ID: 932898260

View in Genome Browser
Species Human (GRCh38)
Location 2:75666423-75666445
Sequence TATTTTATAAAGAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 1, 2: 4, 3: 62, 4: 801}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932898260 Original CRISPR TATTTTATAAAGAAATTGGA TGG Intronic
901257489 1:7842987-7843009 TGTCTTCTAAAGAGATTGGATGG + Exonic
901336985 1:8458161-8458183 TATTTTATAAACGAAGAGGATGG - Intronic
901728531 1:11261610-11261632 TATTTTTGAAAGAATTTGTAAGG + Intronic
901833031 1:11905677-11905699 TATTTTAGAAAAAAATCTGATGG - Intergenic
903246933 1:22023087-22023109 CAGGTTATAAAGGAATTGGAAGG + Intergenic
904763441 1:32821941-32821963 TTTTTAATAAAGTAATTGCAGGG + Intronic
904791553 1:33026120-33026142 TAGTTTATAAAACAATTGAACGG - Intronic
905549965 1:38829726-38829748 TAATTGAAAAAGAAATTAGATGG + Intergenic
905681477 1:39875177-39875199 TATTTTATGAAGTAACTGGGTGG - Intronic
906019681 1:42616430-42616452 TATTTAGGAAAGAAAATGGAAGG + Intronic
906037563 1:42761303-42761325 TATTTTATAATTAAAATGTAAGG + Intronic
906189745 1:43890268-43890290 TAGTATACAAAGAAAGTGGATGG + Intronic
906390009 1:45407004-45407026 TATCTTATAACAATATTGGAAGG - Intronic
906502530 1:46351962-46351984 TTTTTTAAAAAGAGACTGGAAGG - Intronic
906664516 1:47609849-47609871 TATTTTAAAATGAATTTTGATGG + Intergenic
906849750 1:49235611-49235633 TATTTTATATACAAGGTGGAAGG + Intronic
907171697 1:52472447-52472469 TAGGTTATAAAGAAATTTTAAGG + Intronic
907366114 1:53961634-53961656 TATTTTAAAAAGATATTCAAGGG - Intronic
907448599 1:54527099-54527121 TCTTCTCCAAAGAAATTGGATGG + Intergenic
907690328 1:56658226-56658248 TACTTTAAAAAGAAATTTTATGG + Intronic
908097322 1:60752577-60752599 CATTTTATAAATAAATAGGCTGG - Intergenic
908779234 1:67673817-67673839 CTGTTTATAAAGAAATTAGAAGG - Intergenic
908850071 1:68366970-68366992 CATTTTAAAAAGAAATAGAACGG - Intergenic
908886999 1:68800952-68800974 TATTTGATAAAGAATCTGAATGG + Intergenic
908960214 1:69688438-69688460 TATCTACTAAAGAAATTTGATGG + Intronic
909083171 1:71139223-71139245 TTTTTTATAAAGAAAATAGTAGG - Intergenic
909109972 1:71462658-71462680 TCTCTTATAAAGAAATTGTTGGG - Intronic
909665626 1:78129089-78129111 TAATTTACAAAGAATTTGTAAGG - Intronic
909753341 1:79191630-79191652 TGTTGTGTAAAGAAATTGGAAGG + Intergenic
909977687 1:82064428-82064450 TAATTTAAAAATAAGTTGGAAGG + Intergenic
910048616 1:82949742-82949764 TACATTATAAAAAAATTGAAAGG + Intergenic
910089999 1:83451081-83451103 TATAATAAAAAGAAATAGGATGG - Intergenic
910312598 1:85841784-85841806 AATTATTTAAAGAAATTGTAAGG - Intronic
910318319 1:85914688-85914710 TATATGATAAAGAAATGAGAGGG - Intronic
910471968 1:87563438-87563460 TAATTTATAATTGAATTGGATGG + Intergenic
910490082 1:87759015-87759037 CATTTTATAAACACATTGGGAGG + Intergenic
910707513 1:90145875-90145897 TATTTTAAAGTGACATTGGAAGG + Intergenic
911139118 1:94478845-94478867 TATTTTATAATGTAAATGGTTGG + Intronic
911368389 1:96967963-96967985 TAATATATAAAGATATTGCAAGG - Intergenic
911445136 1:97983294-97983316 TGTTTTAGAAAGTAATTGAATGG + Intergenic
911547002 1:99229766-99229788 GATTTTATATAAAACTTGGAGGG - Intergenic
912160422 1:106976500-106976522 TATCATAAAAAGAAATTGAAAGG - Intergenic
912752501 1:112297342-112297364 TTTTGTATAATGAAATTGCATGG + Intergenic
912907962 1:113727661-113727683 TATGTAATAAAGAATTTGGTTGG + Intronic
913367335 1:118054684-118054706 TATTTTTTAAAAAAATGGGTAGG - Intronic
913458050 1:119053888-119053910 TAATTTAAAAAAAAATTGGTTGG - Intronic
914826554 1:151141740-151141762 TTTTTTTTAAAGAGATGGGATGG + Intronic
915873947 1:159592277-159592299 GAATCTATAAAGAAAATGGAAGG + Intergenic
915884331 1:159706511-159706533 TATTTTAGAAAAAAAGTGTAAGG + Intergenic
916556259 1:165896644-165896666 TGTCTTATAAACAAATTGCAAGG - Intronic
916645071 1:166776835-166776857 TAGTTGATCAAGAAATGGGAAGG - Intergenic
916755356 1:167764119-167764141 TATTTTTTAAAGAAATCGTTTGG - Intronic
916977531 1:170097447-170097469 GATTTTATAAAGGGATTGGCTGG - Intergenic
917247135 1:173015974-173015996 TATTTTATATAGTATTTTGAAGG - Intergenic
917333833 1:173908854-173908876 TATCTTTTAAAGAAGTTGGCTGG - Intronic
917518553 1:175729162-175729184 TATTGTTTAAAAAAAATGGAAGG - Intronic
917558026 1:176112410-176112432 TTTTCTAAAAAGAAATTGAATGG - Intronic
917566072 1:176212787-176212809 TATTTTATGAAGGTATAGGAAGG + Intergenic
918443275 1:184590348-184590370 TCTTTTACAAATAAATTGCACGG + Intronic
918488091 1:185050648-185050670 TATTTTCTAATGACCTTGGAAGG - Intronic
918533608 1:185550249-185550271 TATTTAAAAAAGAAATGAGAAGG - Intergenic
918611041 1:186492338-186492360 AATTTTATAAAAAGAATGGATGG - Intergenic
918770751 1:188556616-188556638 AATGTTATAAGGAAATTGGCAGG + Intergenic
918872993 1:190001039-190001061 TATTTTAAAAAATAATGGGATGG - Intergenic
918903903 1:190465224-190465246 TAATTCATAAAGAAATTGTCAGG + Intronic
919257732 1:195145484-195145506 TATTTTATATACAACTTAGAAGG - Intergenic
919284468 1:195537403-195537425 GAATTTATGAAGATATTGGAGGG + Intergenic
920018796 1:202937200-202937222 TTTTTTTAAAAGAAAATGGATGG + Intergenic
920137912 1:203785243-203785265 TATTTTATAAAGTTATTGTGTGG + Intergenic
920587535 1:207181676-207181698 TATTTTAAAAAGTAATTGACAGG + Intergenic
920638702 1:207730450-207730472 TATTTTAAAAATAAACTGGGAGG + Intronic
920887695 1:209947687-209947709 TAGTTGATAAAGAAACTGTAGGG + Intronic
921241868 1:213193164-213193186 TATTTTCTATAGCCATTGGAAGG + Intronic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
921845680 1:219877273-219877295 TACTTTTTAAAGTAATTGTAAGG + Intronic
922190301 1:223312985-223313007 TATGTTACAAAGAATTTGGCTGG + Intronic
922970012 1:229728269-229728291 TATTTTGTAAAGAATTGGGAAGG - Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924426663 1:243957458-243957480 TATTTTATCTGCAAATTGGAAGG + Intergenic
924686490 1:246296637-246296659 AATTTTATAGAGAAAGTAGAAGG - Intronic
1063044513 10:2378055-2378077 TATAGTATAAAAAAATTTGATGG + Intergenic
1063296952 10:4816116-4816138 TAATTTATAAATAAAATTGAGGG - Intronic
1064507267 10:16046589-16046611 TATTTTCTAAAGAAGTTTGCTGG + Intergenic
1065996572 10:31064781-31064803 AACTTTAAAGAGAAATTGGAAGG + Intergenic
1066267246 10:33788291-33788313 TGTGTTAAAAAGAACTTGGATGG + Intergenic
1066486047 10:35845935-35845957 TATTTTTTTAAAAAATTGGCTGG - Intergenic
1066523643 10:36251497-36251519 TGTTTCAGTAAGAAATTGGAAGG + Intergenic
1066550376 10:36549228-36549250 TATTTTTTAAATAAATTGGAAGG - Intergenic
1066766078 10:38804100-38804122 TAGTTTCTAAAGGAATTGAATGG - Intergenic
1066769408 10:38831976-38831998 TAGTTTCTAAAGGAATTGAATGG + Intergenic
1067259959 10:44680791-44680813 TAATTTACAAAGACATTGGCTGG + Intergenic
1068000829 10:51332098-51332120 TATTTTTTAAAGGGATTTGATGG - Intronic
1068170464 10:53386913-53386935 TATTTGTTAAGGAGATTGGACGG + Intergenic
1068428530 10:56900400-56900422 AATTTTAAATAGAAATTAGAGGG + Intergenic
1069460427 10:68589970-68589992 CATTTAATATAAAAATTGGAAGG - Intronic
1069483085 10:68801691-68801713 TATTTAAGAAAGAAAATGAATGG - Intergenic
1071275057 10:84046181-84046203 TATTTTATAAATATGGTGGAGGG + Intergenic
1072227288 10:93382506-93382528 TAATTTAAAAAGAAAAAGGAAGG - Intronic
1073220749 10:101871332-101871354 AATTTTATACAGAAATGGAAAGG + Intronic
1073678030 10:105672129-105672151 TATATAACAAAGAAATTGGCTGG + Intergenic
1074364934 10:112850077-112850099 CATTTTATAAAGAGTTGGGAGGG + Intergenic
1074816352 10:117143723-117143745 TATTTCAGAAAGAAGTAGGAGGG + Intergenic
1075285817 10:121184877-121184899 TATTTTATAATGAAATATAATGG - Intergenic
1075443784 10:122499759-122499781 TATTTTTTAAAGAAAATGAAAGG + Intronic
1076170753 10:128317891-128317913 TCTTTTATAAATAAAATGAATGG + Intergenic
