ID: 932884957

View in Genome Browser
Species Human (GRCh38)
Location 2:75541303-75541325
Sequence GGGCCCTAGCACCAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932884952_932884957 14 Left 932884952 2:75541266-75541288 CCAGTTTTCAGACTCTAGATTCT 0: 1
1: 0
2: 1
3: 14
4: 251
Right 932884957 2:75541303-75541325 GGGCCCTAGCACCAGCCTGGAGG 0: 1
1: 1
2: 3
3: 28
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932884957 Original CRISPR GGGCCCTAGCACCAGCCTGG AGG Intronic
900031957 1:378783-378805 GGGCCCTTGCACCAGGCAGGAGG + Intergenic
900052505 1:606969-606991 GGGCCCTTGCACCAGGCAGGAGG + Intergenic
900408780 1:2503720-2503742 GGGCCCCAGCAGCAGCAGGGTGG + Intronic
900609043 1:3536748-3536770 GGGTCCTGGCAGGAGCCTGGTGG - Intronic
900794080 1:4697598-4697620 TGGACCTGGCACCAGCCTGTGGG - Intronic
902576600 1:17381836-17381858 GGGCCCTAGCAAAAGGCAGGGGG + Intronic
903698985 1:25232290-25232312 AGGCCCTAGGCCCAGCCTGTGGG - Intronic
904340048 1:29828612-29828634 GGCCCCGAGCCACAGCCTGGGGG - Intergenic
904463131 1:30692347-30692369 GAGCCCTCGCACAAGCCTGGGGG + Intergenic
904804082 1:33118795-33118817 GGATCCCAGCACTAGCCTGGTGG - Intronic
906107529 1:43303878-43303900 GGACCCCTGCTCCAGCCTGGGGG - Intronic
909514097 1:76488124-76488146 AGGCCCTAGCTCCAACATGGGGG - Intronic
909565017 1:77044347-77044369 GGGCAATCGCACCAGCCTGAGGG + Exonic
910183064 1:84506286-84506308 GGCCCCGAGCGCGAGCCTGGAGG + Exonic
912433190 1:109640523-109640545 GGCCCCACTCACCAGCCTGGTGG + Intergenic
912698047 1:111856018-111856040 GGGTCCTGGCAAGAGCCTGGAGG - Intronic
916610460 1:166386554-166386576 AGGCCCTAGCAGCTTCCTGGAGG - Intergenic
918602144 1:186375882-186375904 GGGCCCAAGTACCAGCCTCTAGG - Exonic
919317292 1:195988328-195988350 AGGCCCTACCACCAGCATTGGGG - Intergenic
920230729 1:204467997-204468019 CTGCCCTGGCACCTGCCTGGGGG + Intronic
922241161 1:223756228-223756250 GTGCCCCAGCCCCAGCCTGAGGG - Intronic
924611695 1:245578765-245578787 GGCACCTTGGACCAGCCTGGTGG - Intronic
1066126436 10:32347050-32347072 GGGCACTAACACCAGCCGGGAGG + Exonic
1067290321 10:44935133-44935155 GAGCGCTTGCTCCAGCCTGGAGG + Exonic
1069381165 10:67844273-67844295 AGGCCCTAGCTCCAGCATTGGGG - Intergenic
1072003655 10:91221102-91221124 GGGCCCGCGCACCTGCCGGGCGG + Intronic
1075724349 10:124603918-124603940 GGGCCTTAGCAGCTGCCTGGGGG - Intronic
1076494044 10:130885261-130885283 GGACCCCAGCACCAGCTGGGTGG - Intergenic
1076831419 10:132996292-132996314 GGGCCGTGGCACCAGCTTGTGGG - Intergenic
1077103796 11:833296-833318 GGGCCCTTGGACCGGCCTGACGG + Intronic
1077191738 11:1258593-1258615 GGCTCCCAGCAACAGCCTGGGGG + Intronic
1077328836 11:1975141-1975163 AGGCCCCAGCACCACCTTGGAGG - Intronic
1081616785 11:44596082-44596104 CGGCCCTAGCTCCCTCCTGGAGG + Intronic
1081667568 11:44925467-44925489 GTGTCCTAGTACCTGCCTGGAGG - Intronic
1084419608 11:69053732-69053754 GGGCCCTGGCACCAGCGTCGGGG - Intronic
1091282676 11:134390953-134390975 GGGCCCTAGCACCTGCTTGGAGG + Exonic
1202811815 11_KI270721v1_random:30320-30342 AGGCCCCAGCACCACCTTGGAGG - Intergenic
1092126230 12:6076956-6076978 GGGCCCTAGCACCAGGCATTGGG - Intronic
1096293811 12:50365942-50365964 GGGCCCTCGCCCCAGCAAGGTGG + Intronic
1097248518 12:57619884-57619906 AGGCCCTAACAGCAGCCTGTCGG + Intronic
1102511415 12:113418130-113418152 GTGCCCCAGCTCCAGCCAGGGGG + Intronic
1102541984 12:113627486-113627508 AGGCCCCAGCTCCAGCATGGGGG + Intergenic
1102776046 12:115519877-115519899 GGGCCCATGCACCAGTGTGGAGG + Intergenic
1102915614 12:116749975-116749997 GGAGCCCAGCACCAGGCTGGAGG - Exonic
1102975319 12:117202769-117202791 AGGCAATACCACCAGCCTGGAGG + Intergenic
1103901731 12:124306965-124306987 AGGCACGAGCACCAGTCTGGAGG + Intronic
1103949989 12:124545310-124545332 GGCCTCTGGCCCCAGCCTGGTGG - Intronic
1106157504 13:27171821-27171843 GGGCCCCAGCCCCCGCCTGCCGG + Exonic
1106593964 13:31121374-31121396 CTGCCCCAGCAGCAGCCTGGTGG - Intergenic
1109045778 13:57409240-57409262 ATGCCCTAGCAGCAGCCTGGTGG + Intergenic
1110011484 13:70339892-70339914 GGGCCCTAGAACCAATCTGTGGG + Intergenic
1113940728 13:114017419-114017441 GGCCCCGAGCACCTGCCTGTGGG + Intronic
1118006568 14:61568837-61568859 TGCCCCAGGCACCAGCCTGGGGG - Intronic
1119665300 14:76481074-76481096 GGGCCCCAGCACCATGCTTGGGG + Intronic
1119764718 14:77181328-77181350 AGGTCCTGGCACCAGCCTAGTGG - Intronic
1121410469 14:93745481-93745503 GGCCCCCAGCCCCAGCCTGGTGG + Intronic
1122967740 14:105139114-105139136 GGGGCCTAGCACCAGCCTGGGGG + Intergenic
1122972528 14:105158215-105158237 GGGCCCCATCACCACGCTGGCGG + Intronic
1123017662 14:105383083-105383105 GGGCGGGAGCAGCAGCCTGGTGG + Intronic
1123056941 14:105575165-105575187 GAGCCCTCACACCTGCCTGGGGG - Intergenic
1123081269 14:105696620-105696642 GAGCCCTCACACCTGCCTGGGGG + Intergenic
1124612514 15:31217821-31217843 GGGACCTTACACCAGCCTGCCGG + Intergenic
1129110507 15:73334428-73334450 AGCCCCCAGCACCAGCCGGGGGG + Intronic
1129521904 15:76191524-76191546 GGGCCCCCGTCCCAGCCTGGGGG - Intronic
1129694049 15:77730624-77730646 GGGCCACAGCATCAACCTGGGGG + Intronic
1129877228 15:78983629-78983651 GGGCCCTTGCCACAGTCTGGGGG - Intronic
1131118584 15:89809215-89809237 GTGCCCCAGTGCCAGCCTGGGGG - Intronic
1132730146 16:1357048-1357070 GGGCCCTAGGGCCAGACTGGAGG + Intronic
1132893170 16:2214486-2214508 GGGGCCCGGCGCCAGCCTGGAGG - Exonic
1132947780 16:2541570-2541592 TGGCCCTCGCACCTGCTTGGGGG - Intronic
1133060346 16:3170788-3170810 GGGCCCAAGGCCCCGCCTGGTGG + Intergenic
1133245060 16:4443158-4443180 GGGCCCAAGCACCCACCTGCAGG - Exonic
1133304953 16:4802785-4802807 GAGCCCTGGAACCAGACTGGCGG + Exonic
1135569308 16:23536069-23536091 GGCCCCTAGCATCAGCCTCTTGG + Intronic
1137036824 16:35575225-35575247 GGGGCCCTGCACCAGCGTGGAGG - Intergenic
1138989034 16:62368012-62368034 AGGCCCTACCACCAACCTTGGGG - Intergenic
1139517516 16:67460554-67460576 GGGCCCTGGCAGAGGCCTGGGGG - Intronic
1140206425 16:72937296-72937318 GGGCTCTGGGACAAGCCTGGGGG + Intronic
1140686117 16:77435145-77435167 ACGCCCTTGCACCAGCCCGGGGG - Intergenic
1140760254 16:78103033-78103055 GGGCCCTAGCGCCAGGCTCCAGG - Intronic
1140818034 16:78638632-78638654 GTGCCCCAGCAGCAGGCTGGAGG + Intronic
1141675111 16:85513705-85513727 GGGGCCTTGCACCAGGCAGGAGG - Intergenic
1144633627 17:16889131-16889153 GGGCCCTTCCACCAGCTGGGGGG - Intergenic
1144779739 17:17801783-17801805 GGGCCCCTACTCCAGCCTGGAGG + Intronic
1145005746 17:19336829-19336851 GGGCACTAGGACCAGGCTGGTGG - Intergenic
1146669982 17:34730555-34730577 GGGCTCTGGCATCAGCTTGGTGG + Intergenic
1146692679 17:34887546-34887568 GTGCCCAAGCAGCACCCTGGTGG - Intergenic
1147376747 17:40027116-40027138 GGGCTGGAGCAGCAGCCTGGCGG - Intronic
1147446047 17:40475903-40475925 AGGCCCCAGTCCCAGCCTGGGGG - Exonic
1148384972 17:47227934-47227956 GGGCCCTTCCACCACCCTGAGGG + Intergenic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1148983586 17:51600668-51600690 AGGCCCCATCACCAGCATGGGGG - Intergenic
1149519163 17:57305214-57305236 GGGCCCGAGCATCTGTCTGGTGG + Intronic
1151190283 17:72393237-72393259 GGGCCTGAGCATCAGTCTGGGGG + Intergenic
1151262905 17:72930759-72930781 GGGCCCTAGCAACAGACCAGTGG + Intronic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151969246 17:77449458-77449480 GGGCCCTGGGAAAAGCCTGGGGG + Intronic
1152293977 17:79456106-79456128 GGGCCCCAGCCCAAGCCTGAAGG + Intronic
1152552022 17:81034821-81034843 GGGCCCTGGGAGCAGCCTGAGGG - Intergenic
1152758354 17:82096542-82096564 GGGGCCAAGCACCACCCTGAGGG + Intronic
1152947696 17:83206931-83206953 GGGCCCTTGCACCAGGCAGGAGG - Intergenic
1156291519 18:35752164-35752186 GGGCCACAGGACCAGCTTGGTGG + Intergenic
1156347776 18:36273484-36273506 CGGCCTTAGCACCAGCCTGGTGG + Intergenic
1157581256 18:48775540-48775562 GGGCCCTGGGACTGGCCTGGAGG + Intronic
1158339297 18:56448240-56448262 GGGCCCTAGGAGCAGCTTAGAGG - Intergenic
1160887991 19:1360898-1360920 GGGCCCTGGCCCCGGCCCGGGGG - Exonic
1160987347 19:1845165-1845187 GGGCCTTGGCTGCAGCCTGGTGG - Intronic
1161065037 19:2233335-2233357 GGGCCATGCCACCAGCCTGGGGG + Exonic
1161435183 19:4258756-4258778 ATCCCCTAGCACCAGCCTGGAGG + Intronic
1161644894 19:5447158-5447180 AGGCACTTGCCCCAGCCTGGCGG - Intergenic
1161698780 19:5784097-5784119 GGGGCCCAGCCCAAGCCTGGGGG + Exonic
1162410378 19:10502216-10502238 GGGCCTTGGCACCAGAGTGGGGG - Intronic
1162968032 19:14165022-14165044 GGGACCTGGCACCGGCTTGGGGG + Intronic
1166888322 19:45974177-45974199 GGGTCCTCCCAGCAGCCTGGGGG - Intergenic
1166939357 19:46353483-46353505 GGGCACTAGCAGCAGACTGAGGG - Intronic
1167516055 19:49923820-49923842 GGGCCCTAGAGCCAGCCTGCTGG - Intronic
1167661483 19:50798345-50798367 GGGTCCCAGCATGAGCCTGGTGG + Exonic
1168344573 19:55643974-55643996 GGGACCTAGAACGAGCCTGGTGG + Intronic
1168706883 19:58475548-58475570 TGGCCCTCGCACCCTCCTGGCGG + Intronic
925045976 2:773571-773593 GGGCACTGGCACCAGGCTGTGGG - Intergenic
927137997 2:20111438-20111460 GGGGCCTAGGCCCAGCCTCGAGG + Intergenic
927477301 2:23423631-23423653 GAGGCCTAGCCTCAGCCTGGCGG + Intronic
931427119 2:62181303-62181325 TGGAAATAGCACCAGCCTGGGGG + Intergenic
932592289 2:73074722-73074744 AGTCCCAAGCCCCAGCCTGGAGG + Exonic
932884957 2:75541303-75541325 GGGCCCTAGCACCAGCCTGGAGG + Intronic
936977303 2:118232698-118232720 GGGCCCTAGAAACAGCCCAGTGG - Intergenic
937228180 2:120381785-120381807 GGGCCTTAGCCCTGGCCTGGGGG + Intergenic
938315067 2:130319310-130319332 GGGCTCTTGTCCCAGCCTGGAGG + Intergenic
941901740 2:170685710-170685732 TGGCAGTAGCAGCAGCCTGGAGG + Intergenic
942044464 2:172091233-172091255 GGGCCCTAGCTGCCGTCTGGGGG - Intergenic
942308879 2:174635315-174635337 GGAACCCAGCACCATCCTGGAGG - Intronic
943879492 2:193122226-193122248 TGGCCCTAGCTCTAGCCTTGTGG + Intergenic
944673339 2:202014855-202014877 GAGCCCTCGCACAAGCCTTGCGG + Intergenic
947745147 2:232503488-232503510 GGGGCCTGGCGCCCGCCTGGTGG + Intergenic
948094709 2:235324530-235324552 GGGCCCCAGCACAGGGCTGGAGG + Intergenic
1169410233 20:5362593-5362615 GGGTCCTAGCTCCATCCAGGGGG + Intergenic
1171458554 20:25285600-25285622 GGGAGCGAGCACCAGCCTGTTGG - Intronic
1172649635 20:36493584-36493606 GGGCCCTGGGACCAGTCTGCAGG - Intronic
1172950815 20:38722672-38722694 AGCCCCTAGCTCCTGCCTGGTGG - Intergenic
1174098508 20:48108510-48108532 GGGTCCAAGCATCAGCCTCGGGG - Intergenic
1174252291 20:49228784-49228806 GGGCACTAGCACCAGCACGCGGG - Exonic
1175443425 20:59005870-59005892 GGTCACTACCTCCAGCCTGGTGG - Intronic
1175899598 20:62354799-62354821 AGGCCCTGTCACAAGCCTGGAGG + Intronic
1176383871 21:6127401-6127423 GGTCCCTGGGCCCAGCCTGGAGG + Intergenic
1177310504 21:19386326-19386348 GGGAGCTAGCAGCAGCCTGGAGG - Intergenic
1179262825 21:39773594-39773616 GGACACCAGCACCAGCTTGGAGG - Intronic
1179633045 21:42690578-42690600 AGGCGCAGGCACCAGCCTGGGGG - Intronic
1179711045 21:43263309-43263331 GGACACTGGCACCTGCCTGGGGG + Intergenic
1179739602 21:43410837-43410859 GGTCCCTGGGCCCAGCCTGGAGG - Intergenic
1180045400 21:45302833-45302855 GGGCTCCAGCAGCAGCCAGGCGG - Intergenic
1180047885 21:45318196-45318218 AGCCCCTAGGACCAGCCTGGAGG - Intergenic
1180085108 21:45504882-45504904 GGGCCCCAGCTACTGCCTGGGGG + Intronic
1181956191 22:26589644-26589666 GCGCCCTGGCGCCCGCCTGGGGG + Intronic
1182687619 22:32133096-32133118 GGGCTGCAGCTCCAGCCTGGGGG - Intergenic
1182771143 22:32797165-32797187 GCCCCCTAGCACCAGCCAGCGGG + Intronic
1183098819 22:35570870-35570892 GGGCCTTGGCACCACCTTGGAGG + Intergenic
1183185350 22:36288630-36288652 GGGCCCTAACACAATCCAGGTGG + Intronic
1183232207 22:36590085-36590107 GGGCCCCAGCTGCATCCTGGTGG + Intronic
1183370221 22:37427796-37427818 GGACCCGAGCCCCGGCCTGGCGG + Intergenic
1183476926 22:38040762-38040784 GGGCACTGGCACCTGCCTGGTGG + Intronic
1184076876 22:42185859-42185881 GGGCTCTGGCACCAGCCTCTGGG + Intronic
1184608756 22:45589517-45589539 GTGGCCTTGCTCCAGCCTGGGGG + Intronic
1185169775 22:49286041-49286063 GGGCGCTAACCCCACCCTGGGGG + Intergenic
950424148 3:12915545-12915567 GGGCCCCAGCACCACCCGGGCGG - Intronic
954316789 3:49805836-49805858 GGTCCCTAGCCCCAGCCTCCAGG + Intronic
956690411 3:71873234-71873256 GGGCCCCTTCACCAGCCTGAGGG + Intergenic
961335842 3:126179341-126179363 GGGCCCTAGCACCAGAACAGAGG - Intronic
961660443 3:128466007-128466029 GGGCCCTGGCAGCTGCCTGTAGG - Exonic
961741670 3:129036876-129036898 GGGCCTCAGCACCAGCCTCGGGG + Intronic
961760308 3:129162221-129162243 GCACCCTAGCAGCAGCCAGGAGG + Intergenic
962968152 3:140373025-140373047 GAGCCATTGCACCATCCTGGGGG + Intronic
964612191 3:158626901-158626923 GGGACCTTGGACCAGCCAGGGGG + Intergenic
966466883 3:180239128-180239150 AGGACTTAGCACCTGCCTGGTGG + Intergenic
968130958 3:196192565-196192587 GGGCCCCGCCTCCAGCCTGGTGG + Intergenic
968518890 4:1026893-1026915 GGGCAGAAACACCAGCCTGGAGG - Intronic
968623150 4:1613386-1613408 GGGCCCTAATCCCAGCCAGGAGG + Intergenic
968646972 4:1746065-1746087 GGACCCCAGCACCAGCCAGAGGG + Intergenic
968689594 4:1983797-1983819 GGGCCGTACCACCTACCTGGTGG + Intronic
968903602 4:3442095-3442117 GGGTTCCAGCCCCAGCCTGGCGG + Exonic
968919642 4:3515804-3515826 GGGACCCAGCCACAGCCTGGGGG - Intronic
968960353 4:3740133-3740155 GGGCCCAAGGACCAGGCTGAGGG - Intergenic
972341476 4:38155727-38155749 GAGCCCTAGCACCCTCCCGGTGG - Intergenic
978503608 4:109434030-109434052 GGGGCCTAGCACCGGCTGGGCGG + Intronic
981669875 4:147274959-147274981 GGGCTGCAGGACCAGCCTGGTGG + Intergenic
981770144 4:148299524-148299546 GTGCCCCAGCTCCAGCCAGGAGG - Intronic
984615216 4:181889212-181889234 GGGGCTTAGCACCATCCTCGTGG + Intergenic
985946438 5:3188267-3188289 GGGCCTTTCCACCACCCTGGGGG - Intergenic
992098280 5:73381962-73381984 GGGGTCTCGCACCAGCCGGGAGG - Intergenic
992106249 5:73451316-73451338 GGTCCCTTGTACCAGCTTGGGGG - Intergenic
992758695 5:79932881-79932903 GTCCCCTAGCTCAAGCCTGGGGG + Intergenic
997253712 5:132410993-132411015 GGGCCCGCGCTCCAGGCTGGCGG - Exonic
997399424 5:133591083-133591105 GGGCACTGGCACCAGGATGGAGG + Intronic
997473793 5:134131215-134131237 GGGCCCTGGCACTGACCTGGTGG + Intronic
1000233410 5:159336009-159336031 GGGCCACAGCACCAGGCTTGAGG - Intergenic
1000652453 5:163833727-163833749 GGGCCATAGACCCAGCGTGGTGG - Intergenic
1002066528 5:176654720-176654742 GGGCCCAACCTCCAGGCTGGTGG - Intronic
1002173144 5:177386336-177386358 GGGCCCTACCTCCAGCCAGCTGG - Exonic
1002741863 5:181440085-181440107 GGGCCCTTGCACCAGGCAGGAGG - Intergenic
1003099182 6:3164125-3164147 GAGCCATTGTACCAGCCTGGGGG - Intergenic
1003265261 6:4560307-4560329 GGGTCCTGGCAGCAGGCTGGCGG - Intergenic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1012797162 6:103776958-103776980 GGGCCCTAGAAACAGCATGTAGG + Intergenic
1012963433 6:105646993-105647015 GGACCCAAGCAGAAGCCTGGGGG + Intergenic
1017149614 6:151266972-151266994 GCGCCACTGCACCAGCCTGGCGG + Intronic
1019056482 6:169227231-169227253 GGGGCCGAGCTCCAGCGTGGAGG + Intronic
1019247004 6:170715842-170715864 GGGCCCTTGCACCAGGCAGGAGG - Intergenic
1019485845 7:1288832-1288854 ACTCCCTGGCACCAGCCTGGTGG - Intergenic
1019613075 7:1946734-1946756 GAACCCTAGGCCCAGCCTGGAGG - Intronic
1019732072 7:2633981-2634003 GGGCCATAGCACCCTGCTGGAGG - Intronic
1024491081 7:49986401-49986423 GGGCCCCAGCCCCAGCTGGGAGG - Intronic
1025812654 7:64884980-64885002 TGGCCCCAGCACCTGCCTCGCGG + Intronic
1026013416 7:66654340-66654362 GTGCCCTAGCTTTAGCCTGGAGG + Intronic
1029378890 7:100199712-100199734 GCACCCTAACCCCAGCCTGGGGG - Intronic
1030005395 7:105113076-105113098 GGACCCCAGCACCAGCCTTCTGG + Exonic
1032097859 7:128948387-128948409 AGGCCCTTGCCCCAGGCTGGAGG + Intronic
1032252606 7:130271048-130271070 GGGCAAGAGCACCAGCCTGAGGG - Intronic
1032794975 7:135269829-135269851 GCTCCCGAACACCAGCCTGGTGG + Intergenic
1035501137 8:92111-92133 GGGCCCTTGCACCAGGCAGGAGG + Intergenic
1036696173 8:10976498-10976520 GAGCCCTAACACCACCCGGGGGG - Intronic
1036698408 8:10994312-10994334 GGGGCCTAGAGCCAGGCTGGGGG - Intronic
1037608371 8:20456304-20456326 AGGCCCTAGCACCAGGCCAGGGG - Intergenic
1040319673 8:46286283-46286305 GGGCCCTAGCCCCCACCTGGTGG + Intergenic
1040323275 8:46329036-46329058 GGGCTCTAGCCCCTACCTGGGGG + Intergenic
1040328608 8:46374739-46374761 AGGCTCTAGCACCCACCTGGGGG + Intergenic
1041553437 8:59125726-59125748 GGGCACTAATTCCAGCCTGGCGG - Intergenic
1041912418 8:63103089-63103111 GGTCCCAAGCACCACCCAGGTGG - Intergenic
1042872686 8:73412565-73412587 GGGCACTGGAGCCAGCCTGGGGG + Intergenic
1048991411 8:139762423-139762445 GGGCACTCACACGAGCCTGGAGG + Intronic
1049088275 8:140494466-140494488 GGGCCTGAGGAGCAGCCTGGAGG - Intergenic
1049377067 8:142294315-142294337 GGGCCCAAACACCAGGCTGAGGG + Intronic
1049709147 8:144055926-144055948 GCTCCCCAGCACCATCCTGGTGG - Exonic
1051170451 9:14315001-14315023 GCGCCCCAGCCCCGGCCTGGGGG - Intronic
1057726602 9:97572578-97572600 GTGCCCCAGCCCCAGGCTGGGGG + Intronic
1058839264 9:108890560-108890582 GGGCTCTAGTACCAGAGTGGAGG - Intronic
1061393006 9:130328024-130328046 GGGCCCTTGCCCCTGGCTGGGGG + Intronic
1061418607 9:130461470-130461492 CGGCCATAGCACTAGCTTGGGGG - Intronic
1061872520 9:133528433-133528455 GGGCCCTTCCAGCAGCCGGGAGG + Intronic
1061893393 9:133634485-133634507 GAGCCCTCCCAGCAGCCTGGTGG - Intergenic
1062316690 9:135970731-135970753 GGGTCCTAACTCCAGCCTGGTGG - Intergenic
1203607775 Un_KI270748v1:71301-71323 GGGCCCTTGCACCAGGCAGGAGG - Intergenic
1191184145 X:57592249-57592271 GGGCCCTGGCCCAAGCCTGTTGG + Exonic
1194066823 X:89271348-89271370 GCGACCCAGCCCCAGCCTGGAGG + Intergenic
1199086267 X:143633898-143633920 GGGCCCAAGCAGCAGCCTGGCGG + Intronic
1200064951 X:153499821-153499843 GGGCACAAGCACCAGGCTGCTGG + Intronic
1200108004 X:153725094-153725116 GGGCCCCAGCACCACCCCGGGGG + Exonic