Intronic
920778023 1:208959349-208959371 AAGAATTAATATCATTAAAGTGG + Intergenic
921456087 1:215374104-215374126 ATGAATTAATGTCATTAAAGTGG - Intergenic
921576335 1:216839368-216839390 ATCCCTCAAAGTCATTAATGAGG + Intronic
921726931 1:218534278-218534300 AGGCACTAATCTCATTAATGAGG - Intergenic
921727592 1:218540512-218540534 AGGCATTAATTTCATTCATGAGG - Intergenic
921887098 1:220318050-220318072 AGGCCTTAATTCCATTCATGAGG + Intergenic
922314795 1:224433868-224433890 CAGCCTGAATGTCAATAACGGGG - Exonic
922903037 1:229152534-229152556 AAGCCTCAAAGTCATCCATGAGG + Intergenic
923660899 1:235956412-235956434 AAGCCTCAATGTTATTAAGATGG + Intergenic
923802449 1:237223330-237223352 GAGCCTTAATTCCATTCATGAGG + Intronic
924089273 1:240485888-240485910 AAGCCATCAGGTCATAAATGAGG - Intergenic
924900538 1:248393672-248393694 AAGAATTAATCTCATTAAAGTGG + Intergenic
924933599 1:248749624-248749646 ATGCATTGATGTCATGAATGTGG - Intronic
1063867108 10:10377265-10377287 AGGCATTAATCTCATTCATGAGG - Intergenic
1063967996 10:11361928-11361950 CAGCATTAATGGCATCAATGTGG - Intergenic
1064928760 10:20599863-20599885 ATGGATTAATGTCATTATTGAGG + Intergenic
1066991657 10:42520288-42520310 AATCATGAATGTCATGAATGTGG - Intergenic
1067198515 10:44144883-44144905 AAGCCTTAATATCATGAAAATGG + Intergenic
1067518309 10:46974163-46974185 AAGCCTTGGTGGCATTCATGTGG - Intronic
1067643940 10:48077665-48077687 AAGCCTTGGTGGCATTCATGTGG + Intergenic
1067806537 10:49396864-49396886 AAGCCTTTATGATATTAAAGGGG + Intergenic
1068004665 10:51378783-51378805 TAGCATTAATGTCACTCATGGGG + Intronic
1068141675 10:53016558-53016580 AAGCAACAATGTCATTACTGAGG - Intergenic
1068780192 10:60911573-60911595 AAGCCTTGGTGTCCTTACTGTGG - Intronic
1069155380 10:65023250-65023272 ATGGATTAATGTCATTATTGAGG - Intergenic
1071062025 10:81581953-81581975 AAGCCATGATCTCATTAACGGGG - Intergenic
1071199056 10:83196504-83196526 AAGCCTTAATCCCACTTATGAGG - Intergenic
1072422419 10:95300252-95300274 GGGCCTTAATCTCATTCATGAGG + Intergenic
1085944356 11:81248815-81248837 AAGTCTTAATTTCTTTAATCAGG - Intergenic
1087827191 11:102778944-102778966 AAGCACTAATCTCATTCATGAGG - Intronic
1087934533 11:104017061-104017083 AATCCGTAATCTCATTCATGAGG - Intronic
1090852097 11:130579585-130579607 AAGCACTAATCCCATTAATGAGG + Intergenic
1091155748 11:133370629-133370651 AAGAATTAATGTCATTAAAATGG + Intronic
1091868219 12:3861334-3861356 AAGCCTTAATGCCATTTATGAGG - Intronic
1093129811 12:15376774-15376796 AGGCATTAATACCATTAATGTGG + Intronic
1094395776 12:30003735-30003757 ATGGGTTAATGTCATTATTGTGG + Intergenic
1095205405 12:39434293-39434315 ATGGATTAATGTCATTATTGAGG - Intronic
1097636392 12:62127576-62127598 ATGAATTAAAGTCATTAATGGGG + Intronic