1076277978 10:129221347-129221369 TAATTTATAAAGAAAAAGAAAGG + Intergenic
1077626194 11:3773984-3774006 TATTTTACCATGTAATTGGATGG - Intronic
1077653197 11:3993344-3993366 TATTTTATATGGAAATATGAGGG - Intronic
1077961213 11:7078487-7078509 TACATTTTAAAGAAATTAGAGGG + Intergenic
1078033522 11:7779350-7779372 ATTTTTATATAGATATTGGATGG - Intergenic
1078063625 11:8063623-8063645 TATAATAGCAAGAAATTGGAAGG - Intronic
1078238931 11:9512391-9512413 TATTTTCTAAACAAATTGGTTGG + Intronic
1078583838 11:12562680-12562702 TATTAAACAAAGAAATTTGAAGG + Intergenic
1078600421 11:12725301-12725323 AATGTTATAAAGAAATTGTAAGG - Intronic
1078713508 11:13817487-13817509 AATTTTATAAAGAAAATTAAAGG - Intergenic
1078841913 11:15085196-15085218 TTTTTAATAAAAAAATTGGCTGG + Intergenic
1078993974 11:16678372-16678394 GATTTTAAAAAGAAATTAGAAGG - Intronic
1079226020 11:18605346-18605368 TACTTTAAAAACAAATTGTATGG + Intergenic
1079325900 11:19492267-19492289 TTTTTTTTAAACAAATTGAAAGG - Intronic
1079440633 11:20511086-20511108 TATTTTTTACAGCAATTTGAAGG - Intergenic
1079653047 11:22954674-22954696 TCTTTTAAAAAGAAAGTGAAGGG - Intergenic
1079985889 11:27200608-27200630 TATTCTCTAAAGAAATTGGATGG - Intergenic
1080273803 11:30480384-30480406 TATTTTAACATGAAATTGGAAGG - Intronic
1080301935 11:30794172-30794194 TATTCTACAAAATAATTGGATGG - Intergenic
1080545395 11:33312212-33312234 TGTCTAATAAAGAAAATGGAAGG - Intronic
1080596432 11:33777699-33777721 TTTTTTAAAAAGAAATCAGAAGG + Intergenic
1080675503 11:34423041-34423063 TATTTTCTAAAGCACTTGAAGGG + Intergenic
1080676232 11:34430116-34430138 TATTTAAAAATGAAATGGGAGGG + Intergenic
1080993159 11:37566001-37566023 TATATTATAAAGAAATGACAAGG + Intergenic
1081079375 11:38721310-38721332 TAGTTAATGATGAAATTGGAAGG + Intergenic
1081444009 11:43112229-43112251 TGTTTTAAAAAGAAAAGGGAAGG - Intergenic
1081721437 11:45291968-45291990 TGCTTTATTAAGAAATTAGAGGG - Intergenic
1082127009 11:48445237-48445259 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1082560590 11:54616218-54616240 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1082897899 11:58212597-58212619 GATTTTATTAAGATCTTGGAAGG + Intergenic
1082929251 11:58581901-58581923 TGTTTTCTAATGATATTGGATGG - Intronic
1085362851 11:75907673-75907695 GTTTTAATAAAGAAATTGGCTGG - Intronic
1085498741 11:76997293-76997315 TACTTTATAAACACATAGGAAGG - Intronic
1085682802 11:78594066-78594088 TATTTCACAATGAAATAGGAAGG + Intergenic
1085866252 11:80297418-80297440 TATTTTTTAACAAAATTGAATGG + Intergenic
1085989481 11:81824430-81824452 TATTTTCTCAAGAAATTTGGAGG - Intergenic
1086009335 11:82080246-82080268 TATATTATAAAGTAACTGTAAGG + Intergenic
1086818997 11:91411633-91411655 TATTTTATATGTCAATTGGATGG - Intergenic
1086846342 11:91754569-91754591 TATTTGAAAAAAAAATAGGAGGG - Intergenic
1087704868 11:101478859-101478881 TTTTGTAAAAAGAAATTTGAAGG - Intronic
1087781798 11:102309178-102309200 TAATTTAAAAAAAAATTGGGGGG - Intergenic
1087998593 11:104845240-104845262 TATTTGCTAAAGAAACTGGAAGG + Intergenic
1088522745 11:110716893-110716915 TATTTTATTACTAAATTAGAGGG + Intergenic
1089234475 11:117011494-117011516 TATTTTCTACAGAAATTAAACGG + Intronic
1089311797 11:117562934-117562956 TATTTTATAAGGATGTTGGAAGG + Intronic
1089865746 11:121629604-121629626 TATTTGATAAAGATAGTTGATGG + Exonic
1089891472 11:121885831-121885853 TTTTTTTTAAAGAAGTTTGAAGG + Intergenic
1090054056 11:123406558-123406580 TGTTTTTTAAAGAAATTGTTAGG + Intergenic
1090699828 11:129283434-129283456 TATTTTATATAGTAGTAGGAAGG - Intergenic
1090707689 11:129354186-129354208 GATTTTACAATGAAATTGGTGGG - Intergenic
1091143133 11:133253180-133253202 TCTTTTATAAAGGAATTAGCAGG + Intronic
1092110735 12:5962341-5962363 AAATTTATATAGAAATTGAAAGG + Intronic
1092319622 12:7458672-7458694 TATTTGAAAAAGAAATCGGCCGG + Intronic
1092574463 12:9764588-9764610 TGTTTTATAAAGAGGTTGAAAGG - Intergenic
1092627477 12:10342643-10342665 GATTTTATATTGAAATTGTATGG + Intergenic
1092775876 12:11944816-11944838 TGTTTGAATAAGAAATTGGAGGG + Intergenic
1092823775 12:12377927-12377949 TATTTTTTAGGGATATTGGAGGG + Intronic
1093667703 12:21834183-21834205 CATTTTAAAAAGAAATTGAATGG - Intronic
1094310777 12:29079540-29079562 AAATGTATATAGAAATTGGAAGG + Intergenic
1095389921 12:41693429-41693451 TATTTCATAATGAAATTGGCTGG - Intergenic
1095724013 12:45432698-45432720 TATTTTAAAAAGGAAATGAATGG - Intronic
1095916402 12:47484599-47484621 TATATAATAAAGAATTTGGGTGG + Intergenic
1097906368 12:64923525-64923547 TATTTTCTATTGAAATTGGTTGG + Intergenic
1097936271 12:65255529-65255551 TATTTTAGAAAGATGTTGGGAGG - Intergenic
1098115820 12:67175422-67175444 TGGTTTACCAAGAAATTGGAGGG + Intergenic
1098461240 12:70735210-70735232 TATTTTATAAAAATGTTAGAAGG + Intronic
1098548188 12:71733622-71733644 TATTTTTTAAAAAAATTAGCCGG - Intergenic
1099165533 12:79302495-79302517 CAATTTAGAAAGAAATGGGAAGG + Intronic
1099168224 12:79333611-79333633 TATTTTTTAAAGACATTGAGTGG - Intronic
1099170868 12:79362459-79362481 GATTTTATAAATAAAAGGGAGGG + Intronic
1099358794 12:81671363-81671385 TATTTTTTAAAAAAATTAGATGG - Intronic
1099384304 12:81996554-81996576 TATTTTATTAATCAATTGGCAGG - Intergenic
1099440637 12:82695339-82695361 TATTCTATAAAGACACTGAAAGG + Intronic
1099675192 12:85751561-85751583 AATTTAATAAGTAAATTGGAGGG + Intergenic
1099916439 12:88900654-88900676 TATTTTAAAAAACAATTAGAAGG - Intergenic
1100038688 12:90283911-90283933 TATTTTCTACAGAAATTGAATGG - Intergenic
1100732855 12:97492130-97492152 TAATTTATAATGAACTTGAAAGG + Intergenic
1100999310 12:100341881-100341903 TATTTTATATAGCAGTTGTAGGG - Intergenic
1101148197 12:101861549-101861571 TGTTCAATAAAGAAATAGGAAGG - Intergenic
1101171100 12:102094822-102094844 TGTTTTATAGAGAAAGTGAATGG + Intronic
1101556071 12:105810892-105810914 CATTTTATAAATAAAATGGTTGG - Intergenic
1102070937 12:110018853-110018875 TATTTTATAAAGGACATTGATGG + Intronic
1102263126 12:111457504-111457526 TATTTTTTCAAGACAATGGATGG - Intronic
1102596591 12:113997464-113997486 TATTTGACAAATAAATTGAATGG - Intergenic
1102849808 12:116230718-116230740 TATTTTATATATAAATTGACAGG - Intronic
1102974854 12:117199281-117199303 TATTATAGAAAGAGATTTGATGG - Intergenic
1106516000 13:30454496-30454518 TGTTATATATAGAAACTGGAAGG + Intergenic
1106778594 13:33032746-33032768 TATTTTTTACAGAAAATAGATGG - Intronic
1106884187 13:34165593-34165615 TATTTTATAACGCATATGGAAGG + Intergenic
1107213853 13:37891927-37891949 TATTTAATGAAGAACATGGATGG + Intergenic
1107313303 13:39103754-39103776 GATTTTCTAAAGAAAATGGTGGG - Intergenic
1107492599 13:40895475-40895497 TATTTTATAAAAAAATAGCTGGG - Intergenic
1107766396 13:43739682-43739704 TATTTTATTAATAAATAAGATGG + Intronic
1107826951 13:44337377-44337399 TCTTTTTTAAAAAAATTGCATGG + Intergenic
1108239902 13:48453180-48453202 CATTCTATAAAGAAACTGTAGGG + Intronic
1109019354 13:57066371-57066393 TATTTTATAAATAATTTTAAGGG - Intergenic
1109402293 13:61849928-61849950 TATCTAAGAATGAAATTGGAGGG - Intergenic
1109920313 13:69048931-69048953 TAAATTATAAAGAAGTTGAATGG - Intergenic
1110775163 13:79400257-79400279 TAATTTATAAAGAAATTTATTGG + Intronic
1110883017 13:80596495-80596517 TTTTTTTTTAAGAAATTGTAAGG - Intergenic
1110898456 13:80787879-80787901 GATTTAATAAAGAAAGTTGATGG + Intergenic
1110925476 13:81145679-81145701 TTAATTATAAAGAAATTGTATGG + Intergenic
1110963645 13:81662490-81662512 TATTTTGGAAATAAATAGGAAGG - Intergenic
1111255026 13:85656068-85656090 TATTTTAAAATGTTATTGGAAGG + Intergenic
1111318480 13:86592643-86592665 TAGTTTATAAAGAAAAAAGAAGG + Intergenic
1111578214 13:90187076-90187098 TTTCTTATCAATAAATTGGAAGG - Intergenic
