ID: 932890093

View in Genome Browser
Species Human (GRCh38)
Location 2:75587086-75587108
Sequence AACTAGAGCATGCATCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932890091_932890093 -8 Left 932890091 2:75587071-75587093 CCATACTAATTCCTAAACTAGAG No data
Right 932890093 2:75587086-75587108 AACTAGAGCATGCATCCACCTGG No data
932890090_932890093 15 Left 932890090 2:75587048-75587070 CCAGTGGTGCATAAAATTTGCAG No data
Right 932890093 2:75587086-75587108 AACTAGAGCATGCATCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932890093 Original CRISPR AACTAGAGCATGCATCCACC TGG Intergenic
No off target data available for this crispr