ID: 932900316

View in Genome Browser
Species Human (GRCh38)
Location 2:75691083-75691105
Sequence AGGTGTCCCCTGCAGATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932900316 Original CRISPR AGGTGTCCCCTGCAGATTAG GGG (reversed) Intronic
900564972 1:3327742-3327764 AGGTCTCCCCTGCAGGTGGGTGG - Intronic
904257297 1:29262684-29262706 ATGTGTCCCCTGCAGATATGGGG + Intronic
904336729 1:29802673-29802695 TGGTGTCCCCTGGAAATTATAGG + Intergenic
904859184 1:33521999-33522021 AAATGTCCCTTGCAGATTAAAGG + Intronic
906004266 1:42455774-42455796 AGGTGTCCCTTGCAGAGTCAGGG + Intronic
910076640 1:83288153-83288175 ACGTATCCCCTTCAGATCAGAGG - Intergenic
910180156 1:84473915-84473937 AGGTATCCCCTTCAGGTAAGAGG - Intergenic
910533725 1:88272206-88272228 AGGTGTCCCATGAATATTAATGG + Intergenic
910916430 1:92294368-92294390 ATGTACCCCCTGCAGATAAGTGG - Intronic
911060443 1:93743362-93743384 AGGTGACCCTTCCAGATCAGTGG + Intronic
911061408 1:93751250-93751272 AGGAGTCAGCTGCAGCTTAGGGG - Intronic
912148987 1:106832866-106832888 AGGTGTCCTTTGCAGATTGCAGG + Intergenic
920915579 1:210255455-210255477 GGGAGCCCCCTGCAGATTCGTGG - Intergenic
921078369 1:211718546-211718568 ATGTATCCCCTTCAGATAAGGGG + Intergenic
922196061 1:223361883-223361905 TGGTGTCCACGGCAGATTAGAGG + Intronic
922789569 1:228303839-228303861 AGGTGTGAGCTGCAGATTCGTGG + Exonic
922789674 1:228304467-228304489 AGGTGTGAGCTGCAGATTCGTGG + Exonic
924323763 1:242875078-242875100 AGGTGTCCCCTGCAATTTGAGGG - Intergenic
924866658 1:247990184-247990206 ATGCATCCCCTGCAGATAAGGGG + Intronic
1064769508 10:18709734-18709756 ACGTGTCCCCTGCAGATGATGGG - Intergenic
1065814304 10:29470476-29470498 CGGTGCCCCCTGCAGGTGAGTGG - Exonic
1066135628 10:32442992-32443014 AGGGGTCCCCTGAAGATTTATGG + Intergenic
1067525827 10:47038044-47038066 AGGTGTCCCCAGAAAATTACTGG + Intergenic
1068358537 10:55944601-55944623 ATGTATCCCCTGCAGATAAAGGG + Intergenic
1079146312 11:17855429-17855451 ACATGTCCCCTGAAGATAAGGGG - Intronic
1079960910 11:26921695-26921717 ATGTTTTCCCTGCAGATAAGGGG - Intergenic
1080733798 11:34989334-34989356 AAGTATCCCCTGCAGATAAGGGG + Intronic
1083395236 11:62386579-62386601 ACGTATCCCCTGCAAATAAGGGG + Intronic
1084285384 11:68127897-68127919 AGGGGTCCCCTGCAGAAGGGAGG - Intergenic
1084462219 11:69302404-69302426 AGGTGAGCCCTGCAGGTCAGAGG - Intronic
1087603502 11:100345431-100345453 ATGTGTCCCCTGCAGAATTCAGG - Intronic
1089881186 11:121775269-121775291 ACTTTTCCCCTGCAGATAAGGGG - Intergenic
1090437718 11:126700719-126700741 AGGTTTCACCTGCTGAATAGCGG - Intronic
1091869560 12:3876953-3876975 ATGTATCCCCTGCAGATAAGGGG - Intergenic
1093846150 12:23973595-23973617 ATGTGTCTCCTGCAGTTAAGGGG - Intergenic
1096089238 12:48887591-48887613 ATGTATCCCCTGAAGATAAGGGG - Intergenic
1096473485 12:51894052-51894074 AGGTGTCACTTGCAGAATAGAGG + Intergenic
1097337861 12:58404688-58404710 AGATGTCCACTGCATAATAGGGG - Intergenic