1097838387 12:64296804-64296826 ATGGATTAATGTCATTATTGTGG + Intronic
1098806846 12:75031827-75031849 AAGCTTTCAGGTCATTTATGTGG - Intergenic
1100729115 12:97444067-97444089 ATGCCTTTATGTCATTATTATGG - Intergenic
1101634336 12:106525432-106525454 AGGCCTTAATCTCAATCATGAGG - Intronic
1101800846 12:108020782-108020804 TAGTCTGAAAGTCATTAATGTGG + Intergenic
1102421675 12:112808298-112808320 AAGGCTTAATGTGATTAATCAGG - Intronic
1105522915 13:21147412-21147434 AAGGCTTAATGGCAATAATCAGG - Exonic
1106046613 13:26147812-26147834 AAGCTTTCAGGTCATTTATGTGG + Intronic
1106782728 13:33075963-33075985 AGGCCTTAATCCCATTAATGAGG + Intergenic
1107325352 13:39235990-39236012 CAGGCTAAATGTGATTAATGAGG - Intergenic
1108965673 13:56297348-56297370 AACCCTTAAAGTCATCCATGAGG - Intergenic
1109431604 13:62243326-62243348 AGGCCTAAATGTCATGAAGGAGG - Intergenic
1109459247 13:62633305-62633327 ACCCCTTAATGTAATCAATGAGG + Intergenic
1110302173 13:73941496-73941518 CAGCCTTTAAGTCATAAATGAGG + Intronic
1110307664 13:74008654-74008676 ACCCCTTAATTTCATAAATGAGG - Intronic
1110357811 13:74588717-74588739 GAGCATTAATCCCATTAATGAGG - Intergenic
1111366094 13:87247210-87247232 ATCCCTCAATGTCATTCATGAGG - Intergenic
1112836673 13:103523092-103523114 ACCCCTTAAAGTCATTCATGAGG - Intergenic
1112918198 13:104576967-104576989 AAACCTCAATGTCAATCATGTGG - Intergenic
1113586069 13:111466659-111466681 AAGAATCAATGTCATTAATATGG - Intergenic
1114541261 14:23461396-23461418 AAGGCTTAATGTAATTAACATGG + Intergenic
1114832942 14:26167215-26167237 AAGCATTTATCTCATTCATGAGG + Intergenic
1116343642 14:43759253-43759275 GAGCATTAATCTCATTAATCAGG - Intergenic
1118067575 14:62208418-62208440 ATGGATTAATGTCATTATTGTGG - Intergenic
1118707925 14:68496785-68496807 AACCCTTGAAGTCATTCATGAGG - Intronic
1118843762 14:69530820-69530842 AAGGATTAATGTCATTATCGAGG - Exonic
1119277474 14:73371713-73371735 AAGCCTTAATCCCATTCAGGAGG - Intronic
1119622826 14:76145563-76145585 GAGCCTTAATTCCATTCATGAGG - Intergenic
1119751126 14:77078162-77078184 AAGTCTTAATCCCATTCATGAGG - Intergenic
1119861833 14:77941615-77941637 AGGCCTTAAAGTAATTAATGAGG + Intergenic
1122285527 14:100649695-100649717 ATGGATTAATGTCATTATTGTGG + Intergenic
1123662746 15:22578963-22578985 AAGTCTTCATGTTATTAATGTGG + Intergenic
1124261538 15:28196952-28196974 AAGTCTTCATGTTATTAATGTGG - Intronic
1124316547 15:28673267-28673289 AAGTCTTCATGTTATTAATGTGG + Intergenic
1125703199 15:41707000-41707022 AACCATAAATGTCATTAATAAGG + Intronic
1125822549 15:42645069-42645091 ACCCCTTAAAGTCATTCATGAGG + Intronic
1126769002 15:52036525-52036547 ATGGGTTAATGTCATTATTGTGG - Intronic
1127853823 15:62938634-62938656 AAGGCTTAATCTCATCAATCGGG - Intergenic
