ID: 932888119

View in Genome Browser
Species Human (GRCh38)
Location 2:75565508-75565530
Sequence TGAAATCATCCTCATGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932888115_932888119 5 Left 932888115 2:75565480-75565502 CCCTGGACTTTTCTCTGCCGTAA 0: 1
1: 0
2: 0
3: 10
4: 101
Right 932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 167
932888116_932888119 4 Left 932888116 2:75565481-75565503 CCTGGACTTTTCTCTGCCGTAAG 0: 1
1: 0
2: 1
3: 16
4: 174
Right 932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932888119 Original CRISPR TGAAATCATCCTCATGTGGT AGG Intronic
901096509 1:6684949-6684971 TGACTTCATCCTCTTGTGGTAGG - Intronic
901762937 1:11482302-11482324 TGCAATCAGCCTCATGTCCTTGG + Intronic
903882297 1:26519474-26519496 AGAAATCATCCTCCTGTGAGTGG + Intergenic
909072144 1:71007611-71007633 TGAAAGGATACTCATGTGGGTGG - Intronic
910508933 1:87982114-87982136 TAAAATATTCTTCATGTGGTGGG + Intergenic
910530415 1:88229265-88229287 AGGAAACATCCTCATGTGATTGG - Intergenic
913044797 1:115064781-115064803 AGCAACCATCCTCATGTGCTTGG - Intronic
917268018 1:173242499-173242521 GGAATTCATTCTCCTGTGGTGGG + Intergenic
918712219 1:187745798-187745820 AGAAATCATTCTCTAGTGGTGGG - Intergenic
918963988 1:191317469-191317491 TGGGATCATTCTCATGTCGTAGG - Intergenic
919206532 1:194426123-194426145 GTAAATCATCCACATGTGGAAGG - Intergenic
919624027 1:199893838-199893860 TAAAACCATCCTTATGTGTTTGG - Intergenic
922386073 1:225084546-225084568 TGAAATGCTTTTCATGTGGTAGG - Intronic
922409745 1:225360485-225360507 TGTTATCATCCTCGTGTGTTAGG + Intronic
922615345 1:226957930-226957952 AGAAAACACCCTCCTGTGGTGGG + Intronic
923359015 1:233189111-233189133 TTAAAACATCCACATGCGGTAGG + Intronic
924363308 1:243263706-243263728 TGAAAACATGCTAAAGTGGTTGG - Intronic
924471642 1:244348184-244348206 GGGAATGAGCCTCATGTGGTAGG + Intergenic
924623241 1:245680224-245680246 TTAAATGATCATCATGAGGTTGG + Intronic
1062781879 10:219310-219332 TTAATTCATCTTCATGTGCTGGG - Intronic
1063790125 10:9435271-9435293 TGAAAGCTTCCTCTTGTGATTGG + Intergenic
1066665272 10:37776785-37776807 TGAAATCATACTGAAGTGGGTGG - Intronic
1067042222 10:42961067-42961089 TGAAAGCAGCCACATGTGCTTGG + Intergenic
1068572880 10:58650458-58650480 TAAAATAATCATCATTTGGTGGG - Intronic
1069063060 10:63914250-63914272 TCAACTCATCATCAGGTGGTGGG - Intergenic
1070488276 10:76951628-76951650 TCAAAGCATCCTCATGTAGCTGG + Intronic
1071710745 10:88046651-88046673 TATACTCATTCTCATGTGGTAGG + Intergenic
1072301819 10:94069173-94069195 TGAAAGCAGCCTGATATGGTGGG - Intronic
1072780079 10:98244347-98244369 TGGAATCACCCTACTGTGGTGGG + Exonic
1073711768 10:106051452-106051474 TGAGATCATCTTCCTGTGGCTGG + Intergenic
1075288401 10:121207242-121207264 TGTAACCATCCCTATGTGGTAGG + Intergenic
1075364455 10:121872449-121872471 TGAAATCTTTTTCATGTCGTGGG - Intronic
1076320662 10:129579082-129579104 TAAAATCATCCTAATCTGTTAGG - Intronic
1076944136 10:133632620-133632642 TGAATTCAGCATCCTGTGGTCGG + Intergenic
1079623747 11:22590194-22590216 TGATATCTTCCTCATTTGATTGG + Intergenic
1080629633 11:34062043-34062065 TGAAAGCATGCTCATGTAGCGGG - Intronic
1083210839 11:61184645-61184667 AGAATTCATCCTCATGCTGTGGG - Intergenic
1083469814 11:62876220-62876242 AGTAATAATCCTCATGTGTTAGG + Intronic
1085740804 11:79076802-79076824 TGAACACCTCCTCATGTGCTTGG + Intronic
