ID: 932895477

View in Genome Browser
Species Human (GRCh38)
Location 2:75635485-75635507
Sequence TCCTGGGTAAAGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932895477_932895485 -6 Left 932895477 2:75635485-75635507 CCCTCAGCCCTCTTTACCCAGGA No data
Right 932895485 2:75635502-75635524 CCAGGACATTTCTCAGGTGTGGG No data
932895477_932895483 -7 Left 932895477 2:75635485-75635507 CCCTCAGCCCTCTTTACCCAGGA No data
Right 932895483 2:75635501-75635523 CCCAGGACATTTCTCAGGTGTGG No data
932895477_932895487 23 Left 932895477 2:75635485-75635507 CCCTCAGCCCTCTTTACCCAGGA No data
Right 932895487 2:75635531-75635553 GTGGCCAACCATAAGAGATGAGG No data
932895477_932895486 4 Left 932895477 2:75635485-75635507 CCCTCAGCCCTCTTTACCCAGGA No data
Right 932895486 2:75635512-75635534 TCTCAGGTGTGGGTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932895477 Original CRISPR TCCTGGGTAAAGAGGGCTGA GGG (reversed) Intergenic
No off target data available for this crispr