1130096255 15:80858373-80858395 AAGCGTTTATTTAATTAATGAGG - Intronic
1130201884 15:81838864-81838886 AACCCTCAATGTGATTTATGAGG + Intergenic
1130413693 15:83669874-83669896 AAGTCATAATTTCATTTATGAGG - Intronic
1132380766 15:101364702-101364724 AAGACTTAATATTGTTAATGTGG + Intronic
1136677716 16:31927661-31927683 AAGCTTTAAGGTCATGAACGTGG - Intergenic
1138317083 16:56079379-56079401 AAGCCTTAAAGTCACTAAAATGG + Intergenic
1140650291 16:77080904-77080926 AACCCTCAAAGTCATTCATGAGG + Intergenic
1141787142 16:86209150-86209172 GAGCCTTAAATTCATTAACGAGG + Intergenic
1143181857 17:4988311-4988333 ACGCCTTCATGTCAGCAATGAGG + Exonic
1143753308 17:9047607-9047629 ACTCCTTAATGTTATTTATGAGG + Intronic
1144145186 17:12390535-12390557 AAGCATCAAAGTCTTTAATGTGG + Intergenic
1144635653 17:16907160-16907182 AAGCATCAATATCATTAAAGTGG - Intergenic
1146685102 17:34836293-34836315 AAGCCTTCAGATGATTAATGAGG + Intergenic
1147416871 17:40298265-40298287 AAGCCTAAATGTTACTGATGGGG - Intronic
1149634960 17:58159347-58159369 AGGCCTTAATCCCATTAATAAGG - Intergenic
1153097296 18:1421568-1421590 GGGCTTTAATGTCATTAAGGAGG + Intergenic
1153455403 18:5276025-5276047 GGGCCTTAATCCCATTAATGAGG - Intergenic
1153741398 18:8133121-8133143 ATGGATTAATGTCATTATTGTGG - Intronic
1153823159 18:8849813-8849835 CAGCCTTCTTGTCATTAAGGAGG + Intergenic
1154372296 18:13775122-13775144 AAGCCTTTATGGCTTTCATGTGG - Intergenic
1155739525 18:29270727-29270749 AAAACTTAATTTCATGAATGTGG + Intergenic
1155755719 18:29493063-29493085 TAGGCTTAATGCCATTAAGGTGG + Intergenic
1155822758 18:30398660-30398682 AAGCTTTCAGGTCATTTATGTGG + Intergenic
1156786727 18:40923949-40923971 AGGCACTAATGTCATTCATGAGG - Intergenic
1157151977 18:45227547-45227569 GGGCCTTAATCCCATTAATGAGG + Intronic
1159290460 18:66412128-66412150 AAGAATTAATGTCATTAAAATGG + Intergenic
1160071831 18:75635762-75635784 GGGCCTTAATGTCATTCACGAGG + Intergenic
1163084186 19:14967523-14967545 ATGCATTAATAACATTAATGTGG - Intronic
1164167223 19:22691728-22691750 AAAACTTAATCTCATTGATGTGG - Intergenic
1166670513 19:44707015-44707037 CATCCTTCATGTCAGTAATGAGG + Intronic
926432246 2:12799862-12799884 AAGAATCAATATCATTAATGTGG + Intergenic
927437137 2:23076392-23076414 AAGCCTTGATGTCAGTAAGCAGG + Intergenic
927952199 2:27179234-27179256 ACCCCTTCATTTCATTAATGTGG + Intergenic
928110842 2:28507477-28507499 ATGGATTAATGTCATTATTGTGG - Intronic
929278638 2:40053444-40053466 AGGTCTTAATCCCATTAATGAGG - Intergenic
930174482 2:48287900-48287922 GGGCCTTAATCCCATTAATGAGG + Intergenic
930272199 2:49270078-49270100 GAGCCCTAATTTCATTTATGAGG + Intergenic
930283140 2:49395405-49395427 AAGCCTAAATGTCTGTAATTAGG + Intergenic