1090637498 11:128699912-128699934 TGCAATCACCTTCATATGGTTGG - Intronic
1094410694 12:30165479-30165501 TTGAATCATCCCCATATGGTTGG - Intergenic
1097409458 12:59233380-59233402 TGAAATCATTCTCATTGTGTAGG - Intergenic
1099678865 12:85797926-85797948 TGACATCATCCTCATTTGCCAGG - Intergenic
1102620811 12:114193188-114193210 CGAAATCAGCTTCAAGTGGTAGG - Intergenic
1104680988 12:130751785-130751807 TGAAACCACTCTCAGGTGGTCGG + Intergenic
1106863760 13:33940369-33940391 TGAAATCATCCCCATGTGTCTGG - Intronic
1106942176 13:34791575-34791597 TGAAATGAGACTCATGAGGTGGG - Intergenic
1108528287 13:51304352-51304374 TTAAATCTTCCCCATATGGTGGG + Intergenic
1110119244 13:71863661-71863683 TGAAGTCCTCACCATGTGGTTGG - Intronic
1111209418 13:85057668-85057690 TAAAATTATCCTAATGTGGAAGG + Intergenic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1117195550 14:53336487-53336509 AGATATCATCTTCATGTGGTTGG + Intergenic
1119719283 14:76880303-76880325 TGAAATCACCCTCATCAGGTTGG - Intergenic
1119832074 14:77712244-77712266 TGCAAGCTCCCTCATGTGGTTGG + Intronic
1121725198 14:96142302-96142324 TGAAACCATCCATATGTGGGAGG + Intergenic
1202927080 14_KI270724v1_random:36414-36436 TGAATTCATCATCCTGTAGTCGG - Intergenic
1202927086 14_KI270724v1_random:36457-36479 TGAATTCAGCATCCTGTGGTTGG - Intergenic
1124863026 15:33461298-33461320 TCAACTCATTCTCCTGTGGTGGG - Intronic
1127341634 15:58051503-58051525 TGAAATAAACCTCATGTTGGAGG + Intronic
1133214802 16:4285410-4285432 TCGAAACACCCTCATGTGGTGGG + Intergenic
1138393613 16:56687915-56687937 AGAAATCATCCTCCTGTGAGTGG - Intronic
1141001903 16:80316289-80316311 TGAAATCAACTTCAGGTGATGGG + Intergenic
1142503736 17:349506-349528 TGAAATAATCAATATGTGGTGGG - Intronic
1142533320 17:597281-597303 TGAAATCAGCCAGAGGTGGTTGG - Intronic
1144601951 17:16624192-16624214 TGAAATTTTCCTCTTGTGTTTGG + Exonic
1146700941 17:34959666-34959688 TGATATTAACTTCATGTGGTAGG + Intronic
1147779354 17:42929023-42929045 TGGAGTCCTCCTCATGTGTTAGG - Intergenic
1147964669 17:44187726-44187748 TCAAAACAACCTCATGAGGTAGG + Exonic
1148632163 17:49119540-49119562 TTAAAACAACCTCATGAGGTAGG + Intergenic
1149098140 17:52870177-52870199 TGAAATAGTCCTGATGTTGTTGG - Intronic
1149150430 17:53555976-53555998 TGAAATTATTCTTGTGTGGTAGG - Intergenic
1149371817 17:56002321-56002343 TGAAATCAGTGCCATGTGGTAGG - Intergenic
1151863961 17:76787431-76787453 TGAAATCACTCACATCTGGTCGG - Intergenic
1153559119 18:6352227-6352249 TGAAATGATCATGATGTGTTGGG - Intronic
927291139 2:21406078-21406100 TGAAAGCAGCTTCATGTGTTTGG + Intergenic
931872003 2:66471157-66471179 TGATTCCATCCTCATGTGATTGG + Intronic
931881252 2:66573782-66573804 TGAAATCATTCTCTTTTGATAGG + Exonic
932080632 2:68711351-68711373 TAAAATCATCATAATGAGGTTGG - Intronic
932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG + Intronic
932923799 2:75946797-75946819 TGAAATCATCTTCATTTTCTTGG + Intergenic
936022831 2:109007959-109007981 AGAAATCATCCTGCTATGGTCGG - Intergenic
938582388 2:132658500-132658522 TGGCATCATCCTCAGGTGGAAGG - Intronic
942227880 2:173832477-173832499 TGGAATCTTCCTCATCTGGTGGG - Intergenic
945607596 2:211955123-211955145 TGAAATAATACTCAAGAGGTAGG + Intronic
948192091 2:236067244-236067266 TGAAATCATCCTGATGAGGCAGG - Intronic
1170181604 20:13536724-13536746 AGCAATCATCCTTATCTGGTAGG - Intronic
