ID: 932891734

View in Genome Browser
Species Human (GRCh38)
Location 2:75602800-75602822
Sequence CTGTACAGCTGGAGAACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932891728_932891734 2 Left 932891728 2:75602775-75602797 CCTTGTGTCAAGAATGCTCCTGG No data
Right 932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932891734 Original CRISPR CTGTACAGCTGGAGAACAGA GGG Intergenic
No off target data available for this crispr