ID: 932889322

View in Genome Browser
Species Human (GRCh38)
Location 2:75578514-75578536
Sequence CTCACATGACAGAAGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932889322_932889328 27 Left 932889322 2:75578514-75578536 CCTTGGTCCTTCTGTCATGTGAG No data
Right 932889328 2:75578564-75578586 TTCACCAGGCCTGAATCTACTGG No data
932889322_932889325 1 Left 932889322 2:75578514-75578536 CCTTGGTCCTTCTGTCATGTGAG No data
Right 932889325 2:75578538-75578560 ACACAGTGAAAACTAGAAAATGG No data
932889322_932889326 13 Left 932889322 2:75578514-75578536 CCTTGGTCCTTCTGTCATGTGAG No data
Right 932889326 2:75578550-75578572 CTAGAAAATGGACCTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932889322 Original CRISPR CTCACATGACAGAAGGACCA AGG (reversed) Intergenic
No off target data available for this crispr