1098850105 12:75586013-75586035 ATGTATCCTCTGCAGATAAGGGG + Intergenic
1099871997 12:88361160-88361182 ACGTATCCCCTGCAGATAAGGGG - Intergenic
1100423978 12:94464994-94465016 ATGTATCCCCAGCAGATAAGGGG - Intergenic
1101428286 12:104605740-104605762 AGGTGTCAACTGCATATTTGTGG + Intronic
1102216940 12:111168358-111168380 ACCTGTCCCCTGCAGATTCCAGG + Intronic
1104025221 12:125021071-125021093 ACCTGTCCCCTGCAGACTGGAGG - Intronic
1104060650 12:125265230-125265252 ATGTATCCCCTGCAGACAAGCGG - Intronic
1104783796 12:131437243-131437265 AGGTGTAGCCTGTAGCTTAGGGG - Intergenic
1105585548 13:21739559-21739581 ATGTGTCCTCTGCACTTTAGGGG - Intergenic
1107152906 13:37132515-37132537 ATGTATCCCCTGCCGATAAGGGG + Intergenic
1108245915 13:48513855-48513877 ATGTATCTCCTGCAGATAAGGGG - Intronic
1117213635 14:53527326-53527348 AGGTGGCCCCTTCAGTTTAATGG - Intergenic
1117572223 14:57058719-57058741 TGATGTCCACTGCAGATTTGTGG - Intergenic
1118574746 14:67231094-67231116 AGATATCCCCTGAAGATGAGGGG + Intergenic
1121401105 14:93678011-93678033 AGGTGTTCTCTGTAGAATAGTGG + Intronic
1122790857 14:104183626-104183648 AGGTGTTCCTTGAGGATTAGGGG + Intergenic
1202868032 14_GL000225v1_random:135741-135763 AGGTGTTCCCTGCAAAAGAGAGG + Intergenic
1202943048 14_KI270726v1_random:1041-1063 GGGTTCCCCCTGCAGATTACTGG + Intergenic
1125923553 15:43542051-43542073 AGCTTTCCCCTTCTGATTAGGGG + Intronic
1126601129 15:50428449-50428471 ACATATCCCCTGCAGATAAGAGG - Intronic
1127491962 15:59473475-59473497 ACGTGTCCCCTGCAGATAAGAGG + Intronic
1128958675 15:71976191-71976213 TGGTGTCCACTGCTTATTAGTGG + Intronic
1130028330 15:80289346-80289368 AGGTGTCCCCAGCAGCTTAAGGG - Intergenic
1131076776 15:89500211-89500233 GCGTGACCCCTGCAGAATAGGGG + Intergenic
1132036232 15:98487106-98487128 AGGTCTCCCCTGCTGAGCAGCGG - Intronic
1134819267 16:17233027-17233049 AGGTGCCCCCTGAAGAGCAGAGG - Intronic
1134868519 16:17630560-17630582 AGGTGTCCCCTGTTGGGTAGAGG - Intergenic
1137021594 16:35433182-35433204 AGGTATCCCCTGGATCTTAGAGG + Intergenic
1137451800 16:48582763-48582785 ACGTATCCCCAGCAGATAAGGGG + Intronic
1137617031 16:49854752-49854774 AGGGGACCCCTGGAGAGTAGAGG - Intronic
1143727866 17:8862147-8862169 GTGTGTCCCCTGCAGGTAAGGGG + Intronic
1146735617 17:35236280-35236302 AGGTGTCCCCTCCATAGTAAAGG - Intergenic
1147196919 17:38773069-38773091 ACATGTCCCCTGCTGATAAGGGG + Intronic
1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG + Intergenic
1148449244 17:47764245-47764267 ACATATCCCCTGCAGATAAGCGG + Intergenic
1149148862 17:53534538-53534560 ATATATCCCCTGCAGATAAGGGG - Intergenic
1150592319 17:66574506-66574528 ATGTATCCCCTGCAGAGAAGGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153340439 18:3967887-3967909 AGGTGTCCAGTGCAGCTGAGAGG - Intronic
1155635529 18:27950543-27950565 AGGTGTCCACTGCAGTTTCCAGG + Intergenic