930315555 2:49792986-49793008 AAGTACTAATGTCATTCATGAGG + Intergenic
930903258 2:56533578-56533600 AAGCTTTTAGGTCATTTATGTGG + Intergenic
931315924 2:61131576-61131598 AAGACTTAATGTTATTAAGATGG + Intronic
931831446 2:66055865-66055887 GAGCATTAATGCCATTCATGAGG - Intergenic
932272480 2:70423004-70423026 ATGAATTAATGTCATTATTGCGG - Intergenic
932878067 2:75474017-75474039 AAGCCTTAATGTCATTAATGAGG + Intronic
933048770 2:77574760-77574782 AAGACTTAATATCATTAAGATGG + Intronic
933346584 2:81093574-81093596 ATGACTTAAGGTCACTAATGGGG + Intergenic
933985810 2:87591379-87591401 AAGCCTTGATGACTTTCATGAGG + Intergenic
934811554 2:97283142-97283164 AAGAATTAATGTCATTAAAATGG - Intergenic
934826137 2:97424798-97424820 AAGAATTAATGTCATTAAAATGG + Intergenic
936333401 2:111567802-111567824 ATGGATTAATGTCATTATTGAGG + Intergenic
936824454 2:116564056-116564078 AGGCCTTAAAGTGTTTAATGGGG + Intergenic
938177779 2:129151974-129151996 AAGCATTAATGGCCTTAAAGAGG - Intergenic
938394566 2:130933522-130933544 AAGACTTAATATTATTAATATGG - Intronic
939816177 2:146899958-146899980 ATGTCTTAGTGTCATTTATGTGG - Intergenic
939816359 2:146901938-146901960 AGGTCTTAGTGTCATTTATGTGG + Intergenic
939904032 2:147888230-147888252 AAGCCTTAACGTCAGGAAAGCGG + Intronic
940163616 2:150742554-150742576 CTCTCTTAATGTCATTAATGTGG + Intergenic
940428918 2:153564664-153564686 AAGCCTGAAGGTCATTAGTGTGG + Intergenic
941092791 2:161197750-161197772 AGGCCTTAATCTTATTCATGTGG + Intronic
941958043 2:171224594-171224616 AAGTCTTAATATCATTAAGGTGG + Intronic
942739715 2:179161277-179161299 GAGCCTTAATGTCATTTGTTAGG - Intronic
942818616 2:180083081-180083103 AAGAATTAATGTCATTAAGATGG - Intergenic
942948383 2:181694970-181694992 AAGGCTTAATGACAATAATCTGG - Intergenic
945341876 2:208666182-208666204 GGGCCTTAATCCCATTAATGAGG + Intronic
946755858 2:222946933-222946955 AAGTCCTAATGCCTTTAATGGGG + Intergenic
947155026 2:227153879-227153901 AAGACTTTATGTCAGGAATGGGG - Intronic
948253436 2:236549409-236549431 GAGCCTTCAGGTCATTAAGGAGG - Intergenic
1169585045 20:7072384-7072406 AGGCCTTAATCCCATTCATGTGG - Intergenic
1169846233 20:9994990-9995012 ATGGATTAATGTCATTATTGTGG - Intronic
1169982510 20:11401988-11402010 AAGCATTAATGTCATTACTGTGG + Intergenic
1171176690 20:23056077-23056099 AAGACTTAATATGATTAAGGTGG + Intergenic
1174388888 20:50204962-50204984 GAGTCTTAATGTCACTAATAGGG + Intergenic
1175013609 20:55764824-55764846 AAGCCTTGATGGCTTTCATGTGG - Intergenic
1175613972 20:60376869-60376891 AAGACATGATGTCTTTAATGTGG + Intergenic
1176736593 21:10554115-10554137 TAGCCATGATGTCATTAATAAGG - Intronic
1177461091 21:21411766-21411788 AAGTCTAAATGGCATCAATGAGG - Intronic
1177773647 21:25544601-25544623 AAGCCTTGATGGCTTCAATGTGG - Intergenic