1170781743 20:19431377-19431399 TGAAAGCATCCACGTGTGGATGG + Intronic
1173726763 20:45303882-45303904 AGAAGTCATCCCCATGTGGGAGG + Intronic
1178997705 21:37420336-37420358 TCATATCATCCTGATGGGGTGGG - Exonic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1182861085 22:33560007-33560029 AGAAATCATTGTCATGTGGGTGG - Intronic
1183934717 22:41255558-41255580 AGATCTCATCCTGATGTGGTGGG - Intronic
1184113752 22:42410081-42410103 GGAAATCATGCTCATGTGCCTGG - Intronic
1185102075 22:48845964-48845986 GGAAATCATCAGCATGTGCTTGG - Intronic
950243995 3:11398425-11398447 GAAAATCATCCCCATGTGTTTGG + Intronic
950715546 3:14845264-14845286 TGAAATCATCCTCAACTTGCTGG + Intronic
956221076 3:66903928-66903950 TGAAACCTTCCTCATGGGGCTGG - Intergenic
957924360 3:86789439-86789461 AGCAATCATTCTCAGGTGGTAGG + Intergenic
959701660 3:109304552-109304574 AGAAATCATCCTCCTGTGAGTGG + Exonic
966646844 3:182255529-182255551 TGATATCATTCACATGTGGATGG - Intergenic
967095670 3:186175353-186175375 TGAAAACCTGCTCGTGTGGTGGG + Intronic
967839475 3:193993444-193993466 AGAAATCATCCTCCTGTGAGTGG + Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
970499120 4:16659031-16659053 TAAAATCAGGCTCATTTGGTGGG - Intronic
976966598 4:91050030-91050052 TGAAAACAACCCCATGAGGTAGG - Intronic
977055545 4:92185848-92185870 TAAAATTATCTACATGTGGTTGG - Intergenic
977090237 4:92664410-92664432 TAAATTCATCCTGTTGTGGTTGG + Intronic
977184598 4:93921004-93921026 TCAAATAATCTTCATGTGTTAGG + Intergenic
977285582 4:95102255-95102277 AGAAAATATCCTCATGTGATTGG - Intronic
977870029 4:102080536-102080558 TGAAACCATCCTCAGGTCCTAGG + Intergenic
978337302 4:107683447-107683469 TGAAATCAATCTCATGGGGTGGG - Intronic
983084924 4:163431426-163431448 TGAAATAATTCTCATGTCTTTGG + Intergenic
985447493 4:190033077-190033099 TGAATTCAGCATCCTGTGGTCGG + Intergenic
985447500 4:190033120-190033142 TGAATTCAGCATCCTGTGGTCGG + Intergenic
985447507 4:190033163-190033185 TGAATTCAGCATCCTGTGGTCGG + Intergenic
988524646 5:31976507-31976529 TGTAAACATCCCCTTGTGGTTGG + Intronic
988751782 5:34195288-34195310 TGTAATCATCTCCATCTGGTAGG + Intergenic
989066573 5:37468404-37468426 TGTAATTATCTCCATGTGGTAGG - Intronic
990924819 5:61008567-61008589 TGAAATCATCCGCATTTTATAGG - Intronic
991398665 5:66231217-66231239 TGAAATGATCCTTTTGTGGTTGG - Intergenic
993062016 5:83050004-83050026 TGAACTCATCCACCTGGGGTGGG + Intergenic
995774372 5:115709898-115709920 TGAAATTATACTCAAGTGTTTGG + Intergenic
995889870 5:116938984-116939006 TCAAAGCAACCTCATGAGGTGGG + Intergenic
998376081 5:141691759-141691781 TGAAGTGCTCCTCATGTGGCAGG + Intergenic
999595830 5:153203097-153203119 TGAAGTCATCCACATGTGTGGGG + Intergenic
1000607681 5:163342066-163342088 TGAATTCATCCACATGAGCTAGG + Intergenic
1002888504 6:1315634-1315656 TCAAATCATCCTCCTGTCCTGGG - Intergenic
1004325115 6:14667542-14667564 TAAGATCATCCTTTTGTGGTGGG - Intergenic
1004373857 6:15075256-15075278 TGAAGTCATACTAATGTGGATGG - Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1004964068 6:20827288-20827310 TGAAAACTGCCCCATGTGGTAGG - Intronic
1007295515 6:40818038-40818060 AAAAATTATCCACATGTGGTGGG - Intergenic
1007374515 6:41447173-41447195 TCATATCAACCTCATGAGGTGGG - Intergenic
1009481848 6:64169205-64169227 TGACATGATCCTCATCTAGTTGG + Intronic
1009685560 6:66950826-66950848 TGATATCAACATCATGTGCTAGG - Intergenic