1158214956 18:55090860-55090882 ACATATCCCCTGCAGATAAGGGG - Intergenic
1158433245 18:57411578-57411600 ATGTATGCCCTGCAGATAAGGGG + Intergenic
1160352867 18:78199969-78199991 AATTGTACCCTGCAGATGAGTGG + Intergenic
1160502174 18:79407086-79407108 AGGTATCACCAGCAGATCAGAGG + Intronic
1161420364 19:4173265-4173287 AGGTGTCCCCTCCGGAGTTGCGG + Intergenic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1164175775 19:22772860-22772882 AGGTGTTCCCTGCACATCTGTGG + Intronic
1164459780 19:28437044-28437066 AGGTGTCCTCAGCAGATCTGAGG + Intergenic
1167163816 19:47784538-47784560 AGTTGTCCCCTGGAGTTTGGGGG + Exonic
925357728 2:3253915-3253937 GGGTGCTCCCTGCAGACTAGAGG - Intronic
926742859 2:16126603-16126625 AGGTGTCCCAGGCAGATGGGTGG - Intergenic
926767859 2:16338095-16338117 AGGTGGCACATGCAGATGAGTGG - Intergenic
927314564 2:21666905-21666927 CAGTGTCCCCTGAAGATTACAGG - Intergenic
927850058 2:26493334-26493356 AGGTGCCCCCTGTAGCTTGGGGG - Intronic
928448975 2:31360823-31360845 ATGTATCTCCTGCAGATAAGGGG + Intronic
931328067 2:61248802-61248824 AGGTATCCCCTGTGGATAAGGGG - Intronic
932299383 2:70655325-70655347 AAGTATCCCCAGCAGATAAGGGG + Intronic
932900316 2:75691083-75691105 AGGTGTCCCCTGCAGATTAGGGG - Intronic
934562556 2:95320736-95320758 ATGTGTCCCCTGGAGTTTGGGGG - Intronic
935305559 2:101733195-101733217 AGGTGTACCCTGCAGGGTTGGGG - Intronic
936973084 2:118193267-118193289 AGGGGAACCCTGCAGATTGGAGG + Intergenic
937201784 2:120208744-120208766 AGGTGTCCCCTACAGATGAGGGG - Intergenic
937244221 2:120482221-120482243 TGGTGTCCCCTGGTGCTTAGAGG - Intergenic
938653147 2:133404322-133404344 ATATATCCCCTGCAGATAAGGGG - Intronic
941829727 2:169941762-169941784 ACGTGTTCCCTGAAGATAAGAGG + Intronic
942634249 2:177985471-177985493 ATGAGTCCCCTGAAGATGAGAGG - Intronic
943583212 2:189708815-189708837 ATGTATCCTCTGCAGATAAGGGG + Intronic
946719856 2:222593091-222593113 ATGTATACCCTGCAGATAAGAGG + Intronic
948051130 2:234980168-234980190 CTGTATCCCCTGCAGATAAGGGG - Intronic
1169254753 20:4088491-4088513 ATGTATCCCCTGCAAATAAGGGG + Intergenic
1170899308 20:20445209-20445231 ATGTATCCCCTGTAGATAAGGGG + Intronic
1173945829 20:46950256-46950278 AAGGTCCCCCTGCAGATTAGTGG - Intronic
1176864887 21:14042158-14042180 AGGTGCCCTCTGCAGATTGATGG - Intergenic
1178104949 21:29307724-29307746 ATGTATCCCCTGTAGATAAGGGG + Intronic
1179180125 21:39037721-39037743 AGTTGTCACCTACAGATCAGAGG + Intergenic
1184093313 22:42303688-42303710 AGGGGACCCTTGCGGATTAGAGG + Intronic
950789813 3:15462910-15462932 AGGTGTCCTCTGAAGGGTAGAGG + Intronic
951996899 3:28740786-28740808 ATGTATCCCCTGCAGATAAAGGG - Intergenic
953038593 3:39234913-39234935 GGGTGTCTCCTTCAGCTTAGAGG + Intergenic
957193238 3:77038457-77038479 AGGTCTCCCTTGCATATTATGGG - Intronic
965610602 3:170539737-170539759 AGGTAGCCCCTGCAGATAAGGGG - Intronic
969038101 4:4272354-4272376 AACTGTCCCCTGCAGATCAAGGG - Intronic