1178053260 21:28770600-28770622 ATGGATTAATGTCATTATTGTGG + Intergenic
1178155435 21:29848182-29848204 GACCCTTAATGCCATCAATGTGG + Intronic
1179157780 21:38864841-38864863 ATGGATTAATGTCATTATTGAGG + Intergenic
1181484638 22:23223059-23223081 AGGCATTAATTTCATTCATGAGG + Intronic
1182576310 22:31275407-31275429 AAGCCTTGAGGTCAAGAATGTGG + Intronic
1182759150 22:32708031-32708053 AAGCTGTAATGTCATAGATGGGG - Intronic
1182892519 22:33830902-33830924 AAGCATTAATCTCATTCATGAGG + Intronic
1183333935 22:37236113-37236135 GAGCCTCAATCTCTTTAATGTGG + Intronic
1185209358 22:49560723-49560745 AGGTCTTAATATCATTCATGAGG - Intronic
949313227 3:2723614-2723636 AGGCCTTAATCCCATTCATGAGG + Intronic
949693518 3:6667689-6667711 AAGCCTTGGTGTCTTTCATGTGG + Intergenic
951256355 3:20453887-20453909 AAGGACTAATGTCATTATTGTGG + Intergenic
955455035 3:59110961-59110983 ATGAATTAATGTCATTATTGTGG + Intergenic
955616695 3:60815830-60815852 AAGAATCAATTTCATTAATGTGG - Intronic
955691667 3:61597138-61597160 ATGGATTAATGTCATTAAGGAGG - Intronic
955882783 3:63565521-63565543 AGGCCTTAATCCCATTCATGAGG + Intronic
957291691 3:78285314-78285336 AGAACTTAATCTCATTAATGAGG + Intergenic
958196284 3:90245729-90245751 AAGCCTTGGTGGCATTCATGTGG - Intergenic
958419476 3:93914371-93914393 AAGCCTTGGTGGCATTCATGTGG - Intronic
960393835 3:117111876-117111898 AGGCCTGAAAGTCAGTAATGGGG - Intronic
960424744 3:117492699-117492721 AATCCTTAAAGACAATAATGAGG - Intergenic
962933647 3:140059880-140059902 AACCATTAATGTCTTGAATGAGG - Intronic
963659100 3:148101760-148101782 AATGCTTAGTGTCATTCATGCGG + Intergenic
964250063 3:154704022-154704044 AAGACTTAATGTTGTTAATATGG + Intergenic
967595307 3:191320994-191321016 AAGTCTTAATCCCATTAATCAGG - Intronic
968250519 3:197206623-197206645 AACCATTAATCTGATTAATGGGG + Intronic
969175524 4:5395990-5396012 AGGCCATGCTGTCATTAATGGGG + Intronic
970052970 4:11937037-11937059 AATCCTTAATGTCAGAAGTGGGG - Intergenic
970858438 4:20674905-20674927 GAGCATTAATCTCATTCATGAGG + Intergenic
970968588 4:21955372-21955394 AAACTTAAATATCATTAATGAGG + Intergenic
972733014 4:41813748-41813770 AAGCCTTAATCCTATTTATGAGG + Intergenic
973795004 4:54416208-54416230 AAGCACTAATCTCATTCATGAGG + Intergenic
974514165 4:62886737-62886759 ATGAATTAATGTCATTACTGAGG + Intergenic
974965561 4:68756722-68756744 AAGAATTAATTCCATTAATGAGG + Intergenic
975435289 4:74344328-74344350 AAGCCTTACTGGCATCCATGTGG - Intergenic
975492863 4:75007533-75007555 AACCCTTAATTTGATAAATGAGG - Intronic
975902665 4:79171222-79171244 ATGGATTAATGTCATTATTGTGG + Intergenic
975959283 4:79881385-79881407 AGGCCTTAATGTTATTATTTTGG - Intergenic
977030459 4:91876334-91876356 AAGCCTTGATGGCTTTCATGTGG + Intergenic
978118757 4:105052694-105052716 ATGCCTTAATTTCATTATTCAGG - Intergenic
978324632 4:107538444-107538466 GAGCCTTAATTCCATCAATGAGG + Intergenic
980114534 4:128666554-128666576 GAGCATTAATCTCATTCATGTGG + Intergenic
980602964 4:135049135-135049157 AAGCCTTAATTTCAGTAAATTGG + Intergenic
981680473 4:147391820-147391842 TAGCATTAATCTCATTCATGGGG - Intergenic
981683588 4:147428113-147428135 ACCCCTCAAAGTCATTAATGAGG - Intergenic
982734631 4:158992814-158992836 AGGCTTTAATCTCATTCATGAGG + Intronic
982853436 4:160348994-160349016 ATGACTTACTGTCTTTAATGTGG + Intergenic
983413757 4:167429135-167429157 ATTCATTAATGTCATTATTGAGG - Intergenic
984288387 4:177762495-177762517 AAGTCTTAAAGTCAGTAAAGAGG - Intronic
985020821 4:185687955-185687977 AAGGCTGCAGGTCATTAATGAGG - Intronic
986883430 5:12204422-12204444 AAGCATCAATGTCATTAAAATGG - Intergenic
986896180 5:12372221-12372243 AAGCACTAATCTCATTCATGAGG + Intergenic
987588652 5:19893073-19893095 AAGCACTAATGCCATTCATGAGG - Intronic
987627317 5:20418884-20418906 AAGCATTAATCCCATTCATGAGG - Intronic
987741994 5:21921250-21921272 AAGCCTTAAAATCATAAATGAGG + Intronic
987831599 5:23102621-23102643 ATGCCTTCAGGTCATTAATATGG + Intergenic
988248779 5:28726511-28726533 AAGTTTTAATCCCATTAATGGGG + Intergenic
988924213 5:35972851-35972873 AAGCTTTCAGGTCATTAATGTGG - Intronic
991287723 5:64997682-64997704 AAGCCTACAGTTCATTAATGAGG - Intronic
992039012 5:72809865-72809887 GGGCCTTAATAACATTAATGAGG - Intergenic
993121415 5:83779311-83779333 AAGGATTAATGTCAATATTGAGG - Intergenic
993453317 5:88098756-88098778 AAGGATTAATGTCTTTATTGTGG + Intergenic
995495632 5:112738945-112738967 AAGCTTTTATGCCATTAATTAGG + Intronic
995544400 5:113215521-113215543 GAGCCTTAATCCCATTCATGAGG - Intronic
995628766 5:114109983-114110005 GAGCCTTAATCTCATTCATGAGG - Intergenic
995962446 5:117858939-117858961 AAGCCTTACTTTCACAAATGAGG + Intergenic
997790806 5:136759649-136759671 TATCCTTCATTTCATTAATGTGG - Intergenic
1000270823 5:159681467-159681489 AAGCCTTGATATCTTTCATGTGG - Intergenic
1000721085 5:164708051-164708073 AAGCTTTAATGTCATAAACTAGG + Intergenic
1000937038 5:167314312-167314334 AAGCCTGAATTTCATTAAGTAGG + Intronic
1001736706 5:174010565-174010587 AACCCTTACTGCCGTTAATGTGG + Intergenic
1002807384 6:590305-590327 AATAATTAATGACATTAATGGGG + Intronic
1002936983 6:1682415-1682437 AAGCCTCAATCTCTTTCATGTGG - Intronic
1002983466 6:2164802-2164824 AAGCCTTCAGGGCATTTATGTGG + Intronic
1003351412 6:5320935-5320957 GAGCATTAATCTCATTCATGAGG + Intronic
1003807494 6:9741950-9741972 AAGAATCAATGTCATTAAAGTGG - Intronic
1004273267 6:14213164-14213186 AAGCACTAATCTCATTCATGAGG - Intergenic
1004597250 6:17111927-17111949 ACACCTTAATCCCATTAATGAGG + Intronic
1006551335 6:34825624-34825646 AGGCATTAATCCCATTAATGAGG + Intronic
1008125972 6:47668649-47668671 AACCCTCAAAGTCATTCATGAGG - Intronic
1008141819 6:47840484-47840506 AAGCCTTAATCCCTTTTATGAGG - Intergenic
1008658622 6:53642927-53642949 AAGCTTTTATTTCATAAATGAGG - Intergenic
1009757074 6:67953755-67953777 GAGCACTAATGTCATTCATGAGG - Intergenic
1009826470 6:68871783-68871805 AATCATTAATGACATTAATGAGG + Intronic
1010114501 6:72286341-72286363 ATGCCTCAATATCATTAATCTGG - Intronic
1011331184 6:86208105-86208127 AAGCTTTCAGGTCATTTATGAGG + Intergenic
1011984894 6:93431030-93431052 ATGCATTAATGCCATTACTGTGG + Intergenic
1012287554 6:97411015-97411037 AATCCTTAAAGTCATCCATGAGG + Intergenic
1012717624 6:102697538-102697560 AAGAGTTATTGACATTAATGAGG - Intergenic
1012799890 6:103812498-103812520 AAGCCTTAAAGTCATCCATGAGG + Intergenic
1014031313 6:116708535-116708557 AAGCCTTAATATTATTAAGATGG - Intronic
1016103526 6:140132899-140132921 AAGCATTAATATTATTAAAGTGG + Intergenic
1016195302 6:141328970-141328992 AGGCATTAATATCATTCATGAGG + Intergenic
1017632899 6:156415754-156415776 ACGCCTTAATCCCATTCATGAGG + Intergenic
1019132228 6:169885426-169885448 AGGGATTAATGTCATTATTGTGG - Intergenic
1021052838 7:16010682-16010704 AAGGATTAATGTCATTATTGAGG + Intergenic
1021113921 7:16727488-16727510 AAGGCCTAATCTCATTCATGAGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021908664 7:25362349-25362371 GGGCCTTCATGTCATTAATGAGG + Intergenic
1024009538 7:45255861-45255883 AAGCTTTCAGGTCATTTATGCGG + Intergenic
1024822454 7:53349066-53349088 AACTTTTAATGTCCTTAATGGGG - Intergenic
1025002627 7:55329784-55329806 AAGGATTAATGTTATTATTGAGG - Intergenic
1027459918 7:78439451-78439473 AAGCCTTAATGTAAGAAGTGGGG + Intronic
1029044263 7:97611509-97611531 AGGCCTTAATCCCATTAATGAGG + Intergenic
1029048211 7:97654170-97654192 AAGCCTTATTCTCAATAATAAGG + Intergenic
1030889597 7:114982948-114982970 TGGCCTTAATCTCATTAATTAGG + Intronic
1033152667 7:138929470-138929492 ATGCCTCAAAGTCATTCATGAGG + Intronic
1033435231 7:141327724-141327746 ATGAATTAATGTCATTATTGTGG + Intronic
1033835707 7:145309167-145309189 AAGAATTAATTTCATTAAAGTGG + Intergenic
1038380541 8:27089112-27089134 AAGCCTTAATCCCATTCAAGAGG + Intergenic
1041313157 8:56536792-56536814 AGGCACTAATGTCATTCATGAGG + Intergenic
1041779879 8:61566235-61566257 ACCCCTCAAAGTCATTAATGAGG - Intronic
1042866241 8:73358863-73358885 AGGCATTAATGCCATTCATGAGG - Intergenic
1043037005 8:75210934-75210956 AAGCCTTAGTGTCATCCACGTGG - Intergenic
1043106231 8:76115046-76115068 AAGCATTAATGTCTTTTCTGTGG + Intergenic
1043851841 8:85224888-85224910 AAACCTTAATGTCATGAGTTTGG + Intronic
1044175479 8:89115481-89115503 TATCCTTCATTTCATTAATGTGG - Intergenic
1044892426 8:96851604-96851626 AAGCCTTAATCCCATTTATGAGG + Intronic
1045411312 8:101923050-101923072 GAGCCTTAATTCCATTCATGAGG - Intronic
1045802685 8:106119451-106119473 AGGCCTTAATTCCATTAATGAGG + Intergenic
1046465132 8:114591858-114591880 AAGCCTTCATGTAATCAAAGAGG + Intergenic
1047789711 8:128190612-128190634 AAGCCTTACGGTCAGTCATGGGG - Intergenic
1048349141 8:133601926-133601948 ATGCACTAATGTCATTAATGAGG + Intergenic
1048984128 8:139722872-139722894 AAGCCTTATTCTCATTATTGAGG - Intergenic
1052470691 9:28891358-28891380 CAGCATTATTGTCATTATTGAGG + Intergenic
1053223582 9:36332131-36332153 CAGCCTTGATGCCATTAAAGAGG - Intergenic
1054705875 9:68461582-68461604 GGGTCTTAATGCCATTAATGAGG - Intronic
1055336031 9:75234476-75234498 GGGCCTTAATTCCATTAATGAGG - Intergenic
1056025171 9:82486478-82486500 AAGCCTTTATGGAATTAATATGG - Intergenic
1056359778 9:85843926-85843948 AAAACTTAATGCCCTTAATGCGG + Intergenic
1056515810 9:87348560-87348582 AAGCTTTCAGGTCATTTATGTGG - Intergenic
1057065969 9:92051989-92052011 AAGACTTAATATCATTAAGATGG + Intronic
1060500383 9:124149317-124149339 AAGCATTAATCCCATTCATGAGG + Intergenic
1186676350 X:11821531-11821553 ATGCATTAATGCCATTATTGTGG + Intergenic
1186732966 X:12429827-12429849 GGGCCTTAATCTCATTCATGAGG - Intronic
1188469303 X:30519345-30519367 ATGCCTCAAAGTCATTCATGAGG - Intergenic
1189752747 X:44239103-44239125 AAGGCTTATTTTTATTAATGGGG + Intronic
1190068876 X:47262926-47262948 AAGCCCTAATGTCAGCAAAGGGG + Intergenic
1190587059 X:51956117-51956139 TAGCCTTCATTCCATTAATGTGG - Intergenic
1192217762 X:69175766-69175788 ATGAATTAATGTCATTATTGTGG + Intergenic
1192816553 X:74599556-74599578 AAGCGTTAATCTCATTCATGAGG - Intronic
1193273139 X:79552546-79552568 AAACCTTATAGTCATTAAAGTGG - Intergenic
1193445565 X:81597525-81597547 AAGCACTAATCTCATTCATGAGG - Intergenic
1193579411 X:83245477-83245499 AAGTGTTAGTTTCATTAATGGGG - Intergenic
1194793334 X:98178548-98178570 AAGCCTTAATTTCATCAGTTTGG + Intergenic
1194908945 X:99615015-99615037 AGGCACTAATCTCATTAATGAGG - Intergenic
1195559267 X:106264883-106264905 AAGAATTATTGTCATTAAAGAGG - Intergenic
1195788338 X:108553117-108553139 AAACCTTAAAGTCTTTAAGGAGG + Intronic
1195995389 X:110726319-110726341 AAGCACTAATCTCATTCATGAGG - Intronic
1196183953 X:112725593-112725615 AGGGCTTAATCTCATTCATGAGG + Intergenic
1202240472 Y:22762056-22762078 AAGCCTTTCTGTCACTGATGGGG - Intergenic
1202393458 Y:24395809-24395831 AAGCCTTTCTGTCACTGATGGGG - Intergenic
1202477327 Y:25274291-25274313 AAGCCTTTCTGTCACTGATGGGG + Intergenic
1202594862 Y:26527310-26527332 TAGCCATGATGTCATTAATAAGG - Intergenic