1111775904 13:92661520-92661542 TATTTTATAAAAGAATTTTATGG + Intronic
1111935714 13:94555134-94555156 TATTTTAAAAACAAATCTGAGGG - Intergenic
1112303885 13:98255728-98255750 TGTTTTATTAAGAAAGTTGAAGG - Intronic
1112305285 13:98267858-98267880 TGTTTCAAAATGAAATTGGAAGG + Intronic
1112553123 13:100441567-100441589 TATTTTTTAAAGAAATAAAAAGG + Intronic
1112569056 13:100577543-100577565 TATTTTATTATGAATTTTGAGGG - Intronic
1112642612 13:101293423-101293445 TATTTTATAAACAACTTCAATGG - Intronic
1112772971 13:102811821-102811843 TATGTTATAATAAAATTGCAAGG - Intronic
1112903084 13:104382927-104382949 TAATTTACAAATAAATTTGAAGG + Intergenic
1113157698 13:107343277-107343299 GAGTTAATAAAGAAATTGAAAGG + Intronic
1114623244 14:24111661-24111683 CATTTTTTAAAAAAATTGGCCGG - Intronic
1115131494 14:30057263-30057285 AATATTATAAACAAGTTGGAAGG - Intronic
1115172109 14:30520280-30520302 AATTTTAAAAATTAATTGGATGG + Intergenic
1116150733 14:41138981-41139003 TAGCTTATAAATGAATTGGATGG - Intergenic
1116253183 14:42514500-42514522 TATTTTGAAAAGTAAATGGAAGG - Intergenic
1116765178 14:49061724-49061746 TATTTTTTTAAGAGATTGGATGG - Intergenic
1117363463 14:55001080-55001102 TTTTTTTTCAAGAATTTGGAGGG + Intronic
1117395709 14:55307562-55307584 TTGTTTATAAAGAAATTACAAGG - Intronic
1117463256 14:55967754-55967776 TCTTGAATAAAGAACTTGGATGG + Intergenic
1117562445 14:56954794-56954816 TTTTTTTTAAAAAAATTGAAAGG + Intergenic
1117876396 14:60254770-60254792 TAGTTTAGAAAGAATTTTGATGG - Intronic
1118047296 14:61984647-61984669 TCTTTTAGTGAGAAATTGGAAGG + Intergenic
1118124459 14:62885151-62885173 TGTTTTTTAAAAAAATTGGTGGG - Intronic
1118514791 14:66515272-66515294 TGTTTAATAAAAAAATTGGGTGG + Intronic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1119244143 14:73089181-73089203 TTTTTAACAAAGAACTTGGAGGG - Intronic
1119372510 14:74159260-74159282 TATTTTATTTAAAAATTGTAGGG - Intronic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120336136 14:83157732-83157754 TGTTTTAAAAATACATTGGAAGG + Intergenic
1120395301 14:83960250-83960272 TTGTTTCTAAAGAAAATGGAAGG - Intergenic
1120871640 14:89342607-89342629 TATTTTGTTAAAAAATTGGAGGG - Intronic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1121197517 14:92087188-92087210 TTTTTTATAAACACCTTGGAGGG + Intronic
1121671067 14:95711157-95711179 TATTTAATAAAGCAATGGTAAGG + Intronic
1122949154 14:105031387-105031409 TATTTTATTTAGGAATAGGATGG - Intergenic
1124002612 15:25771395-25771417 TATTTTTTATAGAGATAGGAAGG - Intronic
1124071863 15:26402661-26402683 TAAATTATAAAGATCTTGGAGGG + Intergenic
1124149649 15:27166136-27166158 TATTTTAGAAGGAAGTTGGATGG + Intronic
1124187040 15:27539845-27539867 TATTTTTTAATTACATTGGAAGG - Exonic
1124797511 15:32796347-32796369 TAATTTTTAAATATATTGGAAGG - Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125416783 15:39462057-39462079 TATTTTAAAAATAAATTCTAAGG - Intergenic
1125839911 15:42790593-42790615 TAATTTATAAATAATTTGGGGGG + Intronic
1125959458 15:43817091-43817113 TATTTCATAAAGTTATTGTATGG + Intronic
1126098849 15:45107687-45107709 TATTTTTTAAAAAAATTAGCCGG + Intronic
1126208287 15:46071306-46071328 AATTTTATAAATAAATATGAAGG + Intergenic
1127446943 15:59072863-59072885 TTTTTAATAAAAAAATTGCAGGG - Intronic
1127682154 15:61308346-61308368 TGTTTTACATAGTAATTGGATGG - Intergenic
1130407933 15:83618943-83618965 TCTTTTATAAATAAACTTGAAGG - Intergenic
1130563493 15:84976608-84976630 TATTTTTTAAAAAATTTGGCTGG + Intergenic
1130785766 15:87094366-87094388 TGTCTTATAAAGGAACTGGAAGG + Intergenic
1131769482 15:95719438-95719460 TGTTTTATAAAGAAATTAAAAGG - Intergenic
1132874846 16:2132271-2132293 TATTTTTAAAAGACATTGGCCGG + Intronic
1133167474 16:3958238-3958260 AATTTTAAAAATAAAATGGATGG + Intronic
1133185615 16:4095559-4095581 TATTTTAGAGAGAGATTGGAAGG - Intronic
1133715537 16:8443873-8443895 TATTTTGTAAAAATATTTGATGG + Intergenic
1133923381 16:10174726-10174748 TATTTTAGAAAGAAACAGCATGG - Intronic
1133946501 16:10353291-10353313 TTTTTAAAAAAGAAATTAGAGGG - Intronic
1134520146 16:14915110-14915132 TATTTTTAAAAGACATTGGCCGG - Intronic
1134553787 16:15151121-15151143 TATTTTTAAAAGACATTGGCCGG + Intergenic
1134707820 16:16313764-16313786 TATTTTTAAAAGACATTGGCCGG - Intergenic
1134959723 16:18398362-18398384 TATTTTTAAAAGACATTGGCCGG + Intergenic
1135133429 16:19870942-19870964 TATTTTTAAAATAAATTGGCTGG + Intronic
1135278280 16:21132165-21132187 TATTTTAAAAAGGAATTGAGGGG - Intronic
1135292034 16:21248188-21248210 TATTTTAAAAAAAAATTTAATGG + Intronic
1135642562 16:24133748-24133770 TATATCATATAGAAATTGTAAGG + Intronic
1135662851 16:24311552-24311574 TATGTGATAAAGAAATTAAATGG + Intronic
1135731353 16:24897618-24897640 TAATTTATAAAGAGGTTGAATGG + Intronic
1135826065 16:25730042-25730064 TATTTTATTTTGAAACTGGATGG + Intronic
1136998778 16:35209816-35209838 TATTGTATAAATAAAGTGTATGG + Intergenic
1137816150 16:51399788-51399810 TATTATAAAAGGATATTGGAAGG - Intergenic
1138808029 16:60115286-60115308 TATTCTATATATAAATTTGATGG + Intergenic
1139138714 16:64235015-64235037 AGTTTTAAAAAGAAATTTGAGGG - Intergenic
1139714162 16:68799339-68799361 TATTTTTTAAACAAACTGGGAGG + Intronic
1140494327 16:75370403-75370425 TATTTTAAAAATAATGTGGAGGG + Intronic
1143611915 17:8022819-8022841 TGTTTTTTCAAGAAAGTGGAAGG + Intergenic
1144082536 17:11777909-11777931 TATAGTATAATGAAATTGAAGGG + Intronic
1144192235 17:12857276-12857298 TATTTTATAAAGAATAAAGAGGG + Intronic
1144622600 17:16827786-16827808 TATTTTAAAAAGAAGTGGGGAGG + Intergenic
1144687803 17:17237486-17237508 CATTTTAAAAAGAGATTTGAGGG + Intergenic
1145330658 17:21869261-21869283 TAGTTTCTAAAGGAATTGAATGG + Intergenic
1145874011 17:28301948-28301970 TAGTTTAGAAATAAATTGGCTGG - Intergenic
1146028343 17:29342652-29342674 TACTTCATAAAGAAAGTAGAGGG - Intergenic
1146172019 17:30641735-30641757 TATTTTATAGAGCTATTGCAAGG + Intergenic
1146345477 17:32057771-32057793 TATTTTATAGAGCTATTGCAAGG + Intergenic
1146417825 17:32653308-32653330 AGTTTTAAAAAGAAATTGGCTGG + Intronic
1148228320 17:45915010-45915032 TTTTTTAAAAAGCAATTGGCTGG - Intronic
1148997905 17:51727733-51727755 TATTTGATAAATAAATAGGATGG - Intronic
1149080303 17:52648320-52648342 TATTTGATAGAGAATTTGGCAGG + Intergenic
1149122329 17:53184669-53184691 TACATTAAAAAGAAATCGGAAGG - Intergenic
1150701732 17:67452812-67452834 TAACTTATAAAGAAATTGCCAGG + Intronic
1151111411 17:71682454-71682476 TATTTTATAAATATATTATAAGG + Intergenic
1152058838 17:78053274-78053296 CATTTTATAAAGTACTTGGGGGG + Intronic
1152685692 17:81692848-81692870 TATTTTATACAAAAATTAGCGGG + Intronic
1153014249 18:569190-569212 TATTTCACAAAGTATTTGGAGGG - Intergenic
1153423509 18:4936284-4936306 TATTTTATTAATAACTTAGAGGG - Intergenic
1153578276 18:6544813-6544835 TATTTTAAGAAGAAATTTGAAGG - Intronic
1153680098 18:7492331-7492353 GGTTTTATAAGGGAATTGGATGG + Intergenic
1154111760 18:11575296-11575318 TATTTTAAAAATTAATTGGAAGG + Intergenic
1154258035 18:12801906-12801928 TATTTTAAAAATAAATTTTATGG - Intronic
1155684740 18:28534808-28534830 TTTTCTATAAAAAAATTGTATGG + Intergenic
1155837657 18:30606726-30606748 TATATAAGAAAGAAATTTGAGGG + Intergenic
1155845506 18:30700651-30700673 TATTGTATAAAGCAATTAAATGG - Intergenic
1155850202 18:30765065-30765087 TATTTTATAAGATAATTGTAAGG + Intergenic
1156030659 18:32708535-32708557 TATTTTTTAAAGATATAGCAGGG - Intronic
1157962910 18:52176809-52176831 TATTCTATCAAGACATAGGAAGG - Intergenic
1158113336 18:53966327-53966349 CATTTTAAAAAATAATTGGAAGG + Intergenic
1158653247 18:59306650-59306672 TATTTTCTAAAGAAATTATTTGG - Intronic
1158815469 18:61089971-61089993 TAGTTCATAACGAAATTGAAAGG + Intergenic