969099668 4:4759504-4759526 ATGTGTCCCTTCCTGATTAGCGG + Intergenic
969130587 4:4988144-4988166 ACATATCCCCTGCAGATAAGGGG - Intergenic
972504691 4:39709654-39709676 ACGTGTCCCCTGTGGATAAGAGG + Intronic
972827730 4:42780382-42780404 ATGTGTCCCCTCCAGATTTCAGG - Intergenic
973766806 4:54170184-54170206 AGTTTTGCCCTGCAGATCAGGGG + Intronic
975168187 4:71201453-71201475 AGATCTCCCCTGCAGAACAGAGG - Intronic
975317547 4:72972217-72972239 ATGTCTCCCCTTCAGATCAGAGG + Intergenic
976409466 4:84696596-84696618 ATGTATCCCCTGTAGATAAGGGG + Intronic
976904549 4:90220277-90220299 AGGTATCCTCTGTAGATAAGGGG + Intronic
977270737 4:94914772-94914794 AGGTGGTCACTGGAGATTAGGGG + Intronic
977896377 4:102370147-102370169 CTGTGCCCCCTGCCGATTAGAGG + Intronic
977924475 4:102684640-102684662 GCGTATCCCCTGCAGATAAGGGG - Intronic
979653220 4:123160738-123160760 ATGTATCCGCTGCAGATAAGGGG - Intronic
983224168 4:165070981-165071003 ATGTTTCCCCTGTAGATAAGGGG - Intergenic
983984995 4:174048567-174048589 AGGTGTCCCATGTACAGTAGTGG + Intergenic
984285049 4:177718555-177718577 ACATTTCCCCTGCAGATGAGGGG - Intergenic
985005474 4:185531076-185531098 ATGTGTCCCCTGTGGATGAGAGG + Intronic
988946046 5:36201052-36201074 ACTTGTCCCCTGCGGATAAGAGG + Intronic
989444301 5:41510089-41510111 TGGTTTCTCCTGCAGATTTGGGG - Intronic
991674199 5:69075542-69075564 AGGTGGCCCCTGCCGTTGAGGGG + Intergenic
991730175 5:69578215-69578237 ATGTATCCTCTGCAGATAAGAGG + Intronic
991806609 5:70433373-70433395 ATGTATCCTCTGCAGATAAGAGG + Intergenic
991864778 5:71049633-71049655 ATGTATCCTCTGCAGATAAGAGG - Intronic
992033719 5:72750048-72750070 AGGTATCCACTGAAGATAAGGGG + Intergenic
994228173 5:97279184-97279206 ATGTATCCCCTGCAGATAAGTGG + Intergenic
994287283 5:97984512-97984534 AGGTATCCCCTGTGGATAAGGGG + Intergenic
996033312 5:118731088-118731110 AAGTGTCCCATGCAAATGAGGGG - Intergenic
996612487 5:125399297-125399319 AGGAGTCCCCTTAAGATCAGAGG + Intergenic
996841808 5:127854592-127854614 AAGTATCCCCTGCAAATAAGGGG + Intergenic
997362718 5:133305430-133305452 AGGTGTCCCAGGCAGGTGAGGGG - Intronic
997909740 5:137858730-137858752 ATGTGTCCCCTGCAGATAAGGGG + Intergenic
1000015688 5:157273549-157273571 AGTTCACCCCTGCAGTTTAGGGG + Intronic
1001434221 5:171686859-171686881 GGGTGTCCCCAGCAGAGGAGTGG + Intergenic
1003947997 6:11093051-11093073 AGGTGCCCCCAGAAGAATAGAGG - Intergenic
1007003621 6:38338107-38338129 ACATATCCCCTGCAGATAAGGGG - Intronic
1008771932 6:54989579-54989601 AAGTATCCCCTGGAGATAAGGGG - Intergenic
1012886635 6:104853803-104853825 ATGTATCCCCTGCGGATAAGTGG - Intronic
1013547109 6:111169186-111169208 ATGTATTTCCTGCAGATTAGAGG + Intronic
1015661095 6:135574195-135574217 AGGTGACAGCTGAAGATTAGTGG + Intergenic
1015852641 6:137589519-137589541 AGGTGGCAACTGCAGATAAGAGG - Intergenic
1017096173 6:150807289-150807311 ACATATCCCCTGCAGATAAGAGG + Intronic
