ID: 932894046

View in Genome Browser
Species Human (GRCh38)
Location 2:75621683-75621705
Sequence AAAGCCTTGTGGATTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932894046_932894050 -9 Left 932894046 2:75621683-75621705 CCCAAGCCAATCCACAAGGCTTT No data
Right 932894050 2:75621697-75621719 CAAGGCTTTTCCCCAGAATTTGG No data
932894046_932894051 -8 Left 932894046 2:75621683-75621705 CCCAAGCCAATCCACAAGGCTTT No data
Right 932894051 2:75621698-75621720 AAGGCTTTTCCCCAGAATTTGGG No data
932894046_932894052 -1 Left 932894046 2:75621683-75621705 CCCAAGCCAATCCACAAGGCTTT No data
Right 932894052 2:75621705-75621727 TTCCCCAGAATTTGGGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932894046 Original CRISPR AAAGCCTTGTGGATTGGCTT GGG (reversed) Intergenic
No off target data available for this crispr