1159183374 18:64939773-64939795 TATTTTATAAAGATGGTGCATGG - Intergenic
1159184770 18:64955364-64955386 TAGTTTTTAAAGAAATGAGATGG + Intergenic
1159234635 18:65655719-65655741 TGTTTTATAAACAAATTGAAGGG + Intergenic
1159242799 18:65764516-65764538 TTTCTTATAAAGAAATTGAGAGG + Intronic
1159426539 18:68295758-68295780 TATTTTTTAAATAAATCGTATGG + Intergenic
1159712777 18:71783681-71783703 TTTTTAATAAAAAAATTGAATGG + Intronic
1159750823 18:72300619-72300641 TATTTTATCAAGATATTTGGAGG + Intergenic
1160162925 18:76489131-76489153 TCTTTTAAAAAGAATTTGGTGGG - Intronic
1160213082 18:76900651-76900673 TATTATGTAAACAGATTGGATGG + Intronic
1160440837 18:78891099-78891121 TCTTTTTTAAAAAAATTAGATGG - Intergenic
1162473040 19:10883719-10883741 AATTTTTTAAAAAAATTGGCTGG + Intronic
1162875939 19:13621080-13621102 TAATTTAAAAAGAAATTGGCTGG + Intronic
1162990408 19:14298300-14298322 TATTTTATAGAGCTATTGCAAGG - Intergenic
1163395355 19:17057051-17057073 TAATTTTTATAGAAATTGGCCGG + Intronic
1164206005 19:23059325-23059347 TATTGTATAAAGCTCTTGGATGG - Intergenic
1164282366 19:23780180-23780202 TATTGTATAAAGCACTCGGATGG + Intronic
1164312963 19:24062175-24062197 TATTGTGTAAAGCACTTGGATGG + Intronic
1164462117 19:28457769-28457791 AATTTAAAAAAGAAAATGGATGG - Intergenic
1165484629 19:36088225-36088247 TATTCTGTAAAGAAATGAGACGG + Intronic
1167188810 19:47968064-47968086 TATTTTATTAAGAAAATTGGGGG + Exonic
1167367124 19:49060491-49060513 AATTATATAAAGAAATTAGCTGG - Intronic
1167394010 19:49215512-49215534 TTTTTTAAAAAAAAATTTGATGG - Intergenic
1167450492 19:49565450-49565472 TGTTATAAAAAGAAATTGGCTGG + Intronic
1167841753 19:52127410-52127432 AATTTTGGAAAGAAAATGGAGGG + Intronic
1168390804 19:56006422-56006444 AATTTTAAAAAAAAAATGGATGG + Intronic
925069382 2:954632-954654 CATTTAATACAGAAATAGGAAGG - Intronic
925806545 2:7656009-7656031 TATTTTATAAAGAAGGGTGAAGG - Intergenic
926535539 2:14106680-14106702 TTTTTTATTAACAAATTTGAGGG - Intergenic
926772375 2:16389820-16389842 TATATTGTATAGAAATTGGCTGG - Intergenic
926881186 2:17544970-17544992 TATTTTAAAAATGGATTGGAGGG - Intronic
927326188 2:21807983-21808005 TATTTTAAAAAGTAATGGAAGGG + Intergenic
927580376 2:24238593-24238615 TTTTTTCTAAAAAGATTGGATGG - Intronic
927591965 2:24364379-24364401 TAATTTATAAAGAAATTAATAGG + Intergenic
928058003 2:28078005-28078027 TATTGTACAAAGAAATTAAATGG + Intronic
928067679 2:28182947-28182969 TATCTTGTAAAGTAAGTGGAAGG - Intronic
928562533 2:32505596-32505618 TATCTTGTAAAGAAGTTGGAGGG - Intronic
929091997 2:38227386-38227408 TATTTTTTAAAGAACTTGTAGGG - Intergenic
929314935 2:40465764-40465786 TATTTTAAAAATAAATTTTAGGG - Intronic
929706916 2:44223159-44223181 TATTTTATAAAGTTGTTGAAAGG + Intronic
930341482 2:50121347-50121369 TACTTTTTAAAGTAATTGTAAGG - Intronic
930410104 2:51014615-51014637 TATTTTATAAATAAAAAAGAAGG + Intronic
930686780 2:54317930-54317952 TAGATTATTAAGAAATTGGGAGG + Intergenic
930926794 2:56827996-56828018 CATTTTATAAAGAAATGGCATGG + Intergenic
931612893 2:64122907-64122929 TATTATAAAATGAAATTGGAAGG - Intronic
931862333 2:66369121-66369143 TTTTTTAAAAAGAAATTTTAGGG + Intergenic
931896535 2:66737094-66737116 TATTTTAGGAAGAAATTCTAAGG - Intergenic
931952375 2:67379618-67379640 TAATTTATAAAGAAAAGAGATGG - Intergenic
932294667 2:70614428-70614450 TATTTTTTAAATGTATTGGAAGG + Intronic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
932900141 2:75688315-75688337 TTTTTTATAAACAAATTCCATGG - Intronic
933056658 2:77679209-77679231 CATTTTATTAAATAATTGGAAGG - Intergenic
933197946 2:79414180-79414202 TTTATTATAAACAAAATGGAGGG - Intronic
933334300 2:80937036-80937058 TATTTTTTAAAGAAAAAAGAAGG + Intergenic
933349144 2:81130653-81130675 TTCTTTATAAAATAATTGGAAGG - Intergenic
933491224 2:82987259-82987281 TATTTGATAAAGAGAAAGGAGGG - Intergenic
934719897 2:96566592-96566614 TATGTTATTAATAAATTGCATGG + Intergenic
935180698 2:100688737-100688759 AATTTTAAAAATAAGTTGGAGGG - Intergenic
935401430 2:102664334-102664356 TTTGTTACAAAGAAATGGGAAGG - Intronic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
935613071 2:105046293-105046315 TATTTCATAGAGAAAATAGAGGG + Intronic
935642437 2:105303893-105303915 TTTTTGCTGAAGAAATTGGATGG - Intronic
936051188 2:109224982-109225004 TATTTTAAAAAGAATTTTGTGGG + Intronic
936402729 2:112177480-112177502 TTTTTAAAAAAGGAATTGGAGGG - Intronic
936619327 2:114078936-114078958 TTTTTTTTACAGAAATTGTAGGG + Intergenic
936698432 2:114980502-114980524 GATTTTATAAACAAATTTAAAGG + Intronic
937085299 2:119167734-119167756 TGTTTTGTAAAGTATTTGGAAGG + Intergenic
937503315 2:122507687-122507709 TGTTTGTTAAAGAAATTGGAAGG + Intergenic
938503393 2:131849820-131849842 AATTTTATAAGAAAATTTGAGGG - Intergenic
938646463 2:133335878-133335900 AATTTTATAAACAAAATGAATGG + Intronic
939261219 2:139812187-139812209 TATTTTAAAAAGAAATTGTATGG - Intergenic
939289194 2:140171215-140171237 TAATTTATAAAGAAATGAGGAGG - Intergenic
939443477 2:142278752-142278774 AATTTTATAAAGACAGTGAAGGG + Intergenic
939727171 2:145735757-145735779 TATTTTTTGAACAAATTGTAAGG + Intergenic
939767812 2:146274508-146274530 TATTGAATAAAGAAATTACAAGG + Intergenic
939917900 2:148070524-148070546 TACTTAATAGAGAAATTGGTAGG + Intronic
940407248 2:153319217-153319239 TAGTTTATAAAGTACTTGCATGG - Intergenic
940409965 2:153350190-153350212 TATTTTAAAAATAAATGGAAAGG + Intergenic
940799926 2:158122305-158122327 TAATTTATAATGAAATAGTATGG - Intronic
941155835 2:161976961-161976983 TATTTTATATCTAAATTTGATGG - Intronic
941188955 2:162352815-162352837 TATATTATAACTACATTGGAAGG - Intronic
941365725 2:164608895-164608917 TATTTTATGATAAAATAGGATGG + Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG + Intergenic
942250528 2:174043943-174043965 TATTTTAAAAAGGAAATGGTAGG + Intergenic
942267706 2:174244926-174244948 TATTTTTTTAAAAAATTGGCTGG - Intronic
942633878 2:177980599-177980621 TTTTTTATGAAGACATTGGTTGG + Intronic
942886029 2:180925064-180925086 AATTTTAAAAATAAAATGGAAGG + Intergenic
943204691 2:184878461-184878483 TATTTTATATAGAAAGCGTAAGG + Intronic
943370171 2:187006366-187006388 AAATTTATAAAGATTTTGGAAGG + Intergenic
943415971 2:187604127-187604149 TATCTGATAAAGAAAGTGGATGG - Intergenic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
944065831 2:195618046-195618068 TATTTTAAAAAGAAAAAGAAGGG + Intronic
944354755 2:198773977-198773999 TATTTTGATAAGAAATGGGATGG - Intergenic
945415843 2:209571069-209571091 TATTAAATAAACAAATTGTAAGG - Intronic
945662112 2:212699067-212699089 TATATTATAAAAAATTTGAAAGG - Intergenic
946634449 2:221708786-221708808 GATTTTAAAAAGAAAAGGGAGGG - Intergenic
946857647 2:223968630-223968652 TTTTTTATAAAGAAAGATGAAGG + Intergenic
946880637 2:224173945-224173967 TATTAGATAAAGGAACTGGAAGG - Intergenic
946942961 2:224789380-224789402 TTTTTTATAAAGAAATAGCATGG + Intronic
946992196 2:225346267-225346289 TAATTTATAAAGAAAAGAGAAGG - Intergenic
947002471 2:225472723-225472745 TTATCTAGAAAGAAATTGGATGG + Intronic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
947497217 2:230646630-230646652 TAATATATAAGGAAATTGAAGGG + Intergenic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
948024856 2:234768883-234768905 TATTTTAGAAAGGAAAGGGAGGG - Intergenic
948163937 2:235846625-235846647 TATTTAATAAATAAATAGGTTGG - Intronic
1168823493 20:793129-793151 TATTTTTAAGAGAAATAGGAGGG - Intergenic
1168828489 20:830747-830769 AATTTTAAAAAGAAATTAGCTGG - Intergenic
1169015139 20:2285957-2285979 TCTCTAAAAAAGAAATTGGAGGG - Intergenic
1169552616 20:6716544-6716566 TATATTTTAAAGAAATTGTTAGG - Intergenic
1169659716 20:7964830-7964852 GATTTTACAAGGAAACTGGAGGG - Intergenic
1169918809 20:10711286-10711308 TATCTTATAAAGAAATGAGTAGG - Intergenic
1170248326 20:14249390-14249412 TATTTTGACAAGAAATAGGAAGG + Intronic
1170249922 20:14270023-14270045 TATTCAATAAAGAAATTATAGGG + Intronic
1170559852 20:17547608-17547630 GTTTGTAAAAAGAAATTGGATGG + Intronic
1171427143 20:25056475-25056497 TATTTTTCAAAGAAATTGGAAGG - Intronic
1172652674 20:36515210-36515232 TATATTTTGAAGATATTGGATGG + Intronic
1173295825 20:41755588-41755610 TATATAAAAAAGAAATTGGCTGG - Intergenic
1175819150 20:61899141-61899163 TATTTTAAAAAAAAATTAGCCGG + Intronic
1176897878 21:14404446-14404468 TAAATTATAAAGAAATTGTAAGG + Intergenic
1177046970 21:16182995-16183017 CATTTTATAAAGATAATGGAGGG - Intergenic
1177208968 21:18046093-18046115 TATTTTTTAAAGAAATAAAAGGG + Intronic
1177423113 21:20887559-20887581 TATATTTTAAAGATATTTGAAGG + Intergenic
1177560466 21:22744262-22744284 GATTGGATCAAGAAATTGGAGGG + Intergenic
1177665561 21:24152986-24153008 TGTTTTAGAAAGAAATTCAAGGG + Intergenic
1177945134 21:27458370-27458392 CATTTTATAAAGAAAATCTAAGG + Intergenic
1179196711 21:39170962-39170984 TATTTTTTAAAAAAATGAGATGG - Intergenic
1179490768 21:41740365-41740387 TATTTTATAAAACAATTCCATGG + Exonic
1180550602 22:16533642-16533664 TATTAAATAAATAAATAGGATGG + Intergenic
1181764693 22:25082864-25082886 TATTTTATATAGAAATTCTGAGG + Intronic
949112976 3:285328-285350 CATTTTATAGAGAAAATGGTGGG - Intronic
949441663 3:4087690-4087712 TATTATATAATCAAATTGAAAGG + Intronic
950137674 3:10593167-10593189 TATTTTTAAAAGAAAATGAAAGG + Intronic
950816580 3:15709777-15709799 GATTTTATAATGAAATTGGTAGG + Intronic
951084743 3:18498470-18498492 TATTTTATAAACAAAGGAGATGG - Intergenic
951119185 3:18904297-18904319 TAATTTATAAAGAAAATTAAAGG - Intergenic
952243559 3:31561275-31561297 TATTTTTTAAAAAAATTTTATGG + Intronic
952273386 3:31853957-31853979 TATCTTATAAGGATATTGTAAGG + Intronic
953813545 3:46134412-46134434 TATTTTACCAAGAAAATAGAAGG + Intergenic
953898226 3:46820589-46820611 AATTTTTTAAACAAATTAGATGG + Intergenic
954165661 3:48755566-48755588 TATAATAAAAAGAGATTGGAAGG - Intronic
954948225 3:54445277-54445299 CATTTTTTAAAGAAATGAGATGG - Intronic
955795355 3:62630643-62630665 TACTTTAAAAAGAAACTGCATGG - Intronic
955875936 3:63490395-63490417 TCTTTTACAAACAAATTGTATGG - Intronic
956106396 3:65823193-65823215 TATTTCATAATAAAATAGGAAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956413831 3:69006361-69006383 TACTTTATAGAGCTATTGGAGGG - Intronic
956974064 3:74559780-74559802 TATTATATTAAGCAATTGCATGG - Intergenic
957259626 3:77883644-77883666 TATTTTATAAAGAAATGAGTTGG + Intergenic
957460858 3:80518017-80518039 TAGTTTATATAGAAAATGCAGGG - Intergenic
957698204 3:83671964-83671986 TATTTTGTACAGAATTTGGCAGG + Intergenic
958065489 3:88540442-88540464 TATTTAAAAAACAAAGTGGAGGG - Intergenic
958507564 3:94999706-94999728 TAATCTATAAACAATTTGGAAGG - Intergenic
958568395 3:95846261-95846283 TACTTTATAAAGCAAGTGGGAGG + Intergenic
958642779 3:96829196-96829218 CTTTTTAAAAAGAAATTTGATGG + Intronic
958993447 3:100874046-100874068 TATTCTCTAGAGACATTGGAGGG + Intronic
959364826 3:105443939-105443961 TATATGATAAAGAAATTCTAGGG + Intronic
959499389 3:107088070-107088092 TATTTTATACAGAACTTGTGAGG + Intergenic
959795713 3:110426101-110426123 TATTTTATAGCTAAATTGCAAGG - Intergenic
959844418 3:111016856-111016878 AATTATATAAATATATTGGAAGG - Intergenic
959892499 3:111571826-111571848 TACTTTATAAGGACATTAGATGG - Intronic
960161800 3:114357902-114357924 TATTTTTTAAAAAGATTGAAAGG + Intronic
960386860 3:117030901-117030923 CATTTTATAAAGCATTTGGGAGG - Intronic
960787758 3:121392557-121392579 TCTTTTATATAGCAATTGAAAGG + Intronic
960875187 3:122288778-122288800 TATTTTAAAAAGTAATTAAAAGG - Intergenic
961235242 3:125360717-125360739 TATTTTATAAACAAACTGTTGGG + Intronic
963597456 3:147346381-147346403 TCATTTATAAAGAAAATGGAAGG - Intergenic
963988528 3:151626387-151626409 TATTTGATAAAGAAGTTTAAAGG - Intergenic
964220301 3:154336626-154336648 TATTTTATTAAGTGATTGTAAGG - Intergenic
964319834 3:155483569-155483591 TAATTTCTAAAATAATTGGAAGG + Intronic
964354308 3:155835982-155836004 TTTTTTTTAAAGAAATTATAAGG + Intronic
964368321 3:155972375-155972397 TATTTTATTATGAAATTATAGGG + Intergenic
964389441 3:156182555-156182577 GATTTTCTTAAGAAAATGGAAGG - Intronic
964397157 3:156257534-156257556 TATTGTGTAAAGATATTGTAGGG - Intronic
965054028 3:163691272-163691294 AACCTTATAAAGAAATTTGATGG - Intergenic
965066825 3:163859851-163859873 TATTTGAGAAAAAAAATGGATGG - Intergenic
965227573 3:166009182-166009204 GATTTAATAAACAAATTGAATGG - Intergenic
965241050 3:166198121-166198143 TATTTTATACAAAAATTAGCCGG - Intergenic
965273358 3:166648255-166648277 TATCTTATAAAGGTATTGGCGGG + Intergenic
965402710 3:168232149-168232171 TATTTTGGAAAAAAAATGGAGGG - Intergenic
965569369 3:170156123-170156145 TATTTTATTAAGAAAAGAGATGG + Intronic
966271551 3:178112946-178112968 TAATTTATAAAGAAAAGAGATGG - Intergenic
966408346 3:179622448-179622470 TATTTTTTAATGAAATAGGAAGG + Intronic
967104314 3:186242964-186242986 TATTTTAAAAAGAACTAGTATGG - Intronic
967134420 3:186501527-186501549 TGTTATATAAGGAAGTTGGATGG + Intergenic
967469645 3:189846979-189847001 TCTTTAATAAAGAATGTGGAAGG - Intronic
967622151 3:191646806-191646828 TTTTTTACAAAAAAATTGTATGG - Intergenic
967784890 3:193481927-193481949 CATTTTTTAAAGAAATTGACAGG + Intronic
968016898 3:195343921-195343943 TAATTTATAAAGAATTTGGTTGG + Intronic
968259111 3:197305021-197305043 CCTTTTATAAATAAATTGGGCGG + Intergenic
968854613 4:3110294-3110316 CATATTACAAAGAAGTTGGAAGG - Intronic
970125486 4:12805190-12805212 TATCTTATGGAGAAATTGAAAGG - Intergenic
970368150 4:15381636-15381658 TTATTTATAAAGAAATTCTATGG - Intronic
970552406 4:17195566-17195588 TAGTTTAAAAAAAAATAGGAGGG + Intergenic
970696848 4:18688017-18688039 TATTTTTTAAAAAAATTTTAAGG - Intergenic
970937514 4:21591084-21591106 TATTTAACAAAGAAAAAGGAAGG + Intronic
971135805 4:23867050-23867072 AATTTTATAAATAAATAAGAGGG + Intronic
971512786 4:27447791-27447813 TATTTTATAAAGCAATATTAAGG - Intergenic
971630842 4:28991699-28991721 AATTTAATAAAGAAATTGTATGG + Intergenic
971761576 4:30772849-30772871 TATTTGATAAAGGAATTGTTAGG - Intronic
971770404 4:30888172-30888194 CATTTTAAAAAGAAATGGGCCGG - Intronic
972100550 4:35409205-35409227 TATTTTATAAAGTAATGAAAAGG + Intergenic
973656529 4:53053781-53053803 TTTTTTAAAAAGAAAATAGAAGG - Intronic
973958876 4:56089974-56089996 TATTTTAAAATGAAATTTTAAGG - Intergenic
974610595 4:64210352-64210374 GCTTTTATAAAGGGATTGGAGGG + Intergenic
974618699 4:64326167-64326189 TATTGTATAAAGGATGTGGATGG + Intronic
974717657 4:65691021-65691043 TTTTTCATAAAGAAATGGAATGG + Intergenic
975008048 4:69314848-69314870 TGTTTTTTAAAAAAATTTGAAGG - Intronic
975350900 4:73344998-73345020 TATTTTAGAAAGAAATAATATGG - Intergenic
975548646 4:75587607-75587629 TATATTTTAAAGAAATTGAGAGG + Intronic
975652286 4:76605828-76605850 TGTTATAGAAAGAAATTGAATGG - Intronic
975849412 4:78556530-78556552 TATTTTATAAGTAAGGTGGAGGG + Intronic
976040168 4:80874627-80874649 TGCCTTATAAAGAAATTGGAGGG - Intronic
976103864 4:81595376-81595398 TGTTTTACAAAGAAATTTAAAGG - Intronic
976279107 4:83309059-83309081 TATTTTATAACTATATAGGAGGG - Intronic
976569440 4:86591918-86591940 TATGTTATAAAGGAAGTGGCTGG + Intronic
976570984 4:86610624-86610646 GATTTCATATAAAAATTGGAGGG - Intronic
976759556 4:88533444-88533466 GATTTTATAAATAAAATTGAAGG + Intronic
976965713 4:91037754-91037776 TATTTTTTAAAAATATTTGATGG + Intronic
977320737 4:95512357-95512379 ATTTTTACAAAGAAACTGGATGG + Intronic
978040149 4:104050625-104050647 CATTTAATAAAGGAATTGGGGGG - Intergenic
978053871 4:104238820-104238842 TATTTTTTAAAAAAATTTAAAGG - Intergenic
978396862 4:108290022-108290044 TATTTTAAAAAGATAAGGGAGGG - Intergenic
978684120 4:111418037-111418059 TATTTTAATAAGAAAATGAAAGG - Intergenic
978789382 4:112644915-112644937 TATTTTATAAGTAAATTTAAAGG - Intronic
979133843 4:117084133-117084155 TATTTTTTAAAGACATTTGAGGG - Exonic
979137840 4:117131720-117131742 TAAATTAGAAAGAAATTGAATGG - Intergenic
979150944 4:117313502-117313524 GGTGTTATAAAGAAATTGGAGGG + Intergenic
979290108 4:118970475-118970497 TATATAGTAAAAAAATTGGAGGG - Intronic
979350518 4:119638963-119638985 TAGTTTAGAAAGAAATAGCATGG + Intergenic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
980000814 4:127485568-127485590 TATTGTATAATGTAATTGAAAGG + Intergenic
980029779 4:127813976-127813998 TATTATATAAAGAAAATTAAAGG - Intronic
980159499 4:129142695-129142717 TATTTTATAAAGGATATGAAGGG - Intergenic
980242077 4:130190431-130190453 TATTTTAAAAAGAGATTTAATGG - Intergenic
980319162 4:131245625-131245647 TATTTTAAAAAGCATGTGGAAGG - Intergenic
980394719 4:132196293-132196315 AATTTTTTAAAAAAATTGAAAGG - Intergenic
980598040 4:134981481-134981503 CATATTAGCAAGAAATTGGAGGG - Intergenic
980766168 4:137307685-137307707 TATTTTCTCAAGAAATTGCTGGG - Intergenic
980789667 4:137603706-137603728 TAATTTATAAAGAAAATGAATGG - Intergenic
980835090 4:138181534-138181556 TACTTTAAAAAGAAATTTCAAGG + Intronic
980854453 4:138422970-138422992 AATATTAAAAAAAAATTGGATGG - Intergenic
980902386 4:138917222-138917244 AAAGTGATAAAGAAATTGGATGG - Intergenic
980925913 4:139137401-139137423 TATATTAGAATGAACTTGGAGGG - Intronic
981727533 4:147862823-147862845 TATTTAATAAAGACATAAGAAGG - Intronic
981890900 4:149735819-149735841 AATTTTATCAACAAGTTGGAAGG - Intergenic
981926083 4:150140879-150140901 GAATGTATAAAGAAGTTGGATGG + Intronic
982148232 4:152422071-152422093 TTTTTTTTAAACAAATTGAAGGG - Intronic
982989031 4:162247028-162247050 TCTTTTATAAAGAAATTTTCAGG + Intergenic
983119744 4:163867330-163867352 TATCTAACAAAGAAATTAGATGG - Intronic
983687365 4:170427555-170427577 CATTTTATAAAGAATTTTAATGG + Intergenic
983983905 4:174034872-174034894 TCTTTGATAAAGAAATTTGCAGG + Intergenic
984124557 4:175791170-175791192 TATTTAATAAATAAATCAGATGG + Intronic
984216750 4:176922699-176922721 CATACTATAAAGAAATTGAAAGG + Intergenic
984435997 4:179710899-179710921 ACTTTTATAAAATAATTGGATGG + Intergenic
984894985 4:184530399-184530421 TAATTTATAAAGAAAAAGAACGG - Intergenic
984931091 4:184847650-184847672 TATTTTATAAATAATTTGTTGGG - Intergenic
984950677 4:185005270-185005292 TAATGTATAAATAAATAGGAAGG - Intergenic
985140621 4:186836886-186836908 TATTTGCTAAAGCAATTGGAAGG + Intergenic
985309117 4:188577815-188577837 TATATTAAAAATAAAATGGAAGG - Intergenic
985331282 4:188838635-188838657 AATCTCATAAATAAATTGGAAGG + Intergenic
985811903 5:2096427-2096449 TATTTTAGAAAGAATTTTAAAGG + Intergenic
986436461 5:7737018-7737040 TATTTTCAAAAGAAAAAGGAAGG + Intronic
986780430 5:11060234-11060256 TATATTATAATGAAAATGAATGG - Intronic
986821925 5:11476865-11476887 AATATTACAAATAAATTGGAGGG - Intronic
986881640 5:12179791-12179813 TATTATATAGAGAAATTGCTAGG + Intergenic
986925951 5:12750856-12750878 GATTTTATTAAGAAATAGAATGG - Intergenic
987085025 5:14460215-14460237 CATTTTAAAAAGAAATGTGAGGG - Intronic
987496749 5:18654862-18654884 TTTTTTAAAAAGAAATTGTTTGG + Intergenic
987560050 5:19508217-19508239 TATTTTCTAAAGAAAGTCTAAGG - Intronic
987839777 5:23208556-23208578 TATTTTATAAATAATTTGTTTGG + Intergenic
987960273 5:24797968-24797990 TATTTTATAATAAAATTTGGGGG - Intergenic
987978385 5:25045940-25045962 TATTATATAATGAAATCTGAAGG - Intergenic
988156237 5:27452716-27452738 TATTTTATAAAATATTTGAAAGG + Intergenic
988519811 5:31935579-31935601 TATTTTATAAAGAAGTCTGTTGG - Intronic
988613155 5:32747318-32747340 TATGTTATAAAGTATTAGGAAGG - Intronic
988945837 5:36198019-36198041 TATTTTGGAAAGAACTTGGTAGG - Intronic
989223742 5:39000813-39000835 TAATATATAAAAAAATTGGGGGG - Intronic
989234358 5:39127957-39127979 TATTTTATAAAGAATTCTTAGGG + Intronic
989392632 5:40917695-40917717 TATTTTAAATAGAAGTTTGAAGG - Intronic
989774446 5:45186380-45186402 TATTATATATACACATTGGAAGG - Intergenic
990057123 5:51596806-51596828 TAATTTTTAAAAATATTGGATGG - Intergenic
990129286 5:52559832-52559854 TATTTTATTAAAAAAATGAAAGG + Intergenic
990196766 5:53325961-53325983 TATATTACAAGGAAATTGTAAGG + Intergenic
990397515 5:55398074-55398096 TAATTTAAAAAGAAATTAGTAGG + Intronic
990525646 5:56624264-56624286 TATTTTTAAAAGAAATAGGCTGG - Intergenic
990819671 5:59823787-59823809 TATCTTAAAAAAAAAATGGAAGG - Intronic
990863343 5:60352732-60352754 TATTTTATAAGGAAAATTAATGG + Intronic
990955662 5:61335831-61335853 TATTTTAAAAAGAAATTTAAGGG + Intronic
992504359 5:77371571-77371593 AAATTTATATAGAAATTGAAAGG - Intronic
992700986 5:79341900-79341922 TAATTAATAAAGAAAATGGAGGG + Intergenic
993326300 5:86542208-86542230 TTTTACATAAAGAAATTGGAGGG - Intergenic
993534339 5:89062957-89062979 TATTTGAAAAAGAAGTTTGAAGG + Intergenic
993588181 5:89759022-89759044 GCTTTTAGAAAGAATTTGGAAGG + Intergenic
993637907 5:90367719-90367741 TATATTATAAGGTAATTGTAAGG - Intergenic
993777793 5:92023006-92023028 TATTTTTTTAAAAAATTGAAAGG + Intergenic
994384066 5:99107534-99107556 TTTTTTATAGAGAAATTGCCAGG + Intergenic
994858641 5:105159217-105159239 CAATATATAAAGAACTTGGAAGG + Intergenic
994863644 5:105233792-105233814 TATATTGTTAAGAGATTGGAAGG + Intergenic
995099986 5:108288576-108288598 TGTTATATAAATATATTGGAAGG + Intronic
995112917 5:108447129-108447151 TATTTTGTGAAGAAATTGACTGG + Intergenic
996059189 5:119014103-119014125 TATTTTAAAAATAGAATGGAGGG - Intergenic
996251408 5:121338113-121338135 TTTTCTATAAAGCAATTGAATGG + Intergenic
996621089 5:125504073-125504095 TGTTGTATAAAGGAATTGGAAGG - Intergenic
996640992 5:125753400-125753422 TATTTTTTAAAGTAATCGGCTGG + Intergenic
996691398 5:126344172-126344194 TATTTTATAAAGAGTTTGTCAGG + Intergenic
996695750 5:126392922-126392944 TATTTGAAAAATAAAGTGGAAGG + Intronic
996787008 5:127249079-127249101 TATGTTTTAAAGAAATTTAAAGG - Intergenic
997833405 5:137172524-137172546 TATTTAATAAAGCAATTGAAGGG + Intronic
997881932 5:137599512-137599534 TATTTGATGAAGAAATTTGATGG + Intergenic
997917416 5:137941943-137941965 CATTTTATCAACAAAATGGAAGG - Exonic
998311959 5:141141970-141141992 TATTTTAAAAAAAAATTAGCTGG - Intronic
998903997 5:146884207-146884229 TTTATTGTACAGAAATTGGAGGG - Intronic
999349425 5:150854306-150854328 TATTTTTTAAAGAATTTAAAAGG - Intronic
999787379 5:154904085-154904107 TTTTTTAGAAAAAAATTTGATGG - Intronic
999816118 5:155178108-155178130 AATTTTATAAATGAATTTGAAGG - Intergenic
999972274 5:156876562-156876584 TATATAATAAAGAATTTGGCTGG - Intergenic
1000414591 5:160970202-160970224 AATATTTAAAAGAAATTGGAGGG - Intergenic
1000709361 5:164551956-164551978 TATTTTCCAAAGAAATCTGAAGG - Intergenic
1000922877 5:167159300-167159322 TATTTAACAAATAAATTGCATGG - Intergenic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1001861974 5:175063999-175064021 TTTCTTACAAATAAATTGGAAGG + Intergenic
1002004408 5:176220738-176220760 TACATTATAAATAAATGGGAGGG - Intergenic
1002221963 5:177689889-177689911 TACATTATAAATAAATGGGAGGG + Intergenic
1002777090 6:337614-337636 TATTTTAAAAAGAAAAAGTATGG - Intronic
1003386749 6:5674844-5674866 GATTTTTTAAAGAAATTGCCTGG + Intronic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004487441 6:16080192-16080214 TTTTTTCTAAAGAAATTTCAAGG - Intergenic
1004728731 6:18336617-18336639 CATTTTATAAAGAAACTGACAGG - Intergenic
1005487956 6:26319181-26319203 TATCTTAAAAGGAAAATGGAGGG - Intergenic
1005529424 6:26687923-26687945 TATTTCATAAAGAAGTTTGGTGG + Intergenic
1005541372 6:26813723-26813745 TATTTCATAAAGAAGTTTGGTGG - Intergenic
1005879845 6:30048095-30048117 AAATTTATAAAGAAATTAAAGGG + Intergenic
1006174764 6:32115275-32115297 TATTAAATAAACAACTTGGAGGG - Exonic
1007133552 6:39499334-39499356 TTTTTTTTAAAGAAAGGGGAGGG + Intronic
1007294097 6:40808270-40808292 TTATTCATTAAGAAATTGGATGG + Intergenic
1007678649 6:43618945-43618967 TATTTTATTTATAAATTGGGGGG + Intronic
1007981708 6:46166138-46166160 AATTTTATAAAGGAAATCGAAGG + Intronic
1008075141 6:47138113-47138135 TATTTTAGAAAGAAATTTATTGG + Intergenic
1008133722 6:47747822-47747844 TATTTTAAAAATAAATAGGCCGG - Intergenic
1008230538 6:48981035-48981057 TATTTTATATAAAAATTATATGG - Intergenic
1008338675 6:50337423-50337445 AATTGTATACAGCAATTGGATGG - Intergenic
1008741969 6:54619938-54619960 TATGTAATAAAGAAATAAGAAGG - Intergenic
1009012175 6:57855787-57855809 TATTTCATAAAGAAGTTTGGTGG - Intergenic
1009266156 6:61557309-61557331 TATTTACTAGAAAAATTGGATGG - Intergenic
1009663777 6:66649658-66649680 TATTTTTTAAACAAACAGGAAGG + Intergenic
1009769625 6:68128703-68128725 TATTTCATAAAAATATTGTAAGG - Intergenic
1009817701 6:68757091-68757113 AAATTTATAACCAAATTGGAGGG - Intronic
1009911473 6:69935008-69935030 TATTTTATAAAGCATTTCAAAGG + Intronic
1010155710 6:72789938-72789960 CATTTTATAATTAACTTGGATGG + Intronic
1010251501 6:73712046-73712068 TATTTTATACAAAAATTAGCCGG + Intronic
1010432281 6:75791965-75791987 GATTTTTTAAAGAAAGTAGAGGG + Intronic
1011153973 6:84308418-84308440 TATTTTAAATTGAAATTGGAGGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012162658 6:95905499-95905521 CAGTTTCTAAAGGAATTGGAAGG + Intergenic
1012188132 6:96247351-96247373 TATAACATAAAGCAATTGGAGGG + Intergenic
1012559424 6:100561034-100561056 TATTTTATAAAACAAGTGGTTGG - Intronic
1012881314 6:104793889-104793911 GATTCTATAAAGCACTTGGAAGG + Intronic
1013542622 6:111125700-111125722 TTTTTTATATAGCAATTGAAAGG - Intronic
1013672154 6:112416444-112416466 TATAGAATAGAGAAATTGGAAGG + Intergenic
1015105580 6:129532546-129532568 TTTTTTTTAAAGTAATTGTAGGG - Intergenic
1015911642 6:138174062-138174084 TTTTTTAAAAACAATTTGGAAGG + Intronic
1016449069 6:144162491-144162513 TATTTTATCCAGAATGTGGAAGG + Intronic
1016516539 6:144898658-144898680 TATTTTTTAAAGCAATTTTATGG + Intergenic
1016615421 6:146042253-146042275 CAGTTTATAAATCAATTGGAAGG + Intronic
1016661160 6:146582572-146582594 TAATTGATAAAAAATTTGGAGGG + Intergenic
1016752102 6:147641882-147641904 CATTTTATAAATAAATTGAGGGG - Intronic
1017696341 6:157020184-157020206 TATTTAGAAAATAAATTGGATGG + Intronic
1018606600 6:165604056-165604078 TATATAACAAAGAAATAGGAAGG + Intronic
1018664214 6:166119548-166119570 CATTTCATAAAGAGTTTGGATGG - Intergenic
1019201639 6:170321181-170321203 AATTTTATAGAGAAAATGTAAGG - Intronic
1020097036 7:5374943-5374965 TCTTTTATGAGGAAATGGGAGGG + Intronic
1020372084 7:7443246-7443268 GATTTTATAAAGAAAATTTATGG + Intronic
1020612820 7:10422202-10422224 TTTTGTGTAAAGAAATTGGGTGG + Intergenic
1020871635 7:13637841-13637863 TATTCTATAAAGAACTTTGAAGG + Intergenic
1021257175 7:18406687-18406709 TATTTTAGAAAAAAAGGGGAAGG - Intronic
1022123833 7:27336660-27336682 TATTTTTTTAAAAAATTGGTTGG + Intergenic
1022214471 7:28244625-28244647 TATTTTTTAAAGAAAATACAAGG + Intergenic
1022553560 7:31267924-31267946 TAGATTAAAAAGAAATTTGAAGG - Intergenic
1022559566 7:31335141-31335163 TATAGTATAAAGAACATGGAAGG - Intergenic
1023181033 7:37484045-37484067 TAATTTACAATAAAATTGGAGGG + Intergenic
1023428892 7:40068935-40068957 AATTTTATAAAGAGATTGACCGG + Intronic
1023441965 7:40193580-40193602 TCTTTTTTAAATAAATTGGCCGG - Intronic
1024906704 7:54390730-54390752 TATTTTATAAAGCATTTAGGAGG + Intergenic
1025722799 7:64031805-64031827 TATTTTATAAAGCCTTTGGGTGG - Intronic
1025744650 7:64232311-64232333 TATTTTACAAAGACCTTGGGTGG - Intronic
1025751825 7:64300625-64300647 TATTTTATAAAGACCTTGGGTGG - Intergenic
1026353437 7:69537113-69537135 TATTTAAAAAAGAAAAAGGACGG + Intergenic
1026530976 7:71196948-71196970 TTTTTTAAAAAAAAATTGGCGGG - Intronic
1027306854 7:76907528-76907550 TATAATAAAAAGAAATAGGATGG - Intergenic
1027578188 7:79957719-79957741 AATTTTATAAATATATTTGAAGG - Intergenic
1027588744 7:80091090-80091112 TATTATATAGACAAAATGGATGG - Intergenic
1027608896 7:80334760-80334782 TATTTTACAACTAAATTAGAAGG - Intergenic
1027644193 7:80776412-80776434 GATTTTATAAAGAAACAGAAAGG - Intronic
1027725320 7:81798074-81798096 TATTTTATAAATAAATTGGAGGG - Intergenic
1028008228 7:85606144-85606166 TATGTTAGATAGACATTGGAAGG + Intergenic
1028033709 7:85951687-85951709 TATTTTATAGAAAAATTTCAAGG - Intergenic
1028126492 7:87119048-87119070 TATTTTACAAGGATATTGGAAGG - Intergenic
1028357692 7:89929317-89929339 GATATTATAAATAAAGTGGAAGG - Intergenic
1028422290 7:90647269-90647291 TATTTTTTATACCAATTGGAAGG - Intronic
1028617810 7:92789755-92789777 TACTTTATAAGGATATTGAAAGG - Intronic
1029354935 7:100044767-100044789 CATTTGCTAAAGAAATTGAAAGG - Intergenic
1030110061 7:106019396-106019418 TTTTTTTTAAAGAAAATGAATGG + Intronic
1030212102 7:107006570-107006592 TATTTTTTAAAAAAATTAGCCGG + Intergenic
1030259501 7:107548244-107548266 AATTTTATAAATAAATGGAATGG - Intronic
1030562152 7:111102069-111102091 TTTTTTTTAAAGAAATTGACAGG - Intronic
1030664655 7:112262625-112262647 TATTTTATAAACAATATAGAGGG + Intronic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1031092750 7:117380360-117380382 TATTTTAAATAAAAATTTGAAGG - Intronic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1031368979 7:120940521-120940543 AATTTTATAATAAAATTGGGGGG + Intergenic
1031485911 7:122324046-122324068 TATTTTACAAAGAAACTGAAAGG - Intronic
1031820133 7:126490370-126490392 GATTTTATAAACAAGATGGAAGG - Intronic
1031858883 7:126955954-126955976 TTTTTAAAAAAGAACTTGGATGG + Intronic
1032942774 7:136814213-136814235 AATTTTCTAAAGAAACTTGATGG + Intergenic
1033996151 7:147351384-147351406 TAGTTTATAAAAAAAATAGAAGG + Intronic
1035396093 7:158535870-158535892 GATTTTAAAAATAAACTGGATGG - Intronic
1035416241 7:158689617-158689639 TATTTCATCATTAAATTGGATGG - Intronic
1035440302 7:158891622-158891644 GATTTTGCAAAGAAATTGGAGGG + Intronic
1035898601 8:3433097-3433119 CGTTTTATACAGAGATTGGAAGG + Intronic
1036105636 8:5835611-5835633 TTTTTTTTAAACAATTTGGAGGG + Intergenic
1036628111 8:10488920-10488942 AATTTTAGAAAGAAATGGAAAGG - Intergenic
1036966324 8:13302068-13302090 TATTTAAAAAAGAAGTTGGTTGG + Intronic
1037012398 8:13859659-13859681 TATTTTTTTAAGGAATAGGATGG - Intergenic
1037110023 8:15154638-15154660 TATTTTGTAAAGAAAATTAAAGG + Intronic
1037253530 8:16924806-16924828 GTTTTTATCAAGAGATTGGAAGG - Intergenic
1037342061 8:17856577-17856599 TATTTTTTAAAAAAATTAGCCGG + Intergenic
1037438068 8:18885465-18885487 TATTTTTTAAAAGAATTGTATGG - Intronic
1037459023 8:19090643-19090665 TATTTTAAAAATAAATTTGTTGG + Intergenic
1037791008 8:21941665-21941687 AATTATATAAGGAAATGGGAGGG + Intronic
1038103716 8:24409889-24409911 AATTTTATACATAAATTGTAAGG - Intergenic
1038423368 8:27448472-27448494 AGTTTTATTATGAAATTGGAAGG + Intronic
1038515186 8:28182219-28182241 TATTTTAGAGAGAAATTGTAGGG - Intronic
1038590959 8:28837405-28837427 TTTCTTATAAATTAATTGGAAGG - Intronic
1038757350 8:30353658-30353680 TATTTTATAAGAAAATTGTGGGG - Intergenic
1038807152 8:30804850-30804872 CACATTATAAAGAATTTGGAAGG + Intronic
1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG + Intergenic
1038977972 8:32722819-32722841 TATTTTATAAGGAAATTAAGTGG + Intronic
1039528056 8:38233626-38233648 TGTTTTATAAAGAATGTGTAAGG + Intronic
1039634681 8:39151595-39151617 TATTTTTTAAATAAATTAAATGG - Intronic
1039950177 8:42164894-42164916 GATTGTATAAATGAATTGGATGG + Intronic
1040069362 8:43177793-43177815 TTTTTGATAACGAAATGGGAGGG + Intronic
1040830157 8:51667067-51667089 AATTCTAGAAAGAAATTGGGTGG - Intronic
1040891459 8:52321271-52321293 TATTTCCTTAAGAAATTGAATGG - Intronic
1041007432 8:53508838-53508860 TTTGTTCTAAAGAATTTGGAGGG + Intergenic
1041303202 8:56434579-56434601 TGATCTAGAAAGAAATTGGAAGG - Intergenic
1041574686 8:59380706-59380728 TATGTTGAAAAGAAATTGTAGGG + Intergenic
1042144460 8:65713642-65713664 TATTTTAGAATCAAATTTGAAGG + Intronic
1042396893 8:68302696-68302718 TATTTACTAAAGAAATTTGAGGG - Intergenic
1042748346 8:72131886-72131908 TATTTAATAAGGAAACTTGAAGG + Intergenic
1042892600 8:73629497-73629519 TATGTTTTAAAAAAATTGCAGGG + Intronic
1043245104 8:77989508-77989530 TATTTTATTTAGACATTGCAGGG + Intergenic
1043273605 8:78365534-78365556 CATTTTGAAAAGAAATTGCAGGG - Intergenic
1043342863 8:79262032-79262054 TATATGATAAAAAAATTAGAAGG - Intergenic
1043515594 8:80992089-80992111 TGTTTTATAGAGAACGTGGATGG - Intronic
1043742787 8:83835064-83835086 TATTTTTTGAACAAAATGGATGG + Intergenic
1044776689 8:95696574-95696596 TATGTTTTAAAGACATTGCAGGG + Intergenic
1044908331 8:97029335-97029357 AATTTTATAAAAAAATGGCAGGG - Intronic
1045895439 8:107210345-107210367 TATTATAAAAAGAAAATGCATGG + Intergenic
1045936359 8:107684249-107684271 TATTTTAGAAAGATCTTGGCTGG + Intergenic
1046089750 8:109487560-109487582 TCTTTTATAGATAAATTGCAAGG - Intronic
1046212676 8:111098973-111098995 TATTCTATCAAGAAATTGCATGG - Intergenic
1047375336 8:124290504-124290526 TATTTTACAACCAAATTGAAGGG + Intergenic
1047421973 8:124714765-124714787 TATTTTAAAAAGAACTGGGCAGG - Intronic
1048631733 8:136250298-136250320 TATTTAATAACAAAGTTGGAGGG + Intergenic
1048694982 8:137017110-137017132 AAATTTAAAAAGTAATTGGATGG - Intergenic
1050793585 9:9507121-9507143 AATTTTAAAAAGAATTTGAATGG + Intronic
1050999923 9:12269234-12269256 TATATTATAAAGGTACTGGAGGG - Intergenic
1051259042 9:15243924-15243946 AATTTTAGAAAGAAAATGGAAGG + Intronic
1051865927 9:21682634-21682656 TATTTAATACAGAAAATGGGTGG - Intergenic
1051988269 9:23118284-23118306 TATTTTTTAAAAAGACTGGAAGG - Intergenic
1052049472 9:23828538-23828560 TATTATGTAAAGAAATTACATGG + Intergenic
1052196486 9:25722147-25722169 TATTTTAAATAGAAACTGAATGG - Intergenic
1052401705 9:28008920-28008942 AATTTCATAAAGAAATTATAAGG + Intronic
1052402345 9:28016421-28016443 AATATTATCAAGAAATAGGAAGG + Intronic
1053482361 9:38424827-38424849 TATTTTATAAAGAGAATATATGG + Intergenic
1054725229 9:68643294-68643316 TATCTTATAAAGAGATTTTAAGG + Intergenic
1055075390 9:72209809-72209831 TATTTTCTAGAGAAAATGAATGG - Intronic
1055327374 9:75144934-75144956 TCTTTAATAAATAAATTGCAAGG - Intronic
1055520557 9:77076561-77076583 TATTTTAAAAAAAAAATGGTGGG - Intergenic
1055773382 9:79741145-79741167 TGTTTTAGAAGGAAATTAGATGG + Intergenic
1055775528 9:79763443-79763465 TATATTCTAAAGAAATAGTAAGG + Intergenic
1055933487 9:81583548-81583570 TATTTTATAAATATATTTGGTGG - Intergenic
1055934686 9:81593554-81593576 TGTTTTATAATGAGATTTGAGGG - Intronic
1056073914 9:83018569-83018591 TTTTTTTAAAAGAAATTGAAAGG + Intronic
1056157540 9:83853535-83853557 GAATTTTTAAAGAAATTGAAAGG - Intronic
1056353003 9:85770562-85770584 GAATTTTTAAAGAAATTGAAAGG + Intergenic
1056453529 9:86739069-86739091 TCTTTCAAAAATAAATTGGATGG + Intergenic
1056562448 9:87743453-87743475 TATTTTATAAAGGAAAAGAAAGG - Intergenic
1057108986 9:92448827-92448849 TATTTTGTAAAGCTAATGGAAGG - Intronic
1057295479 9:93833798-93833820 AAATTTATAAAGAAATTCAAAGG - Intergenic
1057510234 9:95672473-95672495 TATATTAAAAAAAAACTGGAGGG + Intergenic
1057664318 9:97032427-97032449 AATTTGATAAACAATTTGGAAGG - Exonic
1057713192 9:97465796-97465818 TACTTGATAGAGAATTTGGAGGG + Intronic
1058488847 9:105472957-105472979 TATTATATAAAGGAATTACAAGG + Intronic
1058534184 9:105938549-105938571 GATTTTATATAGAAATAAGAAGG - Intergenic
1058636198 9:107040949-107040971 TTTTTTAAAAAGAAAGGGGATGG - Intergenic
1059066333 9:111089151-111089173 TGGTTAATAAAGAAATTGGCTGG - Intergenic
1059176166 9:112171881-112171903 TACTCTTTAAAGAAATTAGAAGG - Intronic
1060259784 9:122064114-122064136 TATTTTAAAAAGATTATGGATGG - Intronic
1060483615 9:124032725-124032747 TCTTTTTTAAAGAAATTGTGGGG - Exonic
1060927671 9:127466393-127466415 TTTTATAGAAAAAAATTGGAGGG - Intronic
1061282176 9:129603729-129603751 TATTTTTTAAAGAGATGGGGGGG + Intergenic
1061355109 9:130098709-130098731 TACTTTATAAAAAAAGTGGCTGG + Intronic
1061470704 9:130823094-130823116 TACCTGATAAAGAACTTGGAAGG - Intronic
1061585050 9:131560605-131560627 TATTTTAAAATTAATTTGGAAGG + Intergenic
1061642982 9:131974202-131974224 TATTATAAAAAGAAATTCCAAGG - Intronic
1061734132 9:132640807-132640829 TACTTAATAAAGAAATTTGTTGG - Intronic
1185953991 X:4468955-4468977 AAGTTTAGAAAGAAAATGGATGG + Intergenic
1186045762 X:5535062-5535084 TATTTTTTAAAAAAATTCTAAGG + Intergenic
1186187406 X:7034948-7034970 TTTTTTATAAAGAAATTATTAGG + Intergenic
1186531185 X:10297478-10297500 AATTTTATAAAAATGTTGGAAGG + Intergenic
1186554266 X:10540859-10540881 TATTTGCTAAAGAAATGGGCAGG + Intronic
1186929957 X:14378227-14378249 TATTTTAAAAAGTATTTCGAAGG + Intergenic
1187720416 X:22144860-22144882 TATTTCATAAATAAATTTCATGG - Intronic
1187815796 X:23230475-23230497 TATTTTATTATGATCTTGGAAGG + Intergenic
1188356298 X:29195890-29195912 AAATTTCTACAGAAATTGGAAGG - Intronic
1189204312 X:39224787-39224809 AATTTTAAAAAGAAAAAGGAGGG + Intergenic
1190003905 X:46716317-46716339 TTTTTAATAAAGAAACTGGCTGG - Intronic
1190690708 X:52910814-52910836 TAATTTCTAAAGAAAATGGGAGG - Intergenic
1190695275 X:52944978-52945000 TAATTTCTAAAGAAAATGGGAGG + Intronic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1191666948 X:63713274-63713296 CAGTTTATAAAGGAAATGGAAGG + Intronic
1191930789 X:66368955-66368977 TATTATTTAAAGAAATTGAAAGG - Intergenic
1192365558 X:70469745-70469767 TATTTTAAAAAGAAATGGATGGG - Intronic
1193193819 X:78606118-78606140 TATGTTTTTAAAAAATTGGAAGG + Intergenic
1193635736 X:83947346-83947368 AATTTTAGAATGCAATTGGAAGG - Intergenic
1194502458 X:94698458-94698480 TATTTTATTAAGAAATAAAATGG + Intergenic
1194770370 X:97896351-97896373 TGATTTAAAAAGATATTGGAAGG + Intergenic
1194775926 X:97964219-97964241 TATTTTACAAAGACATTAAAAGG - Intergenic
1195497154 X:105549875-105549897 GATTTAATAAAGAAGTTGGCCGG - Intronic
1195758298 X:108220800-108220822 TATTTTAATAAGAGATGGGATGG - Intronic
1195913302 X:109911395-109911417 TATTTTAGAAGTAAACTGGAAGG + Intergenic
1196108715 X:111923515-111923537 TATTTTATGAAGAAAATATATGG - Intronic
1196317324 X:114243434-114243456 TACTTTATAAAGATATTGTGAGG + Intergenic
1196933785 X:120708554-120708576 TATTTGTTGAAGAAACTGGATGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1197406470 X:126058750-126058772 TATTTTTTAATGACATTGCAAGG + Intergenic
1197908576 X:131454773-131454795 CATTTTATAATGCAATTTGAGGG + Intergenic
1198171228 X:134107092-134107114 TATTTTGTTAACAAATTAGATGG - Intergenic
1198171267 X:134107597-134107619 TATTTTGTTAACAAATTAGATGG - Intergenic
1198511529 X:137356652-137356674 AATCTTATAGAGAAATTAGAAGG - Intergenic
1198891045 X:141396611-141396633 TATTTTAAAATAAATTTGGATGG - Intergenic
1199029480 X:142979989-142980011 TATTTTATTGAGAAAATAGAAGG + Intergenic
1199534912 X:148891467-148891489 TTTTTAACAAAGAAATTGTATGG + Intronic
1201209620 Y:11667647-11667669 TAGTTTCTAAAGTAATTGAATGG + Intergenic
1201404807 Y:13638856-13638878 AATTTTATACAGAAAGTTGAAGG + Intergenic
1201538136 Y:15074406-15074428 TAGTTTGTATAGAATTTGGAAGG + Intergenic
1201749718 Y:17419691-17419713 TAATTTATAATAGAATTGGATGG + Intergenic