ID: 932910702

View in Genome Browser
Species Human (GRCh38)
Location 2:75803287-75803309
Sequence TTAAAAGGCTGAACTAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932910702_932910705 -3 Left 932910702 2:75803287-75803309 CCTAATCTAGTTCAGCCTTTTAA No data
Right 932910705 2:75803307-75803329 TAAAGTTACTGAATCTCGGAAGG No data
932910702_932910704 -7 Left 932910702 2:75803287-75803309 CCTAATCTAGTTCAGCCTTTTAA No data
Right 932910704 2:75803303-75803325 CTTTTAAAGTTACTGAATCTCGG No data
932910702_932910706 14 Left 932910702 2:75803287-75803309 CCTAATCTAGTTCAGCCTTTTAA No data
Right 932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG No data
932910702_932910707 30 Left 932910702 2:75803287-75803309 CCTAATCTAGTTCAGCCTTTTAA No data
Right 932910707 2:75803340-75803362 TTAAAGGTCACACAATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932910702 Original CRISPR TTAAAAGGCTGAACTAGATT AGG (reversed) Intergenic
No off target data available for this crispr