1017763057 6:157585857-157585879 AGGTGTCCTCTGCAAGTGAGGGG + Intronic
1021394577 7:20131459-20131481 ATGTATCCCCTGCAGATAAGGGG - Intergenic
1022312098 7:29206921-29206943 AGTTGTCCCCTGCGGCTGAGAGG + Intronic
1023714158 7:43026323-43026345 AGCAGTCCCCTGGAGAGTAGAGG + Intergenic
1024175178 7:46832808-46832830 ATGTATCTCCTGCAGATAAGGGG + Intergenic
1025774742 7:64550508-64550530 AGGTGTCACCTGCAGATTTATGG + Intronic
1027000597 7:74650975-74650997 ATGTGTCCCCCACAGATAAGAGG + Intergenic
1027294403 7:76753326-76753348 ACGTATCCCCTTCAGATCAGAGG - Intergenic
1027800811 7:82746891-82746913 AGGTATCCCCTGCAAAGTAAAGG + Intergenic
1027842466 7:83330491-83330513 AGGTCTCCCCTGCAGAAGACTGG + Intergenic
1036600228 8:10254026-10254048 AGGAGTCCCCGGCAGATCGGAGG - Intronic
1037843290 8:22260796-22260818 ACTTGTCCCCTGCAGATAGGAGG - Intergenic
1038453538 8:27656365-27656387 ATGTATCCCCTGCAGGTAAGAGG + Intronic
1042188739 8:66164469-66164491 AGGTGGCCTCTGCAGTTTTGTGG - Intronic
1042244299 8:66695253-66695275 ATGTATCTCCTGCAGATAAGGGG - Intronic
1042302988 8:67305769-67305791 ATATATCCCCTGCAGATAAGGGG - Intronic
1042793119 8:72630922-72630944 ACGTATCCCCTGTAGATAAGGGG - Intronic
1043282666 8:78487794-78487816 ACATATCCCCTGCAGATAAGGGG - Intergenic
1043372988 8:79613550-79613572 AGGTTTCCGCTGCAGGCTAGTGG + Intronic
1044122999 8:88421019-88421041 ATGTATCCCCTGCAGATAAAAGG - Intergenic
1044782732 8:95760124-95760146 ATGTATTCCCTGCAGATAAGGGG + Intergenic
1045062246 8:98420532-98420554 ATGTATCCCCTGCAGATAAGGGG + Intronic
1046259523 8:111748555-111748577 ATGTATCCCTTGCAGATAAGCGG - Intergenic
1046792617 8:118338008-118338030 AGGTATCCCCTACAGATAAGGGG + Intronic
1046801693 8:118435450-118435472 ATGTTTCCCTTGCAGATGAGGGG + Intronic
1047452929 8:124982741-124982763 ATGTGTCCCCAGCAGATAAGGGG + Intergenic
1047898524 8:129394070-129394092 AGGTATCCCCCACAGATAAGTGG - Intergenic
1048230447 8:132635484-132635506 AGGTGGGCCCTGCAGTATAGTGG - Intronic
1049745791 8:144262781-144262803 CGGTGTACCCTGCAGGTGAGGGG - Intronic
1054854682 9:69885725-69885747 AGGTGACCGCTGAAGAATAGTGG - Intronic
1054965812 9:71026026-71026048 AAGTGTCCATGGCAGATTAGAGG - Intronic
1059096685 9:111423966-111423988 AGATGTCACCTGCAGGTAAGGGG + Intronic
1060488934 9:124067829-124067851 ATTTCTCCCCTACAGATTAGAGG - Intergenic
1062048860 9:134437096-134437118 AGCTGTCCCCTCCTGATTAGGGG - Intronic
1187096335 X:16152357-16152379 AGGTGTCCACCTCAGAGTAGTGG - Exonic
1188619358 X:32201068-32201090 ATGTATCCCCTACAGATAAGGGG - Intronic
1190106341 X:47563453-47563475 ACATGTACCCTGCAGATAAGGGG - Intronic
1196624273 X:117860288-117860310 AGATGTCCCCTGAAGTTTTGTGG - Intergenic
1198775462 X:140174156-140174178 ATGTATCCCCTGCAAATAAGGGG - Intergenic
1201465603 Y:14277134-14277156 AGGTGTCCCCTACAGAGTGTGGG + Intergenic
1201719637 Y:17082491-17082513 AAGTGTGCCCTGCAGATGGGAGG - Intergenic