ID: 932880210

View in Genome Browser
Species Human (GRCh38)
Location 2:75494320-75494342
Sequence TGGGGTAAACACAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932880210 Original CRISPR TGGGGTAAACACAGGGATGC TGG Intronic
900325658 1:2107609-2107631 TGGAGGAAACACAGGGAGGGAGG + Intronic
903835041 1:26198179-26198201 TGAGGAAATCACAGGGATTCAGG - Intronic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
907601716 1:55777977-55777999 AGGGGTAAATACAGAGAGGCAGG - Intergenic
909216349 1:72895348-72895370 TGTGGTAAACACAAGAGTGCAGG - Intergenic
909759502 1:79270832-79270854 TGAGGCACACACAGAGATGCAGG + Intergenic
911824196 1:102460951-102460973 TGGGGTACATACAGTGATGAAGG + Intergenic
912160715 1:106981692-106981714 TGGTGGACACCCAGGGATGCTGG - Intergenic
912697369 1:111851597-111851619 TGGGGTAAAGACTGTAATGCAGG - Intronic
914747481 1:150510847-150510869 TGGGGAAAACAGTGGGAAGCGGG - Intronic
914956738 1:152169322-152169344 TGGGAGAAAGACAGGGAAGCAGG + Intergenic
916116848 1:161492280-161492302 TGCATTAAACACAGGGGTGCAGG + Intergenic
919499896 1:198324845-198324867 TGGGGTAAAAATAGGAATGACGG + Intergenic
919512616 1:198484889-198484911 TGCAATAAACACAGGGATGCAGG - Intergenic
919738772 1:200970241-200970263 TGGGGAAAACACAAGGTTGCGGG - Intronic
919827784 1:201516037-201516059 TGGGGGTAATACAGGGAAGCAGG + Intergenic
920035170 1:203060726-203060748 TGGGGGAAACAAAGGGAAGAGGG + Intronic
921930434 1:220749835-220749857 TGGAGTGAACACAGGGATGCAGG - Intronic
922105144 1:222507152-222507174 TGGGCTATATGCAGGGATGCAGG + Intergenic
922701261 1:227762481-227762503 AGCAGTAAACACAGGGAAGCTGG - Intronic
1062914312 10:1235569-1235591 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914609 10:1236797-1236819 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914649 10:1236917-1236939 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914763 10:1237277-1237299 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914780 10:1237325-1237347 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914848 10:1237541-1237563 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914864 10:1237589-1237611 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914887 10:1237661-1237683 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914896 10:1237685-1237707 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914936 10:1237805-1237827 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914999 10:1237998-1238020 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915020 10:1238067-1238089 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915058 10:1238184-1238206 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915096 10:1238304-1238326 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915117 10:1238373-1238395 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915217 10:1238686-1238708 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915223 10:1238707-1238729 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915261 10:1238827-1238849 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915282 10:1238896-1238918 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915391 10:1239240-1239262 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915439 10:1239385-1239407 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915587 10:1239841-1239863 GGGAGTAAACACCGGGAGGCAGG - Intronic