1010264874 6:73854914-73854936 TGAAATGACATTCATGTGGTGGG - Intergenic
1010753060 6:79636187-79636209 TGAGATCATACTCAGGTGGGGGG + Intronic
1014198479 6:118584051-118584073 TGAAATAGTCCTCATCTGTTTGG + Intronic
1015200619 6:130575903-130575925 TGAAGTCATTGTAATGTGGTCGG - Intergenic
1015591712 6:134828998-134829020 TGAAATCATGCTGGAGTGGTGGG - Intergenic
1017604084 6:156114658-156114680 TGAGAGCTTCCTGATGTGGTTGG - Intergenic
1017826622 6:158086499-158086521 TGAAAACATCTGCCTGTGGTTGG + Intronic
1017858939 6:158377292-158377314 TAAAATCATACCTATGTGGTGGG - Intronic
1020647376 7:10831377-10831399 TTCAATCATCCTCATGTGGCTGG - Intergenic
1020840005 7:13204636-13204658 TGAAATCATCCTTCTGTGCTTGG + Intergenic
1022199870 7:28106041-28106063 TGAAAACCTCCACATGTGCTTGG - Intronic
1023061511 7:36331881-36331903 TTAAATCATCCTCATGCTATTGG - Intronic
1023219274 7:37901979-37902001 CGAAGTCATCCTCATGTATTTGG - Intronic
1024093146 7:45964244-45964266 TTAAATCATCCTCATATAATTGG - Intergenic
1026210944 7:68304616-68304638 TGGAAGCATCCTCCTGTGGTAGG + Intergenic
1029520225 7:101056183-101056205 TGGAATCATCATCTTGTGGAGGG - Exonic
1030994025 7:116335937-116335959 TGCATCCATCCTCATGTGGCAGG - Intronic
1031148844 7:118029078-118029100 TGAAAACATCCCCATGAGGTAGG - Intergenic
1035979121 8:4349370-4349392 TTAAAGCATCCTTTTGTGGTAGG + Intronic
1037751468 8:21685017-21685039 TGAAATCATCCTTAAGTTGGAGG - Intergenic
1039109091 8:34022336-34022358 TGAAATCACACACATGTGGTGGG + Intergenic
1040643946 8:49376851-49376873 TGAAATCATCCTCACATGGATGG + Intergenic
1042834957 8:73071194-73071216 TCATACCAACCTCATGTGGTAGG + Intronic
1047678813 8:127232536-127232558 TGAAATAATCCTTAAATGGTAGG - Intergenic
1047695401 8:127398575-127398597 TGACATCATGCTCAGGTAGTCGG + Intergenic
1047704596 8:127484824-127484846 TGAAAACATGCTCATGTATTAGG + Intergenic
1048018182 8:130515923-130515945 TCACATCATCCTGATGTTGTGGG + Intergenic
1050889359 9:10804409-10804431 TGTACTCATCCTGTTGTGGTGGG + Intergenic
1051599394 9:18857556-18857578 GGAAATCATAATCATGTGATTGG - Intronic
1052534142 9:29726487-29726509 TGAAACCAGCCTCATCTGATGGG - Intergenic
1055222382 9:73952290-73952312 TGTAATTATTTTCATGTGGTAGG - Intergenic
1055763617 9:79637282-79637304 TCACATCAACCTCATGTGGAAGG + Intronic
1058032699 9:100216915-100216937 TGAGATCATGCCCAGGTGGTGGG - Intronic
1058576182 9:106404893-106404915 TGAAACCATTCTCATGTGAATGG - Intergenic
1203441246 Un_GL000219v1:10574-10596 TGAATTCAGCATCCTGTGGTGGG + Intergenic
1203512055 Un_KI270741v1:129482-129504 TGAATTCAGCATCCTGTGGTGGG + Intergenic
1186439039 X:9569564-9569586 TCAAATGATCCTCAAGTGCTGGG - Intronic
1187506857 X:19885842-19885864 TGAAATCCTCCTCCTCTGCTGGG - Intronic
1191054666 X:56229563-56229585 AGAAATAATCAGCATGTGGTTGG - Intergenic
1192344367 X:70289250-70289272 TGGATTCCTCCTCATGAGGTGGG - Exonic
1194949944 X:100113132-100113154 TGAAATCATCTTTCTATGGTTGG + Intergenic
1195443731 X:104926669-104926691 TGAAAACATCCTTATATGATGGG - Intronic
1195580823 X:106500075-106500097 TGAAATCCTTTTCATGTGTTGGG + Intergenic
1197296812 X:124729358-124729380 TGAAAACAGCCCCATGAGGTAGG + Intronic
1197468107 X:126831938-126831960 TGAAATCATCCTGAGGTGAAAGG - Intergenic
1197645105 X:129008994-129009016 TTAAAACATCATTATGTGGTGGG + Intergenic
1200086434 X:153609563-153609585 TGAAATAATCCACTTCTGGTAGG - Intergenic