1064237256 10:13587526-13587548 TGGTGGAAAGGCAGGGATGCGGG - Intronic
1065050635 10:21787981-21788003 TGGGGTAGCCTCAGGGATGAAGG - Intronic
1065325202 10:24544715-24544737 TTGGGTAAACACGAGGCTGCTGG + Intronic
1065701981 10:28434504-28434526 TGGGATAAACATACGAATGCAGG + Intergenic
1066050115 10:31626430-31626452 TGCAGTAAACATAGGTATGCAGG + Intergenic
1067541396 10:47157145-47157167 TGGGTTTCACACAGGGAAGCTGG + Intergenic
1069358241 10:67612539-67612561 TGGGGTAAACACAGGCAATAGGG + Intronic
1069979300 10:72241175-72241197 TGGGGTACAGAGAGGGAAGCAGG + Intergenic
1073498752 10:103917754-103917776 AGGGGTGAACGCAGGGATCCAGG + Intronic
1073874244 10:107902853-107902875 TAGGGGAAAGTCAGGGATGCGGG - Intergenic
1073940236 10:108689521-108689543 AGGGGTGAACACAGAGAGGCTGG - Intergenic
1074941121 10:118236670-118236692 TGTGGAAAACACGGGGATGCTGG - Intergenic
1075927509 10:126264848-126264870 TGGGGTGAGAACAGGGAAGCAGG - Intronic
1077450611 11:2641117-2641139 TGCAATAAACACGGGGATGCAGG + Intronic
1078588351 11:12614941-12614963 TGGTATAAACACAGGCATGTAGG + Intergenic
1079616925 11:22506711-22506733 TGGCGTGAACCCAGGGAGGCGGG - Intergenic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1082172011 11:49016037-49016059 TGTGGTAAATACAGGCAAGCTGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1084674676 11:70627186-70627208 TTGGGCACACACAGGGCTGCAGG + Intronic
1085303715 11:75473487-75473509 GGAGGTATACACAGGGATGCAGG - Intronic
1085543139 11:77291060-77291082 TGCAATAAACATAGGGATGCAGG - Intronic
1088441291 11:109873593-109873615 TGCAATAAACACAGGAATGCAGG - Intergenic
1090586793 11:128221859-128221881 TGGGGTAAACAAAGACATGGAGG - Intergenic
1097704568 12:62854458-62854480 TGGGGTAGTCACAGGGGTGGGGG + Intronic
1098836941 12:75434757-75434779 TGTGATAAACATATGGATGCAGG - Intergenic
1098866104 12:75765622-75765644 TGGGGTGAACACAAGATTGCTGG + Intergenic
1099004907 12:77224518-77224540 TGGGGGAACCACAGGGATTAGGG - Intergenic
1099314942 12:81072671-81072693 TGTGATAAACACACGGATGCAGG - Intronic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1101229229 12:102722641-102722663 TGAGGTAAGCACAGGCCTGCTGG + Intergenic
1101415808 12:104507136-104507158 TGGGGTAAGCTCAGGTGTGCCGG + Intronic
1102129109 12:110511270-110511292 TGCAATAAACACAGGGATGTAGG - Intronic
1103651804 12:122438686-122438708 TGAGGTTTACACAGGGATGCAGG - Intergenic
1106412492 13:29520279-29520301 TGGGGTACACTCAGGAAGGCTGG - Intronic
1109150883 13:58845893-58845915 TGGTGAAAACACAGGCATACAGG + Intergenic
1115675392 14:35667847-35667869 TGTGGTAAACACAAGAGTGCAGG - Intronic
1117348731 14:54860020-54860042 TTGGGTATACACAGGGGTCCTGG - Intronic
1117636530 14:57750341-57750363 TGTGGTAAACATAGGAGTGCAGG + Intronic
1118532680 14:66724547-66724569 AGGGGTAGATAGAGGGATGCAGG + Intronic
1119619082 14:76118209-76118231 TGGGGCCAGCAAAGGGATGCAGG + Intergenic
1119667619 14:76496548-76496570 TGGGGTCAGTACAGGGAGGCAGG + Intronic
1119906947 14:78314257-78314279 TGGGGGAAAAACAGGGATACAGG + Intronic
1121320433 14:92988647-92988669 AGGGGTACACACAGGGGTGAGGG + Intronic
1121692239 14:95886208-95886230 TGGGGGAAGCTCAGGGAAGCTGG - Intergenic
1122445870 14:101768081-101768103 AGGGGTAAGGCCAGGGATGCTGG - Intronic
1122481279 14:102049078-102049100 TGGGGCAAACAGGAGGATGCTGG - Intronic
1122775231 14:104114007-104114029 TGGGCTCAGCCCAGGGATGCCGG - Exonic
1125678346 15:41514297-41514319 TGAGGCAAACACAGAGATCCAGG - Intergenic
1126238152 15:46409729-46409751 CTTGGGAAACACAGGGATGCAGG - Intergenic
1127381426 15:58433945-58433967 TGGGGAAACCGCAGGGAAGCCGG + Intronic
1128312304 15:66638664-66638686 TGGGGGTAACAATGGGATGCTGG + Intronic
1128732464 15:70030533-70030555 TGGTGTAGACACATGGTTGCTGG - Intergenic
1129033955 15:72638750-72638772 TGTGGGAGACACAGGGATCCTGG + Intergenic
1129215927 15:74098466-74098488 TGTGGGAGACACAGGGATCCTGG - Intergenic
1129689163 15:77703592-77703614 TGGGGTGATGTCAGGGATGCTGG + Intronic
1129690347 15:77709839-77709861 AGGGGTAAACACAGGGAAGGTGG + Intronic
1129885128 15:79032078-79032100 TGGGGTAGAGTCAGGGAGGCAGG - Intronic
1131402050 15:92133106-92133128 TGGGGAGAGCCCAGGGATGCTGG - Intronic
1131986031 15:98043625-98043647 CTGGGTAAACTCAGTGATGCCGG + Intergenic
1132146235 15:99431655-99431677 TGGGGACAGCACAAGGATGCTGG + Intergenic
1132665594 16:1080099-1080121 TGGGGTAGACACAGGGCAGTAGG + Exonic
1134450018 16:14357683-14357705 TGGGGCAAAGACTGGGAGGCAGG - Intergenic
1135166960 16:20147735-20147757 TGGGGAAGACACAAGGATGCAGG - Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1138300732 16:55927814-55927836 TGTGGTAAACATATGAATGCAGG - Intronic
1140495052 16:75378779-75378801 TGGGGTAAAAACAAAGATACTGG + Intronic
1141398437 16:83725231-83725253 TGGGATAAACAAAGGCATGGTGG + Intronic
1141842423 16:86581812-86581834 AGGGGTAAACACACAGATGGAGG + Exonic
1141988373 16:87594565-87594587 TGGGGTGACAACAGGGAGGCAGG + Intergenic
1142074917 16:88112136-88112158 TGCAGTAAACACAGGCGTGCCGG + Intronic
1142307013 16:89291319-89291341 TGGGGAAAGCACAGCGGTGCTGG + Intronic
1142570954 17:873856-873878 TGGGGGAAACACACGGGTTCTGG + Intronic
1144763037 17:17718072-17718094 TGGGGTCTGCACAGGAATGCTGG - Intronic
1145799659 17:27674711-27674733 TGGGATACACATAGGGATGGAGG + Intergenic
1145994358 17:29096997-29097019 AGGGGAAGACCCAGGGATGCAGG + Intronic
1146839057 17:36136879-36136901 TAGGATAACCACAGGGAAGCAGG + Intergenic
1149564223 17:57630056-57630078 TGGGGCAGGCCCAGGGATGCAGG - Intronic
1152566113 17:81101143-81101165 TGCCGGAAACACAGGGCTGCAGG - Intronic
1158736036 18:60080964-60080986 TGCAATAAACACAGGGAGGCAGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160462147 18:79047462-79047484 TGGGGTCAACCCCGGGAAGCCGG - Intergenic
1162532764 19:11245429-11245451 TGGGGGAAACACAGGCAGGGAGG - Intronic
1162548353 19:11344701-11344723 TGGGGGATAGACAGGGCTGCTGG + Intronic
1162767429 19:12928516-12928538 TGGGGTGAGCACAGGGCTGGGGG - Exonic
1164531637 19:29052900-29052922 TGTGGTAAACACATGAGTGCAGG - Intergenic
1164574021 19:29394973-29394995 TGGGGGTGTCACAGGGATGCTGG + Intergenic
1164608024 19:29613804-29613826 TGGGGGAACCACAGAGAAGCAGG - Intronic
1166094044 19:40528883-40528905 TGGGGCAAAGCCAGGGACGCAGG - Intronic
1166298621 19:41902046-41902068 TGGGGTACACAGAGGGACCCTGG - Intronic
1166511232 19:43410295-43410317 TGGGGTAAACAAATGCATGGGGG + Intronic
1168376277 19:55882607-55882629 TCCAGTAAACACATGGATGCAGG + Intergenic
925188598 2:1865814-1865836 TGTTGTAAACACAGTGCTGCTGG - Intronic
926564218 2:14452315-14452337 TGGGGTAAATCCAGGGTAGCAGG - Intergenic
927142712 2:20140862-20140884 AGGGGTCAGCAAAGGGATGCTGG + Intergenic
927361335 2:22237655-22237677 TGGCGTAAACAAAGGTAAGCAGG + Intergenic
928293442 2:30060605-30060627 TAGGGAAAACACAGTGATTCTGG + Intergenic
932492102 2:72128711-72128733 TGGGTTAAACACAGTCATCCCGG - Intergenic
932572443 2:72945202-72945224 TGGGGTGGACACGGGGGTGCAGG - Intronic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
935339008 2:102043131-102043153 TGAGGTAAAGACTTGGATGCAGG + Intergenic
936980157 2:118256491-118256513 GTGGGTAAACACATGGCTGCAGG + Intergenic
937369724 2:121288847-121288869 TGGGGTGAAGAAAGGAATGCCGG - Intergenic
937439662 2:121905305-121905327 TGGGGTCAACAGGGGCATGCTGG + Intergenic
937477709 2:122229798-122229820 TGGGGGAAACTGAGGCATGCAGG - Intergenic
937478922 2:122239494-122239516 CTGGATAAACACGGGGATGCTGG + Intergenic
937951878 2:127394493-127394515 TGGGGCATACACAGGAATGGTGG + Intergenic
939134211 2:138274419-138274441 TGGGGGAAACACAGTGAGCCAGG + Intergenic
939371246 2:141303717-141303739 TGCAGTAAATACAGAGATGCAGG + Intronic
944198502 2:197080766-197080788 TGGAGTAGACACAGGCATTCGGG + Intronic
945273453 2:207964410-207964432 TGGGGTAGACACACTGGTGCTGG + Intronic
946724286 2:222646927-222646949 TGGGCCAAACACAGCGATGCTGG + Intronic
947449548 2:230194603-230194625 TGGAGTAGACACATGCATGCAGG + Intronic
1168871229 20:1130444-1130466 TGGCTGAAGCACAGGGATGCGGG - Intronic
1169895229 20:10498264-10498286 AGCTGTAAACACAGGGAGGCAGG - Intronic
1170757263 20:19214972-19214994 CGGGGGCAACACAGGGAGGCTGG - Intronic
1172409736 20:34712020-34712042 TGGGGTATCCCCATGGATGCTGG + Exonic
1172580401 20:36042909-36042931 TTGGGTATACCCAGGGATTCTGG + Intergenic
1174977114 20:55348621-55348643 TGGGGAAAACACAGGGCTTGTGG + Intergenic
1175285076 20:57832381-57832403 TGGGGTGAGCCCAGGGACGCTGG + Intergenic
1178438119 21:32577287-32577309 TGAGTTAATCACAGGCATGCGGG - Intronic
1178705244 21:34867818-34867840 TGGGGGAAGCACAGGGCAGCAGG - Intronic
1180798659 22:18620873-18620895 TGGGGGAGTCACAGAGATGCTGG + Intergenic
1180877247 22:19180327-19180349 TGGGGCAAACACAGGCCTGAGGG - Intronic
1181223055 22:21374391-21374413 TGGGGGAGTCACAGAGATGCTGG - Intergenic
1181255683 22:21561243-21561265 TGGGGGAGTCACAGAGATGCTGG + Intronic
1181509715 22:23383721-23383743 TGGGGAAAAGGCAGGGAAGCCGG + Intergenic
1182145475 22:27994468-27994490 TACAGTAAACACTGGGATGCCGG + Intronic
1182185518 22:28397893-28397915 TGGGATACACCCAGGGATCCTGG - Intronic
1182444446 22:30381937-30381959 TGGGGTAAGCACAGAGCTGGTGG - Intronic
1182892230 22:33828635-33828657 TGGGGAAACCACAGGGGTGCTGG - Intronic
1182907866 22:33954039-33954061 TGGGTTAATCACATGGATGTTGG + Intergenic
1182913875 22:34010172-34010194 TGTGGTATACACAGGGATCCTGG + Intergenic
1185335195 22:50268154-50268176 TGGGGTGAACACACGCATGGTGG - Intronic
950141313 3:10617926-10617948 TGGGGTCAACACAGCGATAAGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952182887 3:30937120-30937142 TGGTGTAAAAATAGGCATGCAGG - Intergenic
953980970 3:47412869-47412891 TGGGGTAGACTCTGGGAGGCTGG - Exonic
954148022 3:48643885-48643907 TGGGGAAAACACAGGGGTATGGG + Intronic
954897252 3:53986461-53986483 TGGGGCCAAGACAGGGATGCAGG - Intergenic
956050102 3:65238605-65238627 TGGGGTGAAGACAGGGAGGGAGG - Intergenic
961035395 3:123638261-123638283 TGGGGTCAACACACAGATTCGGG - Intronic
961168462 3:124779594-124779616 GGTGGTTAACACAGGGATTCTGG + Intronic
961190250 3:124954485-124954507 TGTGATAAACACATGCATGCAGG + Intergenic
962973702 3:140427963-140427985 TGTGGTCCACAAAGGGATGCAGG - Intronic
963100441 3:141597471-141597493 TGGGGTATAAACAGGCATGAGGG + Intronic
963918662 3:150884895-150884917 AGGGGTGTACACAGAGATGCTGG - Intronic
964218537 3:154317733-154317755 TGGGGAAAAAAGAGGGAAGCAGG + Intronic
965872965 3:173282085-173282107 TGTGATAAACACATGAATGCAGG - Intergenic
967006132 3:185384415-185384437 TGCAGTAAACATGGGGATGCAGG + Intronic
970631912 4:17956349-17956371 TGCAGTAAACATGGGGATGCAGG - Intronic
970793063 4:19881799-19881821 TGCAGTAAACACAGGCATGAAGG - Intergenic
977330363 4:95629686-95629708 AGAGTTAAACACAGGGATCCAGG - Intergenic
979762807 4:124427830-124427852 TGGGGAAAATACAGAGATGTTGG + Intergenic
979930467 4:126623944-126623966 TGGGGTAAACATGTGGGTGCAGG - Intergenic
980495819 4:133586821-133586843 TGGGGTAGACCCAGAGAAGCAGG - Intergenic
981232391 4:142371975-142371997 TGTGATAAACACGTGGATGCAGG - Intronic
981920085 4:150078023-150078045 TGGGGTCCTCACTGGGATGCTGG + Intergenic
983206504 4:164915940-164915962 TGGGCCAAACACAGTGATGCTGG - Intergenic
983212119 4:164969606-164969628 TGGGCCAAACACAGTGATGCTGG + Exonic
985052402 4:186005057-186005079 TGCGATAAACATGGGGATGCAGG + Intergenic
985209250 4:187574100-187574122 TGTGATAAACACAGGAGTGCAGG + Intergenic
986743938 5:10727777-10727799 TGTGGTATCCACAGGGGTGCTGG - Intronic
986891229 5:12309558-12309580 TGGGGGACAGACAGTGATGCGGG + Intergenic
988389392 5:30607823-30607845 TGGGATCAACACATGGATGGAGG + Intergenic
991024084 5:62011167-62011189 AGGAGTATACACAGGGAAGCAGG + Intergenic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
994026519 5:95090817-95090839 TGGGCTAAAGACAGAGATGTGGG - Intronic
997906678 5:137823826-137823848 TGCAGTGAACACAGGAATGCAGG - Intergenic
999310103 5:150546417-150546439 TGGCATAATCACAGGAATGCTGG - Intronic
1001127490 5:169033391-169033413 TGCAGTGAACACAGGCATGCAGG + Intronic
1001535927 5:172497842-172497864 GGGGGTGAACATGGGGATGCTGG - Intergenic
1004806695 6:19210816-19210838 TGGTGCAAACACATGAATGCTGG - Intergenic
1004876137 6:19956810-19956832 TTGGGTAAAAACAGGGGAGCAGG + Intergenic
1005033385 6:21532568-21532590 TTGGAAAAACACAGTGATGCAGG + Intergenic
1006268850 6:32948870-32948892 TGGGGGAGAGACAGGGATGGAGG + Intronic
1006767007 6:36515251-36515273 TGGGATGACCACAGGGGTGCAGG + Intronic
1007295582 6:40818394-40818416 TGGGGTAAGCCCAGGGATGTGGG + Intergenic
1007843504 6:44735700-44735722 TTGGGAAAACACAGGCATGGAGG + Intergenic
1008500582 6:52177416-52177438 TGTAGTACACACAGGGATGCTGG - Intergenic
1011344019 6:86349041-86349063 TGCAGTAAACACGGGAATGCAGG - Intergenic
1012987710 6:105892772-105892794 TGGGGTTGACACTGGGAGGCTGG - Intergenic
1013906186 6:115222609-115222631 TGGGGTCTACAGAGGCATGCAGG - Intergenic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1015787554 6:136933322-136933344 TTGGGTAAAAACAGGAGTGCAGG - Intergenic
1016516469 6:144897812-144897834 TGGGGTAAAGAAAGGAAGGCTGG - Intergenic
1017788014 6:157772435-157772457 GGGGCCAAACACAGGGATGAAGG + Intronic
1017818257 6:158030494-158030516 TGGGATGGACACAGGGATGTGGG - Intronic
1018516537 6:164585803-164585825 TGAGGTGGAAACAGGGATGCTGG + Intergenic
1018636923 6:165870645-165870667 TGCAAGAAACACAGGGATGCAGG - Intronic
1022691243 7:32657326-32657348 TGGGGAAAACACAGTGCTGCTGG + Intergenic
1022918806 7:34991234-34991256 TGGGGAAAACACAGTGCTGCTGG + Intronic
1023367326 7:39476788-39476810 TGGGAGAAACACAGTGATGCTGG - Intronic
1024542259 7:50486391-50486413 TGAGGAAAAAACAGGGATGTGGG + Intronic
1025016673 7:55444632-55444654 TGGGGTGAACACATGGGAGCTGG - Intronic
1026569762 7:71519194-71519216 CCAGATAAACACAGGGATGCAGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029518878 7:101047370-101047392 TGGGGTAAAGTCAAGCATGCTGG + Intronic
1029571735 7:101374303-101374325 TGGGGCAAACAAGGAGATGCAGG - Intronic
1032305405 7:130729408-130729430 TTTGGTATACACAGGGATCCTGG - Intergenic
1033447064 7:141432454-141432476 TGGGATAAAAATAGTGATGCAGG - Intronic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1034082161 7:148289054-148289076 TGGGGTAATCAAAGGGAGACAGG - Intronic
1035479168 7:159168382-159168404 TGTGGTAAACATGGGGGTGCAGG - Intergenic
1039234184 8:35483909-35483931 TGTGGTTAACACAGGGCTGCTGG + Intronic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042901457 8:73732422-73732444 TGGTGTAAATATCGGGATGCCGG + Intronic
1045948968 8:107830078-107830100 AGGGGTAGACACAGGGAGGGAGG + Intergenic
1048854182 8:138672708-138672730 TGGGGCAAAGGCAGGGAAGCAGG + Intronic
1050764533 9:9115670-9115692 TGTGATAAACATAGGCATGCAGG - Intronic
1052302275 9:26966136-26966158 TGTGATAAACATAGGAATGCAGG + Intronic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1057552591 9:96063117-96063139 TGGGGTAAACACAGACAGGTGGG - Intergenic
1058058980 9:100474927-100474949 TGGGGCAAAGACAGGCATTCAGG + Intronic
1058342153 9:103911621-103911643 TGGGGTAAACTGATGGATTCAGG + Intergenic
1058693462 9:107538910-107538932 TGGGGTAAGTTCAGGGATGGAGG + Intergenic
1061087800 9:128409402-128409424 TGGGGCAGACAAAGGGCTGCGGG - Intergenic
1061116124 9:128613482-128613504 TGAGGTAAGCAAAGGGAGGCGGG + Exonic
1061664725 9:132153894-132153916 TGGAGTAAACACAGACGTGCAGG - Intergenic
1061972795 9:134053878-134053900 TGGGGAACACACTGGGAGGCAGG + Intronic
1062300343 9:135863873-135863895 AGGGGGGAACACAGGCATGCGGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1203761226 EBV:13643-13665 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203762155 EBV:16715-16737 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203763084 EBV:19787-19809 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764013 EBV:22859-22881 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203764942 EBV:25931-25953 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203765871 EBV:29003-29025 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203766800 EBV:32075-32097 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1203767729 EBV:35147-35169 TGGGGTGGACACAGGGGGGCGGG - Intergenic
1185570357 X:1130320-1130342 TCTGGTAAACACAGGGACCCAGG + Intergenic
1186415814 X:9382302-9382324 TGGGTTGAACACAGGCAGGCTGG - Intergenic
1187148279 X:16657405-16657427 TGATGTAAGCACAGGGATGGTGG + Intronic
1187844097 X:23518850-23518872 GGTGGTGACCACAGGGATGCTGG - Intergenic
1188453500 X:30335275-30335297 TGGGGTAAACACTGGCGAGCAGG + Intergenic
1192182237 X:68923306-68923328 TGAGGTAAAAACACGGAGGCAGG - Intergenic
1196780962 X:119383816-119383838 AGGGGTAAACCCAAGGATACAGG + Intergenic
1197027396 X:121770352-121770374 TGTGGTAAACACATGAGTGCAGG + Intergenic
1197297379 X:124735627-124735649 TGTGATAAACACATGCATGCAGG - Intronic
1197607672 X:128604464-128604486 TGGGGTAAACAAAATGATGAGGG - Intergenic
1197758969 X:130014697-130014719 GGGGGTCAACACAGGCATGGGGG - Exonic
1199767600 X:150952480-150952502 TTGGGGAAACTCAGGAATGCTGG